De novo assembly of complex genomes using single molecule sequencing
|
|
|
- Claribel Barrett
- 5 years ago
- Views:
Transcription
1 De novo assembly of complex genomes using single molecule sequencing Michael Schatz Jan 14, 2014 PAG / #PAGXXII
2 1. Shear & Sequence DNA Assembling a Genome 2. Construct assembly graph from overlapping reads AGCCTAGGGATGCGCGACACGT GGATGCGCGACACGTCGCATATCCGGTTTGGTCAACCTCGGACGGAC CAACCTCGGACGGACCTCAGCGAA 3. Simplify assembly graph
3 Assembly Complexity A" R" B" R" C" R" B" A" R" C"
4 Assembly Complexity A" R" B" R" C" R" A" R" B" R" C" R" A" R" B" R" C" R"
5 Single Molecule Sequencing Technology PacBio RS II Moleculo Oxford Nanopore
6 PacBio Assembly Algorithms PBJelly PacBioToCA & ECTools HGAP & Quiver Gap Filling and Assembly Upgrade English et al (2012) PLOS One. 7(11): e47768 Hybrid/PB-only Error Correction Koren, Schatz, et al (2012) Nature Biotechnology. 30: PB-only Correction & Polishing Chin et al (2013) Nature Methods. 10: < 5x PacBio Coverage > 50x
7 What should we expect from an assembly?
8 S. cerevisiae W303 PacBio RS II sequencing at CSHL by Dick McCombie Size selection using an 7 Kb elution window on a BluePippin device from Sage Science Over 175x coverage in 2 days using P5-C3 Mean: x over 10kbp 8.7x over 20kb Max: 36,861bp
9 S. cerevisiae W303 S288C Reference sequence 12.1Mbp; 16 chromo + mitochondria; N50: 924kbp PacBio assembly using HGAP + Celera Assembler 12.4Mbp; 21 non-redundant contigs; N50: 811kbp; >99.8% id
10 S. cerevisiae W303 S288C Reference sequence 12.1Mbp; 16 chromo + mitochondria; N50: 924kbp PacBio assembly using HGAP + Celera Assembler 12.4Mbp; 21 non-redundant contigs; N50: 811kbp; >99.8% id 35kbp repeat cluster Near-perfect assembly: All but 1 chromosome assembled as a single contig
11 A. thaliana Ler-0 A. thaliana Ler-0 sequenced at PacBio Sequenced using the previous P4 enzyme and C2 chemistry Size selection using an 8 Kb to 50 Kb elution window on a BluePippin device from Sage Science Total coverage >119x Genome size: Mbp Chromosome N50: 23.0 Mbp Raw data: 11 Gb Sum of Contig Lengths: 149.5Mb N50 Contig Length: 8.4 Mb Number of Contigs: 1788 High quality assembly of chromosome arms Assembly Performance: 8.4Mbp/23Mbp = 36% MiSeq assembly: 63kbp/23Mbp [.2%]
12 Hybrid Approaches for Larger Genomes PacBioToCA fails in complex regions 1. Error Dense Regions Difficult to compute overlaps with many errors 2. Simple Repeats Kmer Frequency Too High to Seed Overlaps 3. Extreme GC Lacks Illumina Coverage Observed Coverage Coverage Error Rate Observed Error Rate
13 ECTools: Error Correction with pre-assembled reads Short&Reads&,>&Assemble&Uni5gs&,>&Align&&&Select&,&>&Error&Correct&& & " Can"Help"us"overcome:" 1. Error"Dense"Regions" "Longer"sequences"have"more"seeds"to"match" 2. Simple"Repeats" "Longer"sequences"easier"to"resolve& & However,&cannot&overcome&Illumina&coverage&gaps&&&other&biases& &
14 O. sativa pv Nipponbare Genome size: 370 Mb Chromosome N50: 29.7 Mbp 19x PacBio C2XL sequencing at CSHL from Summer 2012 Assembly MiSeq Fragments 23x 459bp 8x 450 Contig NG50 6,332 ALLPATHS-recipe 18,248 PacBioToCA 50,995 50x x x ** MiSeq for correction ECTools 3500 ** MiSeq for correction 155,695
15 Assembly Complexity of Long Reads M.jannaschii (Euryarchaeota) C.hydrogenoformans (Firmicutes) E.coli(Eubacteria) Y.pestis(Proteobacteria) B.anthracis(Firmicutes) A.mirum(Actinobacteria) S.cerevisiae(Yeast) Y.lipolytica(Fungus) D.discoideum(Slime mold) N.crassa (Red bread mold) C.intestinalis(Sea squirt) C.elegans(Roundworm) C.reinhardtii(Green algae) A.taliana(Arabidopsis) D.melanogaster(Fruitfly) P.persica(Peach) Target Percentage O.sativa(Rice) P.trichocarpa(Poplar) S.lycopersicum(Tomato) G.max(Soybean) M.gallopavo(Turkey) D.rerio(Zebrafish) A.carollnensis(Lizard) Z.mays(Corn) M.musculus(Mouse) H.sapiens(Human) 100% 90% Assembly N50 / Chromosome N50 80% 70% 60% 50% 40% 30% 20% 10% 0 mean1 ( 3,650 ± 140bp) SVR Fit ( 3,650 ± 140bp) C Genome Size Assembly complexity of long read sequencing Lee, H*, Gurtowski, J*, Yoo, S, Marcus, S, McCombie, WR, Schatz MC et al. (2014) In preparation
16 Assembly Complexity of Long Reads M.jannaschii (Euryarchaeota) C.hydrogenoformans (Firmicutes) E.coli(Eubacteria) Y.pestis(Proteobacteria) B.anthracis(Firmicutes) A.mirum(Actinobacteria) S.cerevisiae(Yeast) Y.lipolytica(Fungus) D.discoideum(Slime mold) N.crassa (Red bread mold) C.intestinalis(Sea squirt) C.elegans(Roundworm) C.reinhardtii(Green algae) A.taliana(Arabidopsis) D.melanogaster(Fruitfly) P.persica(Peach) Target Percentage O.sativa(Rice) P.trichocarpa(Poplar) S.lycopersicum(Tomato) G.max(Soybean) M.gallopavo(Turkey) D.rerio(Zebrafish) A.carollnensis(Lizard) Z.mays(Corn) M.musculus(Mouse) H.sapiens(Human) 100% 90% Assembly N50 / Chromosome N50 80% 70% 60% 50% 40% 30% 20% 10% 0 mean2 ( 7,400 ± 245bp) mean1 ( 3,650 ± 140bp) SVR Fit ( 7,400 ± 245bp) SVR Fit ( 3,650 ± 140bp) C C Genome Size Assembly complexity of long read sequencing Lee, H*, Gurtowski, J*, Yoo, S, Marcus, S, McCombie, WR, Schatz MC et al. (2014) In preparation
17 Assembly Complexity of Long Reads M.jannaschii (Euryarchaeota) C.hydrogenoformans (Firmicutes) E.coli(Eubacteria) Y.pestis(Proteobacteria) B.anthracis(Firmicutes) A.mirum(Actinobacteria) S.cerevisiae(Yeast) Y.lipolytica(Fungus) D.discoideum(Slime mold) N.crassa (Red bread mold) C.intestinalis(Sea squirt) C.elegans(Roundworm) C.reinhardtii(Green algae) A.taliana(Arabidopsis) D.melanogaster(Fruitfly) P.persica(Peach) O.sativa(Rice) P.trichocarpa(Poplar) S.lycopersicum(Tomato) G.max(Soybean) M.gallopavo(Turkey) D.rerio(Zebrafish) A.carollnensis(Lizard) Z.mays(Corn) M.musculus(Mouse) H.sapiens(Human) 100% 90% Assembly N50 / Chromosome N50 Target Percentage 80% 70% 60% 50% 40% 30% 20% 10% 0 mean8 (30,000 ± 692bp) mean4 (15,000 ± 435bp) mean2 ( 7,400 ± 245bp) mean1 ( 3,650 ± 140bp) SVR Fit (30,000 ± 692bp) SVR Fit (15,000 ± 435bp) SVR Fit ( 7,400 ± 245bp) SVR Fit ( 3,650 ± 140bp) C5???? C4???? C C Genome Size Assembly complexity of long read sequencing Lee, H*, Gurtowski, J*, Yoo, S, Marcus, S, McCombie, WR, Schatz MC et al. (2014) In preparation
18 Summary Long read sequencing of eukaryotic genomes is here Recommendations < 100 Mbp: 100x PB C3-P5 expect near perfect chromosome arms < 1GB: 100x PB C3-P5 expect high quality assembly: contig N50 over 1Mbp > 1GB: hybrid/gap filling expect contig N50 to be 100kbp 1Mbp > 5GB: mschatz@cshl.edu Caveats Model only as good as the available references (esp. haploid sequences) Technologies are quickly improving, exciting new scaffolding technologies
19 Acknowledgements Schatz Lab James Gurtowski Hayan Lee Shoshana Marcus Alejandro Wences Giuseppe Narzisi Srividya Ramakrishnan Rob Aboukhalil Mitch Bekritsky Charles Underwood Tyler Gavin Greg Vurture Eric Biggers Aspyn Palatnick CSHL McCombie Lab Hannon Lab Gingeras Lab Jackson Lab Iossifov Lab Levy Lab Lippman Lab Lyon Lab Martienssen Lab Tuveson Lab Ware Lab Wigler Lab NBACC Serge Koren Adam Phillippy
20 Thank You! / #PAGXXII Variant Calling and 4:25 in the KBase Workshop
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II
A near perfect de novo assembly of a eukaryotic genome using sequence reads of greater than 10 kilobases generated by the Pacific Biosciences RS II W. Richard McCombie Disclosures Introduction to the challenge
Hybrid Error Correction and De Novo Assembly with Oxford Nanopore
Hybrid Error Correction and De Novo Assembly with Oxford Nanopore Michael Schatz Jan 13, 2015 PAG Bioinformatics @mike_schatz / #PAGXXIII Oxford Nanopore MinION Thumb drive sized sequencer powered over
The Resurgence of Reference Quality Genomes
The Resurgence of Reference Quality Genomes Michael Schatz April 9, 2015 UMN-MSI: Advances in Genome Assembly Outline 1. Assembly Fundamentals 2. PacBio Sequencing of Rice 3. Oxford Nanopore Sequencing
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab'
Current'Advances'in'Sequencing' Technology' James'Gurtowski' Schatz'Lab' Outline' 1. Assembly'Review' 2. Pacbio' Technology'Overview' Data'CharacterisFcs' Algorithms' Results' 'Assemblies' 3. Oxford'Nanopore'
The Resurgence of Reference Quality Genome Sequence
The Resurgence of Reference Quality Genome Sequence Michael Schatz Jan 12, 2016 PAG IV @mike_schatz / #PAGIV Genomics Arsenal in the year 2015 Sample Preparation Sequencing Chromosome Mapping Summary &
Single cell & single molecule analysis of cancer
Single cell & single molecule analysis of cancer Michael Schatz October 22, 2015 JHU Genomics Symposium Schatzlab Overview Human Genetics Role of mutations in disease Narzisi et al. (2015) Iossifov et
SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing
SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing Michael Schatz May 10, 2012 Biology of Genomes @mike_schatz / #bog12 Ingredients for a
Long Read Sequencing Technology
Long Read Sequencing Technology - Algorithms and its applications - Hayan Lee@Schatz Lab May 18, 2015 Graduate Student Symposium Simons Center for Quantitative Biology 1 Outline Background Long read sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing
Looking Ahead: Improving Workflows for SMRT Sequencing Jonas Korlach FIND MEANING IN COMPLEXITY Pacific Biosciences, the Pacific Biosciences logo, PacBio, SMRT, and SMRTbell are trademarks of Pacific Biosciences
SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing
SMRT-assembly Error correction and de novo assembly of complex genomes using single molecule, real-time sequencing Michael Schatz Jan 17, 2012 PAG-XX: PacBio Workshop @mike_schatz / #PAGXX Outline 1. SMRT-sequencing
Heterozygosity, Phased Genomes, and Personalized-omics
Heterozygosity, Phased Genomes, and Personalized-omics Michael Schatz January 12, 2017 UMD CBCB Schatzlab Overview Human Genetics Role of mutations in disease Fang et al. (2016) Narzisi et al. (2015) Agricultural
Genome Assembly. J Fass UCD Genome Center Bioinformatics Core Friday September, 2015
Genome Assembly J Fass UCD Genome Center Bioinformatics Core Friday September, 2015 From reads to molecules What s the Problem? How to get the best assemblies for the smallest expense (sequencing) and
Assembly and Validation of Large Genomes from Short Reads Michael Schatz. March 16, 2011 Genome Assembly Workshop / Genome 10k
Assembly and Validation of Large Genomes from Short Reads Michael Schatz March 16, 2011 Genome Assembly Workshop / Genome 10k A Brief Aside 4.7GB / disc ~20 discs / 1G Genome X 10,000 Genomes = 1PB Data
Whole Genome Assembly and Alignment Michael Schatz. Nov 5, 2013 SBU Graduate Genetics
Whole Genome Assembly and Alignment Michael Schatz Nov 5, 2013 SBU Graduate Genetics Outline 1. *-seq review 2. Assembly theory 1. Assembly by analogy 2. De Bruijn and Overlap graph 3. Coverage, read length,
De Novo and Hybrid Assembly
On the PacBio RS Introduction The PacBio RS utilizes SMRT technology to generate both Continuous Long Read ( CLR ) and Circular Consensus Read ( CCS ) data. In this document, we describe sequencing the
Reference-quality diploid genomes without de novo assembly
Reference-quality diploid genomes without de novo assembly Michael Schatz January 16, 2018 PAG Bioinformatics Workshop @mike_schatz / #PAGVI Why NT de novo? De novo is necessary for the first genome of
Long read sequencing technologies and its applications
Long read sequencing technologies and its applications Hayan Lee Ph.D. Computer Science Simons postdoctoral fellow @ Lawrence Berkeley National Laboratory Research fellow @ Simons Institute of the theory
De novo whole genome assembly
De novo whole genome assembly Qi Sun Bioinformatics Facility Cornell University Sequencing platforms Short reads: o Illumina (150 bp, up to 300 bp) Long reads (>10kb): o PacBio SMRT; o Oxford Nanopore
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Minghui Wang Bioinformatics Facility Cornell University DNA Sequencing Platforms Illumina sequencing (100 to 300 bp reads) Overlapping reads ~180bp fragment
A Roadmap to the De-novo Assembly of the Banana Slug Genome
A Roadmap to the De-novo Assembly of the Banana Slug Genome Stefan Prost 1 1 Department of Integrative Biology, University of California, Berkeley, United States of America April 6th-10th, 2015 Outline
Analysis of Structural Variants using 3 rd generation Sequencing
Analysis of Structural Variants using 3 rd generation Sequencing Michael Schatz January 12, 2016 Bioinformatics / PAG XXIV @mike_schatz / #PAGXXIV Analysis of Structural Variants using 3 rd generation
De novo whole genome assembly
De novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell University Data generation Sequencing Platforms Short reads: Illumina Long reads: PacBio; Oxford Nanopore Contiging/Scaffolding
Error correction and assembly complexity of single molecule sequencing reads
Error correction and assembly complexity of single molecule sequencing reads June 18, 2014 Hayan Lee 1,2, James Gurtowski 1,3, Shinjae Yoo 4, Shoshana Marcus 1, W. Richard McCombie 5, and Michael Schatz
DNA Sequencing and Assembly
DNA Sequencing and Assembly CS 262 Lecture Notes, Winter 2016 February 2nd, 2016 Scribe: Mark Berger Abstract In this lecture, we survey a variety of different sequencing technologies, including their
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
Sequencing Pitfalls. Michael Schatz. July 16, 2013 URP Bioinformatics
Sequencing Pitfalls Michael Schatz July 16, 2013 URP Bioinformatics Advances in Sequencing: Zeroth, First, Second Generation 1970s: 0 th Gen Radioactive Chain Termination 5000bp / week 1980s-1990s: 1 st
De novo genome assembly with next generation sequencing data!! "
De novo genome assembly with next generation sequencing data!! " Jianbin Wang" HMGP 7620 (CPBS 7620, and BMGN 7620)" Genomics lectures" 2/7/12" Outline" The need for de novo genome assembly! The nature
De Novo Assembly of High-throughput Short Read Sequences
De Novo Assembly of High-throughput Short Read Sequences Chuming Chen Center for Bioinformatics and Computational Biology (CBCB) University of Delaware NECC Third Skate Genome Annotation Workshop May 23,
100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes
100 Genomes in 100 Days: The Structural Variant Landscape of Tomato Genomes Michael Schatz January 15, 2019 PAG2019 Bioinformatics Workshop @mike_schatz Tomato Domestication & Agriculture Tomatoes are
Next Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
RNA sequencing with the MinION at Genoscope
RNA sequencing with the MinION at Genoscope Jean-Marc Aury jmaury@genoscope.cns.fr @J_M_Aury December 13, 2017 RNA workshop, Genoscope Overview Genoscope Overview MinION sequencing at Genoscope RNA-Seq
MinION, GridION, how does Nanopore technology meet the needs of our users?
MinION, GridION, how does Nanopore technology meet the needs of our users? Journée Long Reads GeT 28 Novembre 2017 Catherine Zanchetta & Maxime Manno get@genotoul.fr @get_genotoul 1 Wet Lab Nanopore technology
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics
Exploiting novel rice baseline datasets: WGS, BAC-based platinum genome sequencing and full-length transcriptomics Dario Copetti, PhD Arizona Genomics Institute The University of Arizona International
100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES
Nanopore Community Meeting 2018 100 GENOMES IN 100 DAYS: THE STRUCTURAL VARIANT LANDSCAPE OF TOMATO GENOMES Michael Schatz Johns Hopkins University, Baltimore, MD @mike_schatz @NanoporeConf #NanoporeConf
De novo assembly of human genomes with massively parallel short read sequencing. Mikk Eelmets Journal Club
De novo assembly of human genomes with massively parallel short read sequencing Mikk Eelmets Journal Club 06.04.2010 Problem DNA sequencing technologies: Sanger sequencing (500-1000 bp) Next-generation
Overview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
Whole Genome Assembly and Alignment Michael Schatz. Nov 20, 2013 CSHL Advanced Sequencing
Whole Genome Assembly and Alignment Michael Schatz Nov 20, 2013 CSHL Advanced Sequencing Outline 1. Assembly theory 1. Assembly by analogy 2. De Bruijn and Overlap graph 3. Coverage, read length, errors,
Oxford Nanopore Sequencing and de novo Assembly of a Eukaryotic Genome Supplemental Notes and Figures
Oxford Nanopore Sequencing and de novo Assembly of a Eukaryotic Genome Supplemental Notes and Figures Table of Contents Supplemental Note 1. Flowcell performance... 2 Supplemental Note 2. Nanopore sequencing
Sequence Assembly and Alignment. Jim Noonan Department of Genetics
Sequence Assembly and Alignment Jim Noonan Department of Genetics james.noonan@yale.edu www.yale.edu/noonanlab The assembly problem >>10 9 sequencing reads 36 bp - 1 kb 3 Gb Outline Basic concepts in genome
Using New ThiNGS on Small Things. Shane Byrne
Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion
A shotgun introduction to sequence assembly (with Velvet) MCB Brem, Eisen and Pachter
A shotgun introduction to sequence assembly (with Velvet) MCB 247 - Brem, Eisen and Pachter Hot off the press January 27, 2009 06:00 AM Eastern Time llumina Launches Suite of Next-Generation Sequencing
The Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
Next-generation sequencing Technology Overview
Next-generation sequencing Technology Overview UQ Winter School 2018 Christopher Noune, PhD AGRF Melbourne christopher.noune@agrf.org.au What is NGS? Ion Torrent PGM (Thermo-Fisher) MiSeq (Illumina) High-Throughput
Sequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
Next Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing
Comprehensive Views of Genetic Diversity with Single Molecule, Real-Time (SMRT) Sequencing Alix Kieu Cruse November 2015 For Research Use Only. Not for use in diagnostics procedures. Copyright 2015 by
Genome Sequencing and Assembly
Genome Sequencing and Assembly History of Sequencing What was the first fully sequenced nucleic acid? Yeast trna (alanine trna) Robert Holley 1965 Image: Wikipedia History of Sequencing Sequencing began
Genome Assembly CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2018
Genome Assembly CHRIS FIELDS MAYO-ILLINOIS COMPUTATIONAL GENOMICS WORKSHOP, JUNE 19, 2018 Overview What is genome assembly? Steps in a genome assembly Planning an assembly project QC assessment of assemblies
High Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
Genomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
The Basics of Understanding Whole Genome Next Generation Sequence Data
The Basics of Understanding Whole Genome Next Generation Sequence Data Heather Carleton-Romer, MPH, Ph.D. ASM-CDC Infectious Disease and Public Health Microbiology Postdoctoral Fellow PulseNet USA Next
TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
Genomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
Sequencing techniques
Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing
Applications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing
Applications of PacBio Single Molecule, Real- Time (SMRT) DNA Sequencing Stephen Turner November 5, 2014 FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Pacific
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora
Genome Assembly of the Obligate Crassulacean Acid Metabolism (CAM) Species Kalanchoë laxiflora Jerry Jenkins 1, Xiaohan Yang 2, Hengfu Yin 2, Gerald A. Tuskan 2, John C. Cushman 3, Won Cheol Yim 3, Jason
Analytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
Introduction to the MiSeq
Introduction to the MiSeq 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, BeadArray, BeadXpress, cbot, CSPro, DASL, Eco, Genetic Energy, GAIIx, Genome Analyzer, GenomeStudio, GoldenGate,
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Matthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
The Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun
The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Optimizing Blue Pippin Size- Selection for Increased SubRead Lengths on the RSII Applications in Clinical Genomics
Optimizing Blue Pippin Size- Selection for Increased SubRead Lengths on the RSII Applications in Clinical Genomics Robert P. Sebra, Ph.D. Icahn School of Medicine at Mount Sinai Icahn Institute for Genomics
Bioinformatics. Dick de Ridder. Tuinbouw Digitaal, 12/11/15
Bioinformatics Dick de Ridder Tuinbouw Digitaal, 12/11/15 Bioinformatics is not Bioinformatics is also not Bioinformatics Bioinformatics (2) Bioinformatics (3) US National Institutes of Health (NIH): Bioinformatics:
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were
Supplementary Figure 1 Genotyping by Sequencing (GBS) pipeline used in this study to genotype maize inbred lines. The 14,129 maize inbred lines were processed following GBS experimental design 1 and bioinformatics
Genome Sequencing & Assembly Michael Schatz. April 21, 2013 CSHL Genome Access
Genome Sequencing & Assembly Michael Schatz April 21, 2013 CSHL Genome Access Outline 1. Assembly theory 1. Assembly by analogy 2. De Bruijn and Overlap graph 3. Coverage, read length, errors, and repeats
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
Alignment and Assembly
Alignment and Assembly Genome assembly refers to the process of taking a large number of short DNA sequences and putting them back together to create a representation of the original chromosomes from which
NGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
Fast-SG: an alignment-free algorithm for hybrid assembly
GigaScience, 7, 2018, 1 15 doi: 10.1093/gigascience/giy048 Advance Access Publication Date: 5 May 2018 Technical Note TECHNICAL NOTE Fast-SG: an alignment-free algorithm for hybrid assembly Alex Di Genova
BIOINFORMATICS ORIGINAL PAPER
BIOINFORMATICS ORIGINAL PAPER Vol. 27 no. 21 2011, pages 2957 2963 doi:10.1093/bioinformatics/btr507 Genome analysis Advance Access publication September 7, 2011 : fast length adjustment of short reads
Understanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
Third Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
Figure S1. Data flow of de novo genome assembly using next generation sequencing data from multiple platforms.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Supplemental Figures Figure S1. Data flow of de novo genome assembly using next generation sequencing data from
Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL)
Genome Sequence of Medicago sativa: Cultivated Alfalfa at the Diploid Level (CADL) Maria J. Monteros, Joann Mudge, Andrew D. Farmer, Nicholas P. Devitt, Diego A. Fajardo, Thiru Ramaraj, Xinbin Dai, Zhaohong
High Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
Genome Projects. Part III. Assembly and sequencing of human genomes
Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences
NGS technologies: a user s guide. Karim Gharbi & Mark Blaxter
NGS technologies: a user s guide Karim Gharbi & Mark Blaxter genepool-manager@ed.ac.uk Natural history of sequencing 2 Brief history of sequencing 100s bp throughput 100 Gb 1977 1986 1995 1999 2005 2007
Detecting Structural Variants in PacBio Reads Tools and Applications
Detecting Structural Variants in PacBio Reads Tools and Applications Aaron Wenger 2017-06-28 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences of California,
De novo Genome Assembly
De novo Genome Assembly A/Prof Torsten Seemann Winter School in Mathematical & Computational Biology - Brisbane, AU - 3 July 2017 Introduction The human genome has 47 pieces MT (or XY) The shortest piece
Plant Breeding and Agri Genomics. Team Genotypic 24 November 2012
Plant Breeding and Agri Genomics Team Genotypic 24 November 2012 Genotypic Family: The Best Genomics Experts Under One Roof 10 PhDs and 78 MSc MTech BTech ABOUT US! Genotypic is a Genomics company, which
Aaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop
Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10
Assembly of Ariolimax dolichophallus using SOAPdenovo2
Assembly of Ariolimax dolichophallus using SOAPdenovo2 Charles Markello, Thomas Matthew, and Nedda Saremi Image taken from Banana Slug Genome Project, S. Weber SOAPdenovo Assembly Tool Short Oligonucleotide
NOW GENERATION SEQUENCING. Monday, December 5, 11
NOW GENERATION SEQUENCING 1 SEQUENCING TIMELINE 1953: Structure of DNA 1975: Sanger method for sequencing 1985: Human Genome Sequencing Project begins 1990s: Clinical sequencing begins 1998: NHGRI $1000
Next Generation Sequencing (NGS)
Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next
How much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?
Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
Analysing genomes and transcriptomes using Illumina sequencing
Analysing genomes and transcriptomes using Illumina uencing Dr. Heinz Himmelbauer Centre for Genomic Regulation (CRG) Ultrauencing Unit Barcelona The Sequencing Revolution High-Throughput Sequencing 2000
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018
How much sequencing do I need? Emily Crisovan Genomics Core September 26, 2018 How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing
Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Data Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
Bionano Access : Assembly Report Guidelines
Bionano Access : Assembly Report Guidelines Document Number: 30255 Document Revision: A For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 Bionano Genomics Inc. All Rights Reserved
Pan Genome and Structural Variation Analysis using different Approaches for de novo Assembly and Haplotype Reconstruction
PAG XXV, January 14-18, 2017 - San Diego, CA, USA Pan Genome and Structural Variation Analysis using different Approaches for de novo Assembly and Haplotype Reconstruction Davide Scaglione dscaglione@igatechnology.com