Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Size: px

Start display at page:

Download "Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es"

Damon Hopkins
6 years ago
Views:

1 Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es

3 Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio Nanopore General considerations Reducing the complexity

5 Cost per raw Megabase of DNA

6 Technological exponential growth Nokia 1200 (2007) iphone 5S (2013)

7 Sanger sequencing

Sanger sequencing Traditional DNA sequencing method Ideal for small sequencing projects Read length around 600-700

8 Sanger sequencing Traditional DNA sequencing method Ideal for small sequencing projects Read length around bp Around 5-10$ per reaction 384 reactions in parallel at most Applied Biosystems is the main technological provider

9 Sanger sequencing

10 Sanger sequencing

ABI files Sequences are usually delivered as ABI files. Binary files. Contain real signal, chromatogram and called sequence and quality They can be opened with: chromas (win) (www.technelysium.com.

11 ABI files Sequences are usually delivered as ABI files. Binary files. Contain real signal, chromatogram and called sequence and quality They can be opened with: chromas (win) ( Sequence scanner (win) (Applied Biosystems) FinchTv (win, mac, linux) ( trev (win, mac, linux) (part of Staden). Usually they have a.ab1 extension.

12 Sequence and quality Phred score = - 10 log (prob error)

13 Sequence and quality Sequence in fasta format >SGN-E TAACAATAACAGTCAGAGCCCGTGTGGGAGCAGTACCGTGGAGTCATCCAGCGGAG AAACGGTTGTTCACGCGCCTAATACGCGACACGCGCCGC >SGN-E

14 Sequence and quality Due to technical limitations different technologies have different errors patterns.

15 Sanger sequencing Quality is worst at the beginning and at the end.

16 Other sources of error Pre-sequencing: PCR mutation-like errors Cloning artifacts, chimeric molecules Post-sequencing: Assembly artifacts Alignment errors due to: Reference Alignment algorithms SNV calling software

17 2nd generation sequencing

18 Sanger vs NGS sequencing Sanger NGS Num. sequences per reaction 1 clone Millions of molecules Max. parallelization 384 Several millions Sequence quality High Low Sequence length bp (depends on the platform) Throughtput Low High

19 Sanger vs NGS

20 Library preparation Fragmentation Sonication Nebulization Shearing Size selection End repair Sequencing adaptor ligation Purification

454 First NGS platform (and first to be phased out) Pirosequencing based chemistry Long reads (400-700bp) Most expensive cost

21 454 First NGS platform (and first to be phased out) Pirosequencing based chemistry Long reads ( bp) Most expensive cost per base Ideal for de novo sequencing projects Owned by Roche ½, ¼ and 1/8 run can be ordered >1 million reads GS FLX+ and GS Junior

22 454

23 454 quality The lengthiest the homopolymer the less quality. It is very difficult to differentiate AAAAAA from AAAAA. Quality diminishes with the sequence length.

Illumina Previously known as Solexa Reversible terminators based sequencing technique Short reads (50 or 250bp depending on the version) Lowest cost per base Ideal for

24 Illumina Previously known as Solexa Reversible terminators based sequencing technique Short reads (50 or 250bp depending on the version) Lowest cost per base Ideal for resequencing projects Highest throughput Runs divided in 8 lanes Up to 4000 million reads Can sequence both ends of the molecules (paired ends) HiSeq2500, NextSeq 500 and MiSeq

25 Illumina 1 sample: 30X human genome

26 HiSeq X Ten

27 Illumina

28 Illumina Quality diminishes with sequence length. No homopolymer problem, mainly substitution errors.

29 SOLiD Ligation based sequencing chemistry Short reads (35-75bp depending on the version) Only for resequencing projects It used to produce nucleotide sequences, but colors Color sequences have poor quality, but nucleotide sequences have high quality 115 or 320 million reads

30 SOLiD

31 SOLiD Really?

Ion Torrent Around 60-80 M reads. 200 pb length.

32 Ion Torrent Around M reads. 200 pb length. Sequences based on H+ production Error rates lower than other 2nd generation Error pattern similar to 454, with homopolymer problem. Very cheap per run. Belongs to Life technologies (Applied Biosystems)

33 Ion Torrent

34 3rd generation sequencing

35 PacBio 3rd generation platform (single molecule) Polymerase based chemistry (SMRT) Longest NGS reads (up to 20,000bp) Very high error rate Ideal for de novo sequencing projects reads

Sequencing based on the time required by the polymerase to incorporate a

36 PacBio 3rd generation, single molecule detection. No amplification step required. Nucleotides labeled on the phosphate removed during the polymerization. Sequencing based on the time required by the polymerase to incorporate a nucleotide (Polymerase requires milliseconds versus microseconds for the stochastic diffusion)

37 PacBio length distribution Longest lengths Limited by the polymerase damages due to the laser Sequencing strategies Standard Circular consensus Taken from flxlexblog.wordpress.com Distributions for standard sequencing, for circular the mean is around 250 pb.

38 PacBio quality distribution Distributions for standard sequencing. For circular sequencing the quality is at least 99.9% Taken from flxlexblog.wordpress.com

39 Nanopore Senses differences in ion flow USB powered

40 Nanopore-first data Not very reliable (yet)

41 Nanopore alignments

42 Nanopore alignments

43 Nanopore accuracy

44 Nanopore-Illumina hybrid error correction

45 Sequencing technologies Modified from Michael Stromberg

46 NGS capabilities Modified from ngsbuzz.blogspot.com Ngsbuzz gives 2.94 Gb yield to Pacbio.

47 Throughput

48 Cost per nucleotide

49 Cost per reaction

50 Read length

51 Bioinformatic challenges Huge data files handling. Beefy computers required. Software still being developed or missing. Ad-hoc software required during the analysis. Existing software tailored to experienced bioinformaticians. Dollar for dollar rule proposed EDSAC by Computer Laboratory Cambridge

52 Bioinformatic challenges Amount of data managed on a typical transcriptome assembly

53 NGS vs Hard Drive Stein Genome Biology :207 doi: /gb

54 Reducing the complexity

55 Genome Pros: Finest resolution Reproducible Cons: Expensive ($600 per sample) Lots of information will be lost if no reference is available, especially in the repetitive regions.

56 RNASeq Pros: Cheaper than whole genome sequencing ($300) Well proven methodologies Cons: RNA handling For many samples is pricier than GBS Follows gene density Reproducible Follows gene density

57 Exome

58 Exome

59 Exome Pros: More complete representation than RNASeq More reproducible than RNASeq Cons: Exome capture platforms only available in model species Pricier than RNASeq

60 doi: /genetics Genotyping by Sequencing (GBS) GBS review: Nature Reviews Genetics 12, (July 2011) doi: /nrg3012

Genotyping by Sequencing (GBS) Pros: Cheap ($50 per sample) Lots of variation Cons: Prone to artifacts (e.g. false SNPs due to repetitive DNA) if no reference genome is available.

61 Genotyping by Sequencing (GBS) Pros: Cheap ($50 per sample) Lots of variation Cons: Prone to artifacts (e.g. false SNPs due to repetitive DNA) if no reference genome is available. Degree of coverage along the genome depends on the Restriction Enzyme chosen How reproducible is it? GBS based SNPs in Soy doi: /genetics

62 Amplicons Pros: Cons: Cheap for few genes Not scalable for lots of genes Labor intensive Previous sequence information is required Amplicon sets can be ordered, but the design is expensive

63 This work is licensed under the Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit or send a letter to Creative Commons, 171 Second Street, Suite 300, San Francisco, California, 94105, USA. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es

Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio