Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
|
|
- Damon Hopkins
- 6 years ago
- Views:
Transcription
1 Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es
2
3 Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio Nanopore General considerations Reducing the complexity
4
5 Cost per raw Megabase of DNA
6 Technological exponential growth Nokia 1200 (2007) iphone 5S (2013)
7 Sanger sequencing
8 Sanger sequencing Traditional DNA sequencing method Ideal for small sequencing projects Read length around bp Around 5-10$ per reaction 384 reactions in parallel at most Applied Biosystems is the main technological provider
9 Sanger sequencing
10 Sanger sequencing
11 ABI files Sequences are usually delivered as ABI files. Binary files. Contain real signal, chromatogram and called sequence and quality They can be opened with: chromas (win) ( Sequence scanner (win) (Applied Biosystems) FinchTv (win, mac, linux) ( trev (win, mac, linux) (part of Staden). Usually they have a.ab1 extension.
12 Sequence and quality Phred score = - 10 log (prob error)
13 Sequence and quality Sequence in fasta format >SGN-E TAACAATAACAGTCAGAGCCCGTGTGGGAGCAGTACCGTGGAGTCATCCAGCGGAG AAACGGTTGTTCACGCGCCTAATACGCGACACGCGCCGC >SGN-E
14 Sequence and quality Due to technical limitations different technologies have different errors patterns.
15 Sanger sequencing Quality is worst at the beginning and at the end.
16 Other sources of error Pre-sequencing: PCR mutation-like errors Cloning artifacts, chimeric molecules Post-sequencing: Assembly artifacts Alignment errors due to: Reference Alignment algorithms SNV calling software
17 2nd generation sequencing
18 Sanger vs NGS sequencing Sanger NGS Num. sequences per reaction 1 clone Millions of molecules Max. parallelization 384 Several millions Sequence quality High Low Sequence length bp (depends on the platform) Throughtput Low High
19 Sanger vs NGS
20 Library preparation Fragmentation Sonication Nebulization Shearing Size selection End repair Sequencing adaptor ligation Purification
21 454 First NGS platform (and first to be phased out) Pirosequencing based chemistry Long reads ( bp) Most expensive cost per base Ideal for de novo sequencing projects Owned by Roche ½, ¼ and 1/8 run can be ordered >1 million reads GS FLX+ and GS Junior
22 454
23 454 quality The lengthiest the homopolymer the less quality. It is very difficult to differentiate AAAAAA from AAAAA. Quality diminishes with the sequence length.
24 Illumina Previously known as Solexa Reversible terminators based sequencing technique Short reads (50 or 250bp depending on the version) Lowest cost per base Ideal for resequencing projects Highest throughput Runs divided in 8 lanes Up to 4000 million reads Can sequence both ends of the molecules (paired ends) HiSeq2500, NextSeq 500 and MiSeq
25 Illumina 1 sample: 30X human genome
26 HiSeq X Ten
27 Illumina
28 Illumina Quality diminishes with sequence length. No homopolymer problem, mainly substitution errors.
29 SOLiD Ligation based sequencing chemistry Short reads (35-75bp depending on the version) Only for resequencing projects It used to produce nucleotide sequences, but colors Color sequences have poor quality, but nucleotide sequences have high quality 115 or 320 million reads
30 SOLiD
31 SOLiD Really?
32 Ion Torrent Around M reads. 200 pb length. Sequences based on H+ production Error rates lower than other 2nd generation Error pattern similar to 454, with homopolymer problem. Very cheap per run. Belongs to Life technologies (Applied Biosystems)
33 Ion Torrent
34 3rd generation sequencing
35 PacBio 3rd generation platform (single molecule) Polymerase based chemistry (SMRT) Longest NGS reads (up to 20,000bp) Very high error rate Ideal for de novo sequencing projects reads
36 PacBio 3rd generation, single molecule detection. No amplification step required. Nucleotides labeled on the phosphate removed during the polymerization. Sequencing based on the time required by the polymerase to incorporate a nucleotide (Polymerase requires milliseconds versus microseconds for the stochastic diffusion)
37 PacBio length distribution Longest lengths Limited by the polymerase damages due to the laser Sequencing strategies Standard Circular consensus Taken from flxlexblog.wordpress.com Distributions for standard sequencing, for circular the mean is around 250 pb.
38 PacBio quality distribution Distributions for standard sequencing. For circular sequencing the quality is at least 99.9% Taken from flxlexblog.wordpress.com
39 Nanopore Senses differences in ion flow USB powered
40 Nanopore-first data Not very reliable (yet)
41 Nanopore alignments
42 Nanopore alignments
43 Nanopore accuracy
44 Nanopore-Illumina hybrid error correction
45 Sequencing technologies Modified from Michael Stromberg
46 NGS capabilities Modified from ngsbuzz.blogspot.com Ngsbuzz gives 2.94 Gb yield to Pacbio.
47 Throughput
48 Cost per nucleotide
49 Cost per reaction
50 Read length
51 Bioinformatic challenges Huge data files handling. Beefy computers required. Software still being developed or missing. Ad-hoc software required during the analysis. Existing software tailored to experienced bioinformaticians. Dollar for dollar rule proposed EDSAC by Computer Laboratory Cambridge
52 Bioinformatic challenges Amount of data managed on a typical transcriptome assembly
53 NGS vs Hard Drive Stein Genome Biology :207 doi: /gb
54 Reducing the complexity
55 Genome Pros: Finest resolution Reproducible Cons: Expensive ($600 per sample) Lots of information will be lost if no reference is available, especially in the repetitive regions.
56 RNASeq Pros: Cheaper than whole genome sequencing ($300) Well proven methodologies Cons: RNA handling For many samples is pricier than GBS Follows gene density Reproducible Follows gene density
57 Exome
58 Exome
59 Exome Pros: More complete representation than RNASeq More reproducible than RNASeq Cons: Exome capture platforms only available in model species Pricier than RNASeq
60 doi: /genetics Genotyping by Sequencing (GBS) GBS review: Nature Reviews Genetics 12, (July 2011) doi: /nrg3012
61 Genotyping by Sequencing (GBS) Pros: Cheap ($50 per sample) Lots of variation Cons: Prone to artifacts (e.g. false SNPs due to repetitive DNA) if no reference genome is available. Degree of coverage along the genome depends on the Restriction Enzyme chosen How reproducible is it? GBS based SNPs in Soy doi: /genetics
62 Amplicons Pros: Cons: Cheap for few genes Not scalable for lots of genes Labor intensive Previous sequence information is required Amplicon sets can be ordered, but the design is expensive
63 This work is licensed under the Creative Commons Attribution 3.0 Unported License. To view a copy of this license, visit or send a letter to Creative Commons, 171 Second Street, Suite 300, San Francisco, California, 94105, USA. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationNEXT GENERATION SEQUENCING. Farhat Habib
NEXT GENERATION SEQUENCING HISTORY HISTORY Sanger Dominant for last ~30 years 1000bp longest read Based on primers so not good for repetitive or SNPs sites HISTORY Sanger Dominant for last ~30 years 1000bp
More informationOverview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
More informationAaron Liston, Oregon State University Botany 2012 Intro to Next Generation Sequencing Workshop
Output (bp) Aaron Liston, Oregon State University Growth in Next-Gen Sequencing Capacity 3.5E+11 2002 2004 2006 2008 2010 3.0E+11 2.5E+11 2.0E+11 1.5E+11 1.0E+11 Adapted from Mardis, 2011, Nature 5.0E+10
More informationNext generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento
Next generation sequencing techniques" Toma Tebaldi Centre for Integrative Biology University of Trento Mattarello September 28, 2009 Sequencing Fundamental task in modern biology read the information
More informationSequence assembly. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequence assembly Jose Blanca COMAV institute bioinf.comav.upv.es Sequencing project Unknown sequence { experimental evidence result read 1 read 4 read 2 read 5 read 3 read 6 read 7 Computational requirements
More informationNGS technologies: a user s guide. Karim Gharbi & Mark Blaxter
NGS technologies: a user s guide Karim Gharbi & Mark Blaxter genepool-manager@ed.ac.uk Natural history of sequencing 2 Brief history of sequencing 100s bp throughput 100 Gb 1977 1986 1995 1999 2005 2007
More informationNext Generation Sequencing. Tobias Österlund
Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationNext-generation sequencing Technology Overview
Next-generation sequencing Technology Overview UQ Winter School 2018 Christopher Noune, PhD AGRF Melbourne christopher.noune@agrf.org.au What is NGS? Ion Torrent PGM (Thermo-Fisher) MiSeq (Illumina) High-Throughput
More informationThird Generation Sequencing
Third Generation Sequencing By Mohammad Hasan Samiee Aref Medical Genetics Laboratory of Dr. Zeinali History of DNA sequencing 1953 : Discovery of DNA structure by Watson and Crick 1973 : First sequence
More informationNext Generation Sequencing Lecture Saarbrücken, 19. March Sequencing Platforms
Next Generation Sequencing Lecture Saarbrücken, 19. March 2012 Sequencing Platforms Contents Introduction Sequencing Workflow Platforms Roche 454 ABI SOLiD Illumina Genome Anlayzer / HiSeq Problems Quality
More informationIntroductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie. Sander van Boheemen Medical Microbiology
Introductie en Toepassingen van Next-Generation Sequencing in de Klinische Virologie Sander van Boheemen Medical Microbiology Next-generation sequencing Next-generation sequencing (NGS), also known as
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationContact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
More informationNext Generation Sequencing (NGS)
Next Generation Sequencing (NGS) Fernando Alvarez Sección Biomatemática, Facultad de Ciencias, UdelaR 1 Uruguay Montevide o 3 TANGO World Champ 1930 1950 (Maraca 4 Next Generation Sequencing module Next
More informationThe Journey of DNA Sequencing. Chromosomes. What is a genome? Genome size. H. Sunny Sun
The Journey of DNA Sequencing H. Sunny Sun What is a genome? Genome is the total genetic complement of a living organism. The nuclear genome comprises approximately 3.2 * 10 9 nucleotides of DNA, divided
More informationNext Gen Sequencing. Expansion of sequencing technology. Contents
Next Gen Sequencing Contents 1 Expansion of sequencing technology 2 The Next Generation of Sequencing: High-Throughput Technologies 3 High Throughput Sequencing Applied to Genome Sequencing (TEDed CC BY-NC-ND
More informationLecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
More informationData Basics. Josef K Vogt Slides by: Simon Rasmussen Next Generation Sequencing Analysis
Data Basics Josef K Vogt Slides by: Simon Rasmussen 2017 Generalized NGS analysis Sample prep & Sequencing Data size Main data reductive steps SNPs, genes, regions Application Assembly: Compare Raw Pre-
More informationUltrasequencing: methods and applications of the new generation sequencing platforms
Ultrasequencing: methods and applications of the new generation sequencing platforms Nuria Tubío Santamaría Course: Genomics Universitat Autònoma de Barcelona 1 Introduction Clasical methods of sequencing:
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationSEQUENCING FROM SAMPLE TO SEQUENCE READY
SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all
More informationUnderstanding the science and technology of whole genome sequencing
Understanding the science and technology of whole genome sequencing Dag Undlien Department of Medical Genetics Oslo University Hospital University of Oslo and The Norwegian Sequencing Centre d.e.undlien@medisin.uio.no
More informationSequencing Theory. Brett E. Pickett, Ph.D. J. Craig Venter Institute
Sequencing Theory Brett E. Pickett, Ph.D. J. Craig Venter Institute Applications of Genomics and Bioinformatics to Infectious Diseases GABRIEL Network Agenda Sequencing Instruments Sanger Illumina Ion
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationBioinformatics: A perspective
Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline The World we are presented with Advances in DNA Sequencing Bioinformatics
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationChapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining
More informationDNA-Sequencing. Technologies & Devices. Matthias Platzer. Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI)
DNA-Sequencing Technologies & Devices Matthias Platzer Genome Analysis Leibniz Institute on Aging - Fritz Lipmann Institute (FLI) Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day,
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationNext Generation Sequencing Technologies
Next Generation Sequencing Technologies What is first generation? Sanger Sequencing DNA Polymerase Base-adding reaction +H + http://chemwiki.ucdavis.edu/organic_chemistry/organic_chemistry_with_a_biological_emphasis/chapter_10%3a_phosphoryl_transfer_reactions/section_10.4%3a_phosphate_diesters
More informationHuman genome sequence
NGS: the basics Human genome sequence June 26th 2000: official announcement of the completion of the draft of the human genome sequence (truly finished in 2004) Francis Collins Craig Venter HGP: 3 billion
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More informationNext- gen sequencing. STAMPS 2015 Hilary G. Morrison Joe Vineis, Nora Downey, Be>e Hecox- Lea, Kim Finnegan
Next- gen sequencing STAMPS 2015 Hilary G. Morrison Joe Vineis, Nora Downey, Be>e Hecox- Lea, Kim Finnegan QuesIons What is the difference between standard and next- gen sequencing? How is next- gen sequencing
More informationCM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
More informationIntroduction to Next Generation Sequencing (NGS)
Introduction to Next eneration Sequencing (NS) Simon Rasmussen Assistant Professor enter for Biological Sequence analysis Technical University of Denmark 2012 Today 9.00-9.45: Introduction to NS, How it
More informationSequencing techniques and applications
I519 Introduction to Bioinformatics Sequencing techniques and applications Yuzhen Ye (yye@indiana.edu) School of Informatics & Computing, IUB Contents Sequencing techniques Sanger sequencing Next generation
More informationNext-Generation Sequencing Services à la carte
Next-Generation Sequencing Services à la carte www.seqme.eu ngs@seqme.eu SEQme 2017 All rights reserved The trademarks and names of other companies and products mentioned in this brochure are the property
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationBioinformatics: A perspective
Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline The World we are presented with Advances in DNA Sequencing Bioinformatics
More informationOutline. General principles of clonal sequencing Analysis principles Applications CNV analysis Genome architecture
The use of new sequencing technologies for genome analysis Chris Mattocks National Genetics Reference Laboratory (Wessex) NGRL (Wessex) 2008 Outline General principles of clonal sequencing Analysis principles
More informationGenome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
More informationNGS technologies approaches, applications and challenges!
www.supagro.fr NGS technologies approaches, applications and challenges! Jean-François Martin Centre de Biologie pour la Gestion des Populations Centre international d études supérieures en sciences agronomiques
More informationBST 226 Statistical Methods for Bioinformatics David M. Rocke. March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1
BST 226 Statistical Methods for Bioinformatics David M. Rocke March 10, 2014 BST 226 Statistical Methods for Bioinformatics 1 NGS Technologies Illumina Sequencing HiSeq 2500 & MiSeq PacBio Sequencing PacBio
More informationHLA-Typing Strategies
HLA-Typing Strategies Cologne, 13.5.2017 Joannis Mytilineos MD, PhD Department of Transplantation Immunology Institute for Clinical Transfusion Medicine and Immunogenetics German Red Cross Blood Transfusion
More informationBioinformatics: A perspective
Bioinformatics: A perspective Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu Outline Advances in DNA Sequencing The World we are presented with Bioinformatics
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 1 Vocabulary Gene: hereditary DNA sequence at a
More informationIntroduction to Bioinformatics and Gene Expression Technologies
Vocabulary Introduction to Bioinformatics and Gene Expression Technologies Utah State University Fall 2017 Statistical Bioinformatics (Biomedical Big Data) Notes 1 Gene: Genetics: Genome: Genomics: hereditary
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationDNA-Sequencing. Technologies & Devices
DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads
More informationThe Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
More informationHigh throughput omics and BIOINFORMATICS
High throughput omics and BIOINFORMATICS Giuseppe D'Auria Seville, February 2009 Genomes from isolated bacteria $ $ $ $ $ $ $ $ $$ $ $ $ $ $ $ $ se q se uen q c se uen ing q c se uen ing qu c en ing c
More informationGenome Sequencing. I: Methods. MMG 835, SPRING 2016 Eukaryotic Molecular Genetics. George I. Mias
Genome Sequencing I: Methods MMG 835, SPRING 2016 Eukaryotic Molecular Genetics George I. Mias Department of Biochemistry and Molecular Biology gmias@msu.edu Sequencing Methods Cost of Sequencing Wetterstrand
More informationDNA-Sequencing. Technologies & Devices
DNA-Sequencing Technologies & Devices Genome analysis DNA sequencing platforms ABI 3730xl 4/2004 & 6/2006 1 Mb/day, 850 nt reads 2 Mb/day, 550 nt reads Roche/454 GS FLX 12/2006 800 Mb/23h, 800 nt reads
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationGenomic Technologies. Michael Schatz. Feb 1, 2018 Lecture 2: Applied Comparative Genomics
Genomic Technologies Michael Schatz Feb 1, 2018 Lecture 2: Applied Comparative Genomics Welcome! The primary goal of the course is for students to be grounded in theory and leave the course empowered to
More informationIntroduction to metagenome assembly. Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014
Introduction to metagenome assembly Bas E. Dutilh Metagenomic Methods for Microbial Ecologists, NIOO September 18 th 2014 Sequencing specs* Method Read length Accuracy Million reads Time Cost per M 454
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationUsing New ThiNGS on Small Things. Shane Byrne
Using New ThiNGS on Small Things Shane Byrne Next Generation Sequencing New Things Small Things NGS Next Generation Sequencing = 2 nd generation of sequencing 454 GS FLX, SOLiD, GAIIx, HiSeq, MiSeq, Ion
More informationSequencing techniques
Sequencing techniques Workshop on Whole Genome Sequencing and Analysis, 2-4 Oct. 2017 Learning objective: After this lecture, you should be able to account for different techniques for whole genome sequencing
More informationMolecular Biology and Functional Genomic Core Facility
Molecular Biology and Functional Genomic Core Facility General Presentation Dr Odile Neyret Core Manager Myriam Rondeau Research Assistant Agnès Dumont Research Assistant Institut de recherche clinique
More informationFunctional Genomics Research Stream. Research Meetings: November 2 & 3, 2009 Next Generation Sequencing
Functional Genomics Research Stream Research Meetings: November 2 & 3, 2009 Next Generation Sequencing Current Issues Research Meetings: Meet with me this Thursday or Friday. (bring laboratory notebook
More informationConcepts and methods in sequencing and genome assembly
BCM-2002 Concepts and methods in sequencing and genome assembly http://megasun.bch.umontreal.ca/papers/bcm-2002/sequencing-bcm2002-nov2015.pdf B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier
More informationSequencing technologies
Sequencing technologies part of High-Throughput Analyzes of Genome Sequenzes Computational EvoDevo University of Leipzig Leipzig, WS 2014/15 Sanger Sequencing (Chain Termination Method) Sequencing of one
More information2nd (Next) Generation Sequencing 2/2/2018
2nd (Next) Generation Sequencing 2/2/2018 Why do we want to sequence a genome? - To see the sequence (assembly) To validate an experiment (insert or knockout) To compare to another genome and find variations
More informationIllumina (Solexa) Throughput: 4 Tbp in one run (5 days) Cheapest sequencing technology. Mismatch errors dominate. Cost: ~$1000 per human genme
Illumina (Solexa) Current market leader Based on sequencing by synthesis Current read length 100-150bp Paired-end easy, longer matepairs harder Error ~0.1% Mismatch errors dominate Throughput: 4 Tbp in
More informationCSC Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx By Anonymous. Similarity Index
Page 1 of 6 Document Viewer TurnitinUK Originality Report Processed on: 05-Dec-20 10:49 AM GMT ID: 13 Word Count: 1587 Submitted: 1 CSC8313-201 - Assignment1SequencingReview- 1109_Su N_NEXT_GENERATION_SEQUENCING.docx
More informationSingle Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
More informationTruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
More informationUnderstanding Accuracy in SMRT Sequencing
Understanding Accuracy in SMRT Sequencing Jonas Korlach, Chief Scientific Officer, Pacific Biosciences Introduction Single Molecule, Real-Time (SMRT ) DNA sequencing achieves highly accurate sequencing
More informationCBC Data Therapy. Metagenomics Discussion
CBC Data Therapy Metagenomics Discussion General Workflow Microbial sample Generate Metaomic data Process data (QC, etc.) Analysis Marker Genes Extract DNA Amplify with targeted primers Filter errors,
More informationGENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON
GENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON Matthew Baranski, Casey Jowdy, Hooman Moghadam, Ashie Norris, Håvard Bakke, Anna Sonesson,
More informationNEXT GENERATION SEQUENCING Whole Gene Sequencing
NEXT GENERATION SEQUENCING Whole Gene Sequencing Ingrid Faé Educational Session 3: Next generation sequencing Stockholm, Friday, June 27 th 2014 Department for Blood Group Serology and Transfusion Medicine
More informationDNA and genome sequencing. Matthew Hudson Dept of Crop Sciences University of Illinois
DNA and genome sequencing Matthew Hudson Dept of Crop Sciences University of Illinois Genome projects 2,424 ongoing genome projects 696 for eukaryotes 520 completed genomes 47 from eukaryotes Almost every
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationIllumina s Suite of Targeted Resequencing Solutions
Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationDNA Sequencing. Happiness Kumburu BSU- workshop Nov, 2016
DNA Sequencing Happiness Kumburu BSU- workshop Nov, 2016 OUT LINE History of DNA sequencing Purpose of DNA sequencing DNA Sequencing Methods Advantages and Disadvantages References DNA SEQUENCING DNA sequencing-the
More informationGalaxy Workshop
Galaxy Workshop 1-8-13 Intros: Tom Bair thomas-bair@uiowa.edu Ann Black-Ziegelbein annblack@eng.uiowa.edu Srinivas Maddhi srinivas-maddhi@uiowa.edu What is galaxy good for Access to resources Documentation
More informationAnalytics Behind Genomic Testing
A Quick Guide to the Analytics Behind Genomic Testing Elaine Gee, PhD Director, Bioinformatics ARUP Laboratories 1 Learning Objectives Catalogue various types of bioinformatics analyses that support clinical
More informationExperimental Design Microbial Sequencing
Experimental Design Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing
More informationHigh throughput sequencing technologies
High throughput sequencing technologies and NGS applications Mei-yeh Lu 呂美曄 High Throughput Sequencing Core Manager g g p q g g Academia Sinica 6/30/2011 Outlines Evolution of sequencing technologies Sanger
More informationIntroduction to Microbial Sequencing
Introduction to Microbial Sequencing Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu General rules for preparing
More informationUltrasequencing: Methods and Applications of the New Generation Sequencing Platforms
Ultrasequencing: Methods and Applications of the New Generation Sequencing Platforms Laura Moya Andérico Master in Advanced Genetics Genomics Class December 16 th, 2015 Brief Overview First-generation
More informationwww.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
More informationsolid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome
solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable
More information