Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies
|
|
- Thomas Wilkinson
- 6 years ago
- Views:
Transcription
1 G0656 pfiv3.2rsvmcs Coordinates Plasmid Features CMV/5 LTR hybrid Partial Gag Central Polypurine Tract RSV Promoter Multiple Cloning Sites WPRE RRE SIN 3 LTR puc origin of replication Ampicillin Resistance Marker pf1(+) phage origin Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies Note: Plasmid can be analyzed by restriction endonuclease cleavage pattern by digesting with BsaI or SspI
2 Multiple cloning sites 5 to 3 G0656 pfiv3.2rsvmcs GAGCTTGCATGCCTGCAGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAA CGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCA TTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT GCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACA TGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGAT GCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCC ACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTA ACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAACCAGT GCTTTGTGAAACTTCGAGGAGTCTCTTTGTTGAGGACTTTTGAGTTCTCCCTTGAGGCTCCCACAGA TACAATAAATATTTGAGATTGAACCCTGTCGAGTATCTGTGTAATCTTTTTTACCTGTGAGGTCTCG GAATCCGGGCCGAGAACTTCGCAGTTGGCGCCCGAACAGGGACTTGATTGAGAGTGATTGAGGAA GTGAAGCTAGAGCAATAGAAAGCTGTTAAGCAGAACTCCTGCTGACCTAAATAGGGAAGCAGTAGCA GACGCTGCTAACAGTGAGTATCTCTAGTGAAGCAGACTCGAGCTCATAATCAAGTCATTGTTTAAAG GCCCAGATAAATTACATCTGGTGACTCTTCGCGGACCTTCAAGCCAGGAGATTCGCCGAGGGACAG TCAACAAGAAAGGAGAGATTCTACAGCAACTAGGGGAATGGACAGGGGCGAGATTGGAAAATGGC CATTAAGAGATGTAGTAATGTTGCTGTAGGAGTAGGGGGGAAGAGTAAAAAATTTGGAGAAGGGA ATTTCAGATGGGCCATTAGAATGGCTAATGTATCTACAGGACGAGAACCTGGTGATATACCAGAG ACTTTAGATCAACTAAGGTTGGTTATTTGCGATTTACAAGAAAGAAGAGAAAAATTTGGATCTAGC AAAGAAATTGATATGGCAATTGTGACATTAAAAGTCTTTGCGGTAGCAGGACTTTTAAATATGACG GTGTCTACTGCTGCTGCAGCTGAAAATATGTATTCTCAAATGGGATTAGACACTAGGCCATCTATG AAAGAAGCAGGTGGAAAAGAGGAAGGCCCTCCACAGGCATATCCTATTCAAACAGTAAATGGAGT ACCACAATATGTAGCACTTGACCCAAAAATGGTGTCCATTTTTATGGAAAAGGCAAGAGAAGGACT AGGAGGTGAGGAAGTTCAACGCGGCCGAGTCTCAATTTTAAAAGAAGAGGTAGGATAGGAGGGAT GGCCCCTTATGAATTATTAGCACAACAAGAATCCTTAAGAATACAAGATTATTTTTCTGCAATACCA CAAAAATTGCAAGCACAGTGGATTTATTATAAAGATCAAAAAGATAAGAAATGGAAAGGACCAAT GAGAGTAGCGGCCGCATGCTAGTAGATCTGCGATGTACGGGCCAGATATACGCGTATCTGAGGGG ACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATA TAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAA CATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGG TGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGA CGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCC ATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTGGTACCTCGAGAAGGGCGAATTCTGCAG ATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGCTTAAGCTTAGGATCCATCCCGGGTG ATATCTAACGCGTTTTCTAGATTACTAGTTTGTCGACTTGAATTCTTATCGATTTACGCGTAAGATCT TTCTAGTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTC CTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTC
3 ATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGC AACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACC TGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCC TGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGG GAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTT CTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGC GGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCaGATcTCCCTTTGGGCCGCCGCCTCCC CGCATACCGGCAAGAAATACAACCACAAATGGAATTGAGGAGAAATGGTAGGCAATGTGGCATGTC TGAAAAAGAGGAGGAATGATGAAGTATCTCAGACTTATTTTATAAGGGAGATACTGTGCTGAGTTC TTCCCTTTGAGGAAGGTATGTCATATGAATCCATTTCGAATCAAATCAAACTAATAAAGTATGTATTG TAAGGTAAAAGGAAAAGACAAAGAAGAAGAAGAAAGAAGAAAGCCTTCAAGAGGATGATGACAGAGT TAGAAGATCGCTTCAGGAAGCTATTTGGCACGACTTCTACAACGGGAGACAGCACAGTAGATTCTGA AGATGAACCTCCTAAAAAAGAAAAAAGGGTGGACTGGGATGAGTACTGGAACCCTGAAGAAATAGA AAGAATGCGAGTATATAACCAGTGCTTTGTGAAACTTCGAGGAGTCTCTTTGTTGAGGACTTTTGA GTTCTCCCTTGAGGCTCCCACAGATACAATAAATATTTGAGATTGAACCCTGTCGAGTATCTGTGTA ATCTTTTTTACCTGTGAGGTCTCGGAATCCGGGCCGAGAACTTCGCAGGTACCCAGCTTTTGTTCC CTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTA TCCGCTCACAATTCCACACAACATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGA GTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTT CCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGG CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGAC GAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACC AGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTT CGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCA GCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG GCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGT TTGCAAACAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGG GTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATC TTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGT CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCC GGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGC CGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGC ATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGA AGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGC CATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC GGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTA AAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAAT GTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCG GATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGTGCACATTTCCCCGAAAAGTG CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAA AACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAG GTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAG CCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCG CGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTAT TACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCC AGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGG AGCTCCACCGCGG
4 Plasmid Analysis by Restriction Endonuclease Cleavage Pattern pfiv3.2rsvmcs GTVC ID#: G0656 Plasmid Prep Date: 5/23/08 Concentration: 2.9ug/ul Predicted fragments size: BsaI-HF SspI-HF 2731 bp 2731 bp 2179 bp 2176 bp 1376 bp 1249 bp 130 bp
5 Information and Cloning Suggestions for Working with pfiv3.2 plasmids: Background: Unlike many other retroviruses, lentiviral vectors have the advantage of infecting both dividing and non-dividing cells. However, they retain stable and long-term expression which is heritable. Lentiviral vectors are produced through a triple plasmid transfection reaction, which includes a transgene shuttle plasmid, a packaging plasmid, and an envelope plasmid. Lentivirus can be pseudo-typed with different envelopes to infect certain tissues and cell lines with greater efficiency. These viral vectors are able to accommodate transgene inserts of approximately 6.5Kb. Viral titers range between 1.0E+7 to 5.0E+8 TU/ml. The Feline Immunodeficiency viral vectors are replicationincompetent and have not been found to infect humans. There are several lentiviral reporter vectors available for purchase from the Viral Vector Core. FIVbased lentiviral vectors are available to University of Iowa investigators and outside users. Investigators outside the University of Iowa may obtain these vectors through a three party Material Transfer Agreement with Novartis Corporation and the University of Iowa. pvetlcmvmcs Backbone Origin: This cloning and expression plasmid was developed by Chiron Technologies: A series of stepwise PCR amplifications were inserted in the pbluescriptksii(+) phagemid to create the FIV backbone plasmid called ptfivl. This plasmid contained the complete 5 LTR and 3 LTR and a long region (0.55kb) of the FIV gag gene. This backbone was further modified to replace the U3 region of the 5 LTR with the CMV promoter-enhancer to create the ptc/fl backbone. The CMV promoter was then again inserted at the 5 end but immediately before the multiple cloning sites and the backbone was renamed pvet L CMVskh10 (currently named pvet L CMVmcs). FIV3.2 Plasmid Vector Origin: The FIV3.2 plasmid is a derivative of Novartis pvet L CMVmcs cloning plasmid (description above). Several modifications were made to the original construct to improve safety and transgene expression. This plasmid was modified by Patrick L. Sinn, PhD (University of Iowa): The lentiviral central polypurine tract and the central termination sequence were added directly downstream of the gag sequence. The Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element, WPRE, was added directly upstream of the rev response element, RRE. The major splice donor and the initial gag sequence each have a mutation but the packaging signal was retained. The FIV 3 LTR was rendered self-inactivating by deleting a portion of the U3 region. Insert Size: Lentiviral vectors are able to accommodate transgene inserts of approximately 6.5Kb. Typically, vector titers decrease inversely proportionally with increasing transgene sizes above 6.5Kb. Note: When cloning your gene of interest, do not include a polyadenylation signal. Inclusion of a poly A signal will not allow proper packaging of lentiviral particles.
6 Lentiviral Production: The University of Iowa Viral Vector Core utilizes a triple plasmid transfection system: a packaging plasmid, envelope plasmid and transgene plasmid. The packaging plasmid encodes for the necessary viral proteins in trans, but they are not packaged into the particles. The envelope plasmid encodes for the envelope protein in trans. The transgene plasmid contains your gene of interest. It also retains the minimal cis acting viral sequences necessary for packaging, reverse transcription and integration. So, when the virus particles are assembled, the accessory genes required for subsequent viral replications are not included, therefore, making the vector replication deficient. We will require 250ug of purified transgene plasmid for production of your vector for a single 500ul prep of concentrated FIV vector. The packaging and envelope plasmids are provided by the UI VVC. The services provided for production are: Triple plasmid transfection Viral particle concentration Titer Assay (transducing units/ml) Plasmid Amplification and QC: Amplification of the pfiv3.2 plasmids: The pfiv3.2 plasmid backbone is ampicillin resistant. Pick a single colony and inoculate in LB broth containing 100g/ml of Ampicillin. Grow on LB agar plates containing 100ug/ml of Ampicillin. We recommend transforming your final miniprep into a stable competent cell line such as SURE2, Stbl2, or Stbl3 to avoid unwanted recombination in viral vector plasmids. We prefer Stbl3 in the Viral Vector Core. Sub-cloning, however, can be difficult in these competent cells. We recommend DH5a competent cells for subcloning. Transform your final, confirmed miniprep into a stable competent cell line. Maxi preps: Use high quality, endotoxin free plasmid purification kits for DNA extractions. The Viral Vector Core also provides maxi prep service for viral vector production. Restriction Digest Analysis: In addition to sequencing, pfiv3.2 plasmids can be digested with BsaI or SspI to confirm the integrity of the plasmid. It is recommended to run a sample of the un-cut and linearized plasmid at the same time. The Viral Vector Core requires a plasmid digest along in addition to the sequence and a map for each plasmid submission. Sequencing Primers for Verification of the Transgene Insert: Additional primers will need to be designed specifically for each cloning project to confirm insertion of your gene of interest. WPREreverse 5 - AGCTGACAGGTGGTGGCAAT-3 Protein expression or mirna knockdown All the plasmids provided at the Viral Vector Core are also expression vectors. Prior to sending the plasmid for virus production, we recommend testing for protein of interest expression or mirna knockdown of protein expression. References: Johnston JC, Gasmi M, Lim LE, Elder JH, Yee JK, Jolly DJ, Campbell KP, Davidson BL, Sauter SL. Minimum Requirements for Efficient Transduction of Dividing and Nondividing Cells by Feline Immunodeficiency Virus Vectors. J Virol June; 73(6): Stein CS, Davidson BL. Gene Transfer to the Brain Using Feline Immunodeficiency Virus-Based Lentivirus Vectors. Methods Enzymology 346: , Harper SQ, Davidson BL. Plasmid-based RNA interference: Construction of small-hairpin RNA (shrna) expression vectors. Methods Mol Biol 309: , 2005.
7 Harper SQ, Staber PD, Beck CR, Fineberg SK, Stein CS, Ochoa D, Davidson BL. Optimization of Feline Immunodeficiency Virus Vectors for RNA Interference. J Virol 80(19): , Boudreau RL, Davidson BL. Chapter 14 - Generation of Hairpin-Based RNAi Vectors for Biological and Therapeutic Application. Methods Enzymology 507: , Please contact us with any questions: Viral Vector Core vectors@uiowa.edu University of Iowa 500 Newton Road 221 Eckstein Medical Research Building Iowa City, IA Tel: (319)
G0411 pfiv3.2mcsegfp. Plasmid Features
G0411 pfiv3.2mcsegfp Plasmid Features Coordinates Feature CMV/5 LTR hybrid 1:682 Major Splice Donor 926:957 Partial gag 958:1468 Central Polypurine Tract 1494:1653 Multiple cloning sites 1653:1714 egfp
More informationG0752 pfiv3.2mcswtiresegfp
G0752 pfiv3.2mcswtiresegfp Plasmid Features Coordinates Feature 1-682 CMV/5 LTR Hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1653-1738 Multiple Cloning Sites 1739-2325 wtires 2326-3045
More informationG0202 pfbaavmcsbghpa MCS. Red type indicates unique restriction site. Plasmid Features:
G0202 pfbaavmcsbghpa Plasmid Features: Coordinates Feature 183-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 820-975 MCS 976-1189 BgHpA 1243-1372 AAV2 ITR (130bp) 1929-2462 Gentamicin
More informationRed type indicates unique restriction site. Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)
G0619 pfbaavmcscmvegfp SV40pA Plasmid Features: Coordinates Feature 194-348 Tn7L 376-511 SV40pA (complementary-remnant of pfb cloning) 678-818 AAV2 ITR (141bp) 877-969 MCS 970-1549 CMV Promoter 1569-2288
More informationAntibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)
G01067 pfbaavcagmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 938-2607 CAG 2600-2685 mcs 2687-3273 wtires 3274-3984 mcherry
More informationMultiple cloning site between CAG and wild type IRES:
G0747 pfbaavcagmcs wtiresegfpbghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 376-511 SV40pA Complementary 678-818 AAV2 ITR (141bp) 938-2607 CAG promoter 872-955 mcs 2687-3273 wtires (11th ATG
More informationAntibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)
G01066 pfbaavmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 860-955 mcs 956-1542 wtires 1543-2253 mcherry 2268-2481 BgHpA
More informationAdenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X
Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects
More informationSV40pA. Plasmid Features: Antibiotic Resistance: Ampicillin Backbone: pbr322
G1072 pacad5cagmcswtiresmcherry- SV40pA Plasmid Features: Coordinates Feature ITR: 16-118 Ad5: 16-368 and 897-3361 CAG 441-2112 MCS: 2121-2177 wtires 2179-2769 mcherry 2765-3475 SV40pA: 3484-3923 Ampicillin:
More informationPlasmid Features: Coordinates Feature Ad5: and mcmv: MCS: SV40: Ampicillin: (Complimentary)
G0688 pacad5cmvmcssv40pa Plasmid Features: 6210bp Coordinates Feature Ad5: 16-368 and 1441-3899 mcmv: 385-907 MCS: 913-1002 SV40: 1003-1470 Ampicillin: 6007-5147 (Complimentary) Antibiotic Resistance:
More informationG0796 pacad5tretightmcssv40pa
G0796 pacad5tretightmcssv40pa Plasmid Features: 6009bp Coordinates Feature ITR: 16-118 Ad5 wt 16-365 and 1240-3698 TRE-tight: 402-717 SV40: 802-1239 Ampicillin: 5806-4946 Antibiotic Resistance: Ampicillin
More informationG0463 pscaavmcsbghpa MCS. Plasmid Features:
3200 G0463 pscaavmcsbghpa Plasmid Features: Coordinates Feature 980-1085 AAV2 ITR 106bp (mutated ITR) 1110-1226 MCS 1227-1440 BgHpA 1453-1595 AAV2 ITR (143bp) 2496-3356 B-lactamase (Ampicillin) Antibiotic
More informationG1059 pacad5mcswtiresmcherry SV40pA
G1059 pacad5mcswtiresmcherry SV40pA Plasmid Features: 6958bp Coordinates Feature ITR: 16-118 Ad5: 16-368 and 2189-4647 MCS: 375-456 wtires 445-1031 mcherry 1032-1742 SV40pA: 1751-2188 Ampicillin: 6755-5895
More informationRed Type Indicates Unique Site
3600 G0605 pscaavmcmvmcsbghpa Plasmid Features: Coordinates Feature 980-1084 AAV2 5 ITR 1144-1666 modified CMV 1667-1761 MCS 1762-1975 BgHpA 1987-2114 AAV2 3 ITR 3031-3891 B-lactamase (Ampicillin) Antibiotic
More informationManufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray
Manufacturing Viral Gene Therapy s: 1 Dr. Vice President, Research & Development Audentes Therapeutics, Inc. San Francisco, USA Natural virus life cycle Late Early Viral Virally infected cell Naïve cell
More informationPlasmid Features: Coordinates Feature ITR: Ad5: and hsyn1 Promoter SV40: Ampicillin:
4600 G0864 pad5hsyn1mcssv40pa Plasmid Features: 6155bp Coordinates Feature ITR: 16-118 Ad5: 16-365 and 903-3357 hsyn1 Promoter 399-862 SV40: 948-1385 Ampicillin: 5092-5952 Antibiotic Resistance: Ampicillin
More informationCertificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer
More informationSupplementary Information
Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA
More informationVECTOR SYSTEMS. Vector Systems
VECTOR SYSTEMS Vector Systems The vector systems currently available through Penn Vector Core are those derived from adenoassociated virus (AAV), adenovirus and lentivirus. The Core offers AAV-based vectors
More informationLoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr
LeGO-C-p53-shRNA SIN-LTR? RRE cppt H1/TO shrna-p53 SFFV mcherry wpre SIN-LTR LeGO-C-scr-shRNA SIN-LTR? RRE cppt H1/TO shrna-scr SFFV mcherry wpre SIN-LTR Supplementary Figure 3A: Scheme of the lentiviral
More informationVECTOR SAFETY INFORMATION. AAV Vectors: Material Information
VECTOR SAFETY INFORMATION AAV Vectors: Material Information AAV vectors contain recombinant transgene sequences (e.g. encoding reporter or therapeutic genes) flanked by the AAV inverted terminal repeats
More informationQuality Control Assays
QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationCertificate of Analysis
Certificate of Analysis Lenti-X DD-ZsGreen1 Vector Set Table of Contents Product Information... 1 plvx-dd-zsgreen1 Reporter Vector... 3 plvx-dd-zsgreen1 Control Vector... 4 Additional Information... 5
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationshrna expression Cloning Kit
shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-
More informationDevelopment of Positive Control for Hepatitis B Virus
Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,
More informationpsmpuw-u6-puro Lentiviral Expression Vector
Product Data Sheet psmpuw-u6-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-221 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationCat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
More informationpcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions Each kit comes with the following components:
pcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions... 1 Product Description... 1 Introduction... 1 Production and Quality Assurance... 2 Methods... 2 Other required
More informationChapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.
Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers
More informationpslic-purop2a Lentivirus Plasmid Construction Kit (Cat# LT2002)
pslic-purop2a Lentivirus Plasmid Construction Kit (Cat# LT2002) [ provides pslic-purop2a lentivirus plasmid construction kit to let user create the lentivirus plasmid expressing the gene of interest. This
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationThermo Scientific Open Biosystems LentiORF plex-mcs Vector
Technical Manual Thermo Scientific Open Biosystems LentiORF plex-mcs Vector Catalog #: OHS4735 Product Description The plex-mcs Empty Vector is the lentiviral plex vector containing a multiple cloning
More informationpeco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)
peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in
More informationCloning of shrna Templates into shrna Expression Vectors. User Manual
Cloning of shrna Templates into shrna Expression Vectors v3a, 8-29-2013 Table of Contents Page A. Background 2 B. Required Materials 2 C. Cloning of shrna Template Oligonucleotides into shrna Expression
More informationDiagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support
Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within
More informationCertificate of Analysis
Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631982
More informationCustom AAV Vector Production Request Form
Oregon National Primate Research Center ONPRC Request Date: Mail Code L584-505 N.W. 185th Avenue, Beaverton, OR 97006 Lab Tel: 503-629-4042, Web: goo.gl/3kyai Custom AAV Vector Production Request Form
More informationpfb and pfb-neo Retroviral Vectors
pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY
More informationExactORF cdna Clones. Application Guide. Table of Contents
ExactORF cdna Clones Application Guide Table of Contents Package Contents and Storage Conditions... 2 Optional Reagents... 2 Related Products... 2 Protocols for handling the DNA... 3 Protocol for Plasmid
More informationCloning of shrna Templates into shrna Expression Vector User Manual
Cloning of shrna Templates into shrna Expression Vector User Manual Table of Contents Page A. Background 1 B. Required Materials 1 C. Cloning of shrna Template Oligonucleotides into shrna Expression Vector
More informationBasics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationpsmpuw-puro Lentiviral Expression Vector
Product Data Sheet psmpuw-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-212 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationProtocols for cell lines using CRISPR/CAS
Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationViral Delivery Guide. Choosing the right viral vector for your research
Viral Delivery Guide Choosing the right viral vector for your research OVERVIEW Transfection, the introduction of foreign DNA or RNA into eukaryotic cells, is an indispensable tool for studying gene expression
More informationLentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors
Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb
More informationpsmpuw Universal Lentiviral Expression Vector (Promoterless)
Product Data Sheet psmpuw Universal Lentiviral Expression Vector (Promoterless) CATALOG NUMBER: VPK-211 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector
More informationThe Molecular Virology Support Core: Adenoviral Vectors and Beyond
The : Adenoviral Vectors and Beyond Christoph A. Kahl, Ph.D. Viral Vector Workshop, May 5th, 2011 Outline 1) Overview of the MVSC 2) Adenoviral Vectors 3) Expertise and Services Overview What does the
More informationYour Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2
More informationChapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
More informationGenBuilder TM Plus Cloning Kit User Manual
GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.
More informationSupplementary Methods pcfd5 cloning protocol
Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous
More informationGuide-it Indel Identification Kit User Manual
Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA
More informationCatalog Number. Mouse Unique & Validated TRC 2.0 SHPM2 Pooled shrna Library. Pooled shrna Library SHPHLIBR
MISSION LentiPlex Human and Mouse Pooled shrna Libraries Catalog Number Product Description Catalog Number Product Description SHPH01 Human TRC 1.0 Pooled shrna Library SHPM01 Mouse TRC 1.0 Pooled shrna
More informationMolecular Cloning. Restriction Enzymes and Ligases
Tools in Genetic engineering The science of using living systems to benefit humankind is called biotechnology. Technically speaking, the domestication of plants and animals through farming and breeding
More informationRecombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
More informationGenBuilder TM Cloning Kit User Manual
GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA
More informationPre-made Reporter Lentivirus for p53 Signal Pathway
Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationGenetics Lecture Notes Lectures 13 16
Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons
More informationGenome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.
TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationpsmpuw-ires-blasticidin Lentiviral Expression Vector
Product Data Sheet psmpuw-ires-blasticidin Lentiviral Expression Vector CATALOG NUMBER: VPK-219 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on
More informationYour Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationBIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
More informationsherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
More informationSupplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have
Suppl. Figure 4 LeGO-iG2-Puro+-p53 SIN-LTR ψ RRE cppt SFFV human Wt-p53 IRES egfp2a PuroR_opt wpre SIN-LTR LeGO-G2-Puro+ SIN-LTR ψ RRE cppt SFFV egfp 2A PuroR_opt wpre SIN-LTR Supplementary Figure 4A:
More informationTrueORF TM cdna Clones and PrecisionShuttle TM Vector System
TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available
More informationCELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)
Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression
More informationGENETIC ENGINEERING worksheet
Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA
More informationMicroRNA Expression Plasmids
MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map
More informationPre-made expression Adenovirus product manual
Pre-made expression Adenovirus product manual Catalog# Product Name Amounts AVP001 RFP adenovirus AVP002 AVP004 AVP005 AVP011 AVP012 AVP017 AVP010 AVP013 AVP014 AVP015 AVP016 AVP-Null AVP001-PBS AVP002-PBS
More informationMicroRNA Expression Plasmids
MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationEctopic Gene Expression in Mammalian Cells
Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic
More information3 Designing Primers for Site-Directed Mutagenesis
3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed
More information3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc
3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationChapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
More informationRecitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
More information7.012 Problem Set 5. Question 1
Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much
More informationCELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)
Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for
More informationUse of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary
No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationProduct Analysis Certificate
Product: Catalog #: CRISPR (Linearized) SVCRU6H16-L Lot #: 17062801 Description: The Linearized sgrna Cloning and Expression Vector is a human immunodeficiency virus (HIV) lentiviral vector with a constitutive
More informationMicroRNA Expression Plasmids
MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map
More informationSelected Techniques Part I
1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative
More informationDesign. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
More informationReading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
More informationReady_to_use Fast Seamless Cloning Kit. User Manual
For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com
More informationLecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
More informationPre-made Lentiviral Particles for nuclear permeant CRE recombinase expression
Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE
More informationIt s All in the Hands Genetic Engineering
It s All in the Hands Genetic Engineering Genetic Engineering Genetic Engineering is the technique of modifying the genome of an organism by using recombinant DNA technology. Recombinant DNA (rdna) technology
More information