Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies

Size: px
Start display at page:

Download "Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies"

Transcription

1 G0656 pfiv3.2rsvmcs Coordinates Plasmid Features CMV/5 LTR hybrid Partial Gag Central Polypurine Tract RSV Promoter Multiple Cloning Sites WPRE RRE SIN 3 LTR puc origin of replication Ampicillin Resistance Marker pf1(+) phage origin Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies Note: Plasmid can be analyzed by restriction endonuclease cleavage pattern by digesting with BsaI or SspI

2 Multiple cloning sites 5 to 3 G0656 pfiv3.2rsvmcs GAGCTTGCATGCCTGCAGGTCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAA CGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCA TTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATAT GCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACA TGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGAT GCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCC ACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTA ACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAACCAGT GCTTTGTGAAACTTCGAGGAGTCTCTTTGTTGAGGACTTTTGAGTTCTCCCTTGAGGCTCCCACAGA TACAATAAATATTTGAGATTGAACCCTGTCGAGTATCTGTGTAATCTTTTTTACCTGTGAGGTCTCG GAATCCGGGCCGAGAACTTCGCAGTTGGCGCCCGAACAGGGACTTGATTGAGAGTGATTGAGGAA GTGAAGCTAGAGCAATAGAAAGCTGTTAAGCAGAACTCCTGCTGACCTAAATAGGGAAGCAGTAGCA GACGCTGCTAACAGTGAGTATCTCTAGTGAAGCAGACTCGAGCTCATAATCAAGTCATTGTTTAAAG GCCCAGATAAATTACATCTGGTGACTCTTCGCGGACCTTCAAGCCAGGAGATTCGCCGAGGGACAG TCAACAAGAAAGGAGAGATTCTACAGCAACTAGGGGAATGGACAGGGGCGAGATTGGAAAATGGC CATTAAGAGATGTAGTAATGTTGCTGTAGGAGTAGGGGGGAAGAGTAAAAAATTTGGAGAAGGGA ATTTCAGATGGGCCATTAGAATGGCTAATGTATCTACAGGACGAGAACCTGGTGATATACCAGAG ACTTTAGATCAACTAAGGTTGGTTATTTGCGATTTACAAGAAAGAAGAGAAAAATTTGGATCTAGC AAAGAAATTGATATGGCAATTGTGACATTAAAAGTCTTTGCGGTAGCAGGACTTTTAAATATGACG GTGTCTACTGCTGCTGCAGCTGAAAATATGTATTCTCAAATGGGATTAGACACTAGGCCATCTATG AAAGAAGCAGGTGGAAAAGAGGAAGGCCCTCCACAGGCATATCCTATTCAAACAGTAAATGGAGT ACCACAATATGTAGCACTTGACCCAAAAATGGTGTCCATTTTTATGGAAAAGGCAAGAGAAGGACT AGGAGGTGAGGAAGTTCAACGCGGCCGAGTCTCAATTTTAAAAGAAGAGGTAGGATAGGAGGGAT GGCCCCTTATGAATTATTAGCACAACAAGAATCCTTAAGAATACAAGATTATTTTTCTGCAATACCA CAAAAATTGCAAGCACAGTGGATTTATTATAAAGATCAAAAAGATAAGAAATGGAAAGGACCAAT GAGAGTAGCGGCCGCATGCTAGTAGATCTGCGATGTACGGGCCAGATATACGCGTATCTGAGGGG ACTAGGGTGTGTTTAGGCGAAAAGCGGGGCTTCGGTTGTACGCGGTTAGGAGTCCCCTCAGGATA TAGTAGTTTCGCTTTTGCATAGGGAGGGGGAAATGTAGTCTTATGCAATACTCTTGTAGTCTTGCAA CATGGTAACGATGAGTTAGCAACATGCCTTACAAGGAGAGAAAAAGCACCGTGCATGCCGATTGG TGGAAGTAAGGTGGTACGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTGACATGGATTGGA CGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCC ATTTGACCATTCACCACATTGGTGTGCACCTCCAAGCTGGTACCTCGAGAAGGGCGAATTCTGCAG ATATCCATCACACTGGCGGCCGCTCGAGCATGCATCTAGCTTAAGCTTAGGATCCATCCCGGGTG ATATCTAACGCGTTTTCTAGATTACTAGTTTGTCGACTTGAATTCTTATCGATTTACGCGTAAGATCT TTCTAGTAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTC CTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTC

3 ATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGC AACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACC TGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCC TGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGG GAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTT CTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGC GGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCaGATcTCCCTTTGGGCCGCCGCCTCCC CGCATACCGGCAAGAAATACAACCACAAATGGAATTGAGGAGAAATGGTAGGCAATGTGGCATGTC TGAAAAAGAGGAGGAATGATGAAGTATCTCAGACTTATTTTATAAGGGAGATACTGTGCTGAGTTC TTCCCTTTGAGGAAGGTATGTCATATGAATCCATTTCGAATCAAATCAAACTAATAAAGTATGTATTG TAAGGTAAAAGGAAAAGACAAAGAAGAAGAAGAAAGAAGAAAGCCTTCAAGAGGATGATGACAGAGT TAGAAGATCGCTTCAGGAAGCTATTTGGCACGACTTCTACAACGGGAGACAGCACAGTAGATTCTGA AGATGAACCTCCTAAAAAAGAAAAAAGGGTGGACTGGGATGAGTACTGGAACCCTGAAGAAATAGA AAGAATGCGAGTATATAACCAGTGCTTTGTGAAACTTCGAGGAGTCTCTTTGTTGAGGACTTTTGA GTTCTCCCTTGAGGCTCCCACAGATACAATAAATATTTGAGATTGAACCCTGTCGAGTATCTGTGTA ATCTTTTTTACCTGTGAGGTCTCGGAATCCGGGCCGAGAACTTCGCAGGTACCCAGCTTTTGTTCC CTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTA TCCGCTCACAATTCCACACAACATACGAGCCGGGAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGA GTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCC AGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTT CCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGG CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGAC GAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACC AGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACC TGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTT CGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCA GCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG GCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTT CGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGT TTGCAAACAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGG GTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATC TTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGT CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCAT AGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTG CTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCC GGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGC CGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGC ATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGA AGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGC CATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGC GGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTA AAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTT CTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAAT GTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCG GATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGTGCACATTTCCCCGAAAAGTG CCACCTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTT TAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGT GTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAA AACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAG GTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAG CCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCA AGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCG CGTCCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTAT TACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCC AGTCACGACGTTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGG AGCTCCACCGCGG

4 Plasmid Analysis by Restriction Endonuclease Cleavage Pattern pfiv3.2rsvmcs GTVC ID#: G0656 Plasmid Prep Date: 5/23/08 Concentration: 2.9ug/ul Predicted fragments size: BsaI-HF SspI-HF 2731 bp 2731 bp 2179 bp 2176 bp 1376 bp 1249 bp 130 bp

5 Information and Cloning Suggestions for Working with pfiv3.2 plasmids: Background: Unlike many other retroviruses, lentiviral vectors have the advantage of infecting both dividing and non-dividing cells. However, they retain stable and long-term expression which is heritable. Lentiviral vectors are produced through a triple plasmid transfection reaction, which includes a transgene shuttle plasmid, a packaging plasmid, and an envelope plasmid. Lentivirus can be pseudo-typed with different envelopes to infect certain tissues and cell lines with greater efficiency. These viral vectors are able to accommodate transgene inserts of approximately 6.5Kb. Viral titers range between 1.0E+7 to 5.0E+8 TU/ml. The Feline Immunodeficiency viral vectors are replicationincompetent and have not been found to infect humans. There are several lentiviral reporter vectors available for purchase from the Viral Vector Core. FIVbased lentiviral vectors are available to University of Iowa investigators and outside users. Investigators outside the University of Iowa may obtain these vectors through a three party Material Transfer Agreement with Novartis Corporation and the University of Iowa. pvetlcmvmcs Backbone Origin: This cloning and expression plasmid was developed by Chiron Technologies: A series of stepwise PCR amplifications were inserted in the pbluescriptksii(+) phagemid to create the FIV backbone plasmid called ptfivl. This plasmid contained the complete 5 LTR and 3 LTR and a long region (0.55kb) of the FIV gag gene. This backbone was further modified to replace the U3 region of the 5 LTR with the CMV promoter-enhancer to create the ptc/fl backbone. The CMV promoter was then again inserted at the 5 end but immediately before the multiple cloning sites and the backbone was renamed pvet L CMVskh10 (currently named pvet L CMVmcs). FIV3.2 Plasmid Vector Origin: The FIV3.2 plasmid is a derivative of Novartis pvet L CMVmcs cloning plasmid (description above). Several modifications were made to the original construct to improve safety and transgene expression. This plasmid was modified by Patrick L. Sinn, PhD (University of Iowa): The lentiviral central polypurine tract and the central termination sequence were added directly downstream of the gag sequence. The Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element, WPRE, was added directly upstream of the rev response element, RRE. The major splice donor and the initial gag sequence each have a mutation but the packaging signal was retained. The FIV 3 LTR was rendered self-inactivating by deleting a portion of the U3 region. Insert Size: Lentiviral vectors are able to accommodate transgene inserts of approximately 6.5Kb. Typically, vector titers decrease inversely proportionally with increasing transgene sizes above 6.5Kb. Note: When cloning your gene of interest, do not include a polyadenylation signal. Inclusion of a poly A signal will not allow proper packaging of lentiviral particles.

6 Lentiviral Production: The University of Iowa Viral Vector Core utilizes a triple plasmid transfection system: a packaging plasmid, envelope plasmid and transgene plasmid. The packaging plasmid encodes for the necessary viral proteins in trans, but they are not packaged into the particles. The envelope plasmid encodes for the envelope protein in trans. The transgene plasmid contains your gene of interest. It also retains the minimal cis acting viral sequences necessary for packaging, reverse transcription and integration. So, when the virus particles are assembled, the accessory genes required for subsequent viral replications are not included, therefore, making the vector replication deficient. We will require 250ug of purified transgene plasmid for production of your vector for a single 500ul prep of concentrated FIV vector. The packaging and envelope plasmids are provided by the UI VVC. The services provided for production are: Triple plasmid transfection Viral particle concentration Titer Assay (transducing units/ml) Plasmid Amplification and QC: Amplification of the pfiv3.2 plasmids: The pfiv3.2 plasmid backbone is ampicillin resistant. Pick a single colony and inoculate in LB broth containing 100g/ml of Ampicillin. Grow on LB agar plates containing 100ug/ml of Ampicillin. We recommend transforming your final miniprep into a stable competent cell line such as SURE2, Stbl2, or Stbl3 to avoid unwanted recombination in viral vector plasmids. We prefer Stbl3 in the Viral Vector Core. Sub-cloning, however, can be difficult in these competent cells. We recommend DH5a competent cells for subcloning. Transform your final, confirmed miniprep into a stable competent cell line. Maxi preps: Use high quality, endotoxin free plasmid purification kits for DNA extractions. The Viral Vector Core also provides maxi prep service for viral vector production. Restriction Digest Analysis: In addition to sequencing, pfiv3.2 plasmids can be digested with BsaI or SspI to confirm the integrity of the plasmid. It is recommended to run a sample of the un-cut and linearized plasmid at the same time. The Viral Vector Core requires a plasmid digest along in addition to the sequence and a map for each plasmid submission. Sequencing Primers for Verification of the Transgene Insert: Additional primers will need to be designed specifically for each cloning project to confirm insertion of your gene of interest. WPREreverse 5 - AGCTGACAGGTGGTGGCAAT-3 Protein expression or mirna knockdown All the plasmids provided at the Viral Vector Core are also expression vectors. Prior to sending the plasmid for virus production, we recommend testing for protein of interest expression or mirna knockdown of protein expression. References: Johnston JC, Gasmi M, Lim LE, Elder JH, Yee JK, Jolly DJ, Campbell KP, Davidson BL, Sauter SL. Minimum Requirements for Efficient Transduction of Dividing and Nondividing Cells by Feline Immunodeficiency Virus Vectors. J Virol June; 73(6): Stein CS, Davidson BL. Gene Transfer to the Brain Using Feline Immunodeficiency Virus-Based Lentivirus Vectors. Methods Enzymology 346: , Harper SQ, Davidson BL. Plasmid-based RNA interference: Construction of small-hairpin RNA (shrna) expression vectors. Methods Mol Biol 309: , 2005.

7 Harper SQ, Staber PD, Beck CR, Fineberg SK, Stein CS, Ochoa D, Davidson BL. Optimization of Feline Immunodeficiency Virus Vectors for RNA Interference. J Virol 80(19): , Boudreau RL, Davidson BL. Chapter 14 - Generation of Hairpin-Based RNAi Vectors for Biological and Therapeutic Application. Methods Enzymology 507: , Please contact us with any questions: Viral Vector Core vectors@uiowa.edu University of Iowa 500 Newton Road 221 Eckstein Medical Research Building Iowa City, IA Tel: (319)

G0411 pfiv3.2mcsegfp. Plasmid Features

G0411 pfiv3.2mcsegfp. Plasmid Features G0411 pfiv3.2mcsegfp Plasmid Features Coordinates Feature CMV/5 LTR hybrid 1:682 Major Splice Donor 926:957 Partial gag 958:1468 Central Polypurine Tract 1494:1653 Multiple cloning sites 1653:1714 egfp

More information

G0752 pfiv3.2mcswtiresegfp

G0752 pfiv3.2mcswtiresegfp G0752 pfiv3.2mcswtiresegfp Plasmid Features Coordinates Feature 1-682 CMV/5 LTR Hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1653-1738 Multiple Cloning Sites 1739-2325 wtires 2326-3045

More information

G0202 pfbaavmcsbghpa MCS. Red type indicates unique restriction site. Plasmid Features:

G0202 pfbaavmcsbghpa MCS. Red type indicates unique restriction site. Plasmid Features: G0202 pfbaavmcsbghpa Plasmid Features: Coordinates Feature 183-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 820-975 MCS 976-1189 BgHpA 1243-1372 AAV2 ITR (130bp) 1929-2462 Gentamicin

More information

Red type indicates unique restriction site. Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)

Red type indicates unique restriction site. Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen) G0619 pfbaavmcscmvegfp SV40pA Plasmid Features: Coordinates Feature 194-348 Tn7L 376-511 SV40pA (complementary-remnant of pfb cloning) 678-818 AAV2 ITR (141bp) 877-969 MCS 970-1549 CMV Promoter 1569-2288

More information

Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)

Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen) G01067 pfbaavcagmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 938-2607 CAG 2600-2685 mcs 2687-3273 wtires 3274-3984 mcherry

More information

Multiple cloning site between CAG and wild type IRES:

Multiple cloning site between CAG and wild type IRES: G0747 pfbaavcagmcs wtiresegfpbghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 376-511 SV40pA Complementary 678-818 AAV2 ITR (141bp) 938-2607 CAG promoter 872-955 mcs 2687-3273 wtires (11th ATG

More information

Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen)

Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen) G01066 pfbaavmcswtiresmcherrybghpa Plasmid Features: Coordinates Feature 194-348 Tn7L 377-617 SV40pA Complementary 678-818 AAV2 ITR (141bp) 860-955 mcs 956-1542 wtires 1543-2253 mcherry 2268-2481 BgHpA

More information

Adenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X

Adenoviral Expression Systems. Lentivirus is not the only choice for gene delivery. Adeno-X Adenoviral Expression Systems Lentivirus is not the only choice for gene delivery 3 Adeno-X Why choose adenoviral gene delivery? Table I: Adenoviral vs. Lentiviral Gene Delivery Lentivirus Adenovirus Infects

More information

SV40pA. Plasmid Features: Antibiotic Resistance: Ampicillin Backbone: pbr322

SV40pA. Plasmid Features: Antibiotic Resistance: Ampicillin Backbone: pbr322 G1072 pacad5cagmcswtiresmcherry- SV40pA Plasmid Features: Coordinates Feature ITR: 16-118 Ad5: 16-368 and 897-3361 CAG 441-2112 MCS: 2121-2177 wtires 2179-2769 mcherry 2765-3475 SV40pA: 3484-3923 Ampicillin:

More information

Plasmid Features: Coordinates Feature Ad5: and mcmv: MCS: SV40: Ampicillin: (Complimentary)

Plasmid Features: Coordinates Feature Ad5: and mcmv: MCS: SV40: Ampicillin: (Complimentary) G0688 pacad5cmvmcssv40pa Plasmid Features: 6210bp Coordinates Feature Ad5: 16-368 and 1441-3899 mcmv: 385-907 MCS: 913-1002 SV40: 1003-1470 Ampicillin: 6007-5147 (Complimentary) Antibiotic Resistance:

More information

G0796 pacad5tretightmcssv40pa

G0796 pacad5tretightmcssv40pa G0796 pacad5tretightmcssv40pa Plasmid Features: 6009bp Coordinates Feature ITR: 16-118 Ad5 wt 16-365 and 1240-3698 TRE-tight: 402-717 SV40: 802-1239 Ampicillin: 5806-4946 Antibiotic Resistance: Ampicillin

More information

G0463 pscaavmcsbghpa MCS. Plasmid Features:

G0463 pscaavmcsbghpa MCS. Plasmid Features: 3200 G0463 pscaavmcsbghpa Plasmid Features: Coordinates Feature 980-1085 AAV2 ITR 106bp (mutated ITR) 1110-1226 MCS 1227-1440 BgHpA 1453-1595 AAV2 ITR (143bp) 2496-3356 B-lactamase (Ampicillin) Antibiotic

More information

G1059 pacad5mcswtiresmcherry SV40pA

G1059 pacad5mcswtiresmcherry SV40pA G1059 pacad5mcswtiresmcherry SV40pA Plasmid Features: 6958bp Coordinates Feature ITR: 16-118 Ad5: 16-368 and 2189-4647 MCS: 375-456 wtires 445-1031 mcherry 1032-1742 SV40pA: 1751-2188 Ampicillin: 6755-5895

More information

Red Type Indicates Unique Site

Red Type Indicates Unique Site 3600 G0605 pscaavmcmvmcsbghpa Plasmid Features: Coordinates Feature 980-1084 AAV2 5 ITR 1144-1666 modified CMV 1667-1761 MCS 1762-1975 BgHpA 1987-2114 AAV2 3 ITR 3031-3891 B-lactamase (Ampicillin) Antibiotic

More information

Manufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray

Manufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray Manufacturing Viral Gene Therapy s: 1 Dr. Vice President, Research & Development Audentes Therapeutics, Inc. San Francisco, USA Natural virus life cycle Late Early Viral Virally infected cell Naïve cell

More information

Plasmid Features: Coordinates Feature ITR: Ad5: and hsyn1 Promoter SV40: Ampicillin:

Plasmid Features: Coordinates Feature ITR: Ad5: and hsyn1 Promoter SV40: Ampicillin: 4600 G0864 pad5hsyn1mcssv40pa Plasmid Features: 6155bp Coordinates Feature ITR: 16-118 Ad5: 16-365 and 903-3357 hsyn1 Promoter 399-862 SV40: 948-1385 Ampicillin: 5092-5952 Antibiotic Resistance: Ampicillin

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

VECTOR SYSTEMS. Vector Systems

VECTOR SYSTEMS. Vector Systems VECTOR SYSTEMS Vector Systems The vector systems currently available through Penn Vector Core are those derived from adenoassociated virus (AAV), adenovirus and lentivirus. The Core offers AAV-based vectors

More information

LoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr

LoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr LeGO-C-p53-shRNA SIN-LTR? RRE cppt H1/TO shrna-p53 SFFV mcherry wpre SIN-LTR LeGO-C-scr-shRNA SIN-LTR? RRE cppt H1/TO shrna-scr SFFV mcherry wpre SIN-LTR Supplementary Figure 3A: Scheme of the lentiviral

More information

VECTOR SAFETY INFORMATION. AAV Vectors: Material Information

VECTOR SAFETY INFORMATION. AAV Vectors: Material Information VECTOR SAFETY INFORMATION AAV Vectors: Material Information AAV vectors contain recombinant transgene sequences (e.g. encoding reporter or therapeutic genes) flanked by the AAV inverted terminal repeats

More information

Quality Control Assays

Quality Control Assays QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Lenti-X DD-ZsGreen1 Vector Set Table of Contents Product Information... 1 plvx-dd-zsgreen1 Reporter Vector... 3 plvx-dd-zsgreen1 Control Vector... 4 Additional Information... 5

More information

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)

More information

shrna expression Cloning Kit

shrna expression Cloning Kit shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-

More information

Development of Positive Control for Hepatitis B Virus

Development of Positive Control for Hepatitis B Virus Human Journals Research Article December 2015 Vol.:2, Issue:2 All rights are reserved by Saurabh Bandhavkar et al. Development of Positive Control for Hepatitis B Virus Keywords: Hepatitis B virus, pbluescript,

More information

psmpuw-u6-puro Lentiviral Expression Vector

psmpuw-u6-puro Lentiviral Expression Vector Product Data Sheet psmpuw-u6-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-221 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

pcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions Each kit comes with the following components:

pcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions Each kit comes with the following components: pcmv6-neo Vector Application Guide Table of Contents Package Contents and Storage Conditions... 1 Product Description... 1 Introduction... 1 Production and Quality Assurance... 2 Methods... 2 Other required

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

pslic-purop2a Lentivirus Plasmid Construction Kit (Cat# LT2002)

pslic-purop2a Lentivirus Plasmid Construction Kit (Cat# LT2002) pslic-purop2a Lentivirus Plasmid Construction Kit (Cat# LT2002) [ provides pslic-purop2a lentivirus plasmid construction kit to let user create the lentivirus plasmid expressing the gene of interest. This

More information

MISSION shrna Library: Next Generation RNA Interference

MISSION shrna Library: Next Generation RNA Interference Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology

More information

Thermo Scientific Open Biosystems LentiORF plex-mcs Vector

Thermo Scientific Open Biosystems LentiORF plex-mcs Vector Technical Manual Thermo Scientific Open Biosystems LentiORF plex-mcs Vector Catalog #: OHS4735 Product Description The plex-mcs Empty Vector is the lentiviral plex vector containing a multiple cloning

More information

peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)

peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in

More information

Cloning of shrna Templates into shrna Expression Vectors. User Manual

Cloning of shrna Templates into shrna Expression Vectors. User Manual Cloning of shrna Templates into shrna Expression Vectors v3a, 8-29-2013 Table of Contents Page A. Background 2 B. Required Materials 2 C. Cloning of shrna Template Oligonucleotides into shrna Expression

More information

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support

Diagnosis Sanger. Interpreting and Troubleshooting Chromatograms. Volume 1: Help! No Data! GENEWIZ Technical Support Diagnosis Sanger Interpreting and Troubleshooting Chromatograms GENEWIZ Technical Support DNAseq@genewiz.com Troubleshooting This troubleshooting guide is based on common issues seen from samples within

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631982

More information

Custom AAV Vector Production Request Form

Custom AAV Vector Production Request Form Oregon National Primate Research Center ONPRC Request Date: Mail Code L584-505 N.W. 185th Avenue, Beaverton, OR 97006 Lab Tel: 503-629-4042, Web: goo.gl/3kyai Custom AAV Vector Production Request Form

More information

pfb and pfb-neo Retroviral Vectors

pfb and pfb-neo Retroviral Vectors pfb and pfb-neo Retroviral Vectors INSTRUCTION MANUAL Catalog #217563 (pfb Retroviral Vector) and #217561 (pfb-neo Retroviral Vector) Revision A For In Vitro Use Only 217561-12 LIMITED PRODUCT WARRANTY

More information

ExactORF cdna Clones. Application Guide. Table of Contents

ExactORF cdna Clones. Application Guide. Table of Contents ExactORF cdna Clones Application Guide Table of Contents Package Contents and Storage Conditions... 2 Optional Reagents... 2 Related Products... 2 Protocols for handling the DNA... 3 Protocol for Plasmid

More information

Cloning of shrna Templates into shrna Expression Vector User Manual

Cloning of shrna Templates into shrna Expression Vector User Manual Cloning of shrna Templates into shrna Expression Vector User Manual Table of Contents Page A. Background 1 B. Required Materials 1 C. Cloning of shrna Template Oligonucleotides into shrna Expression Vector

More information

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm

Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

psmpuw-puro Lentiviral Expression Vector

psmpuw-puro Lentiviral Expression Vector Product Data Sheet psmpuw-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-212 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human

More information

pdsipher and pdsipher -GFP shrna Vector User s Guide

pdsipher and pdsipher -GFP shrna Vector User s Guide pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...

More information

Protocols for cell lines using CRISPR/CAS

Protocols for cell lines using CRISPR/CAS Protocols for cell lines using CRISPR/CAS Procedure overview Map Preparation of CRISPR/CAS plasmids Expression vectors for guide RNA (U6-gRNA) and Cas9 gene (CMV-p-Cas9) are ampicillin-resist ant and stable

More information

UTR Reporter Vectors and Viruses

UTR Reporter Vectors and Viruses UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for

More information

Viral Delivery Guide. Choosing the right viral vector for your research

Viral Delivery Guide. Choosing the right viral vector for your research Viral Delivery Guide Choosing the right viral vector for your research OVERVIEW Transfection, the introduction of foreign DNA or RNA into eukaryotic cells, is an indispensable tool for studying gene expression

More information

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors

Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Lentiviral CRISPR guild RNA Cloning Kit for constructing CRISPR targeting grna lentivectors Cat# Product Name Amount Application grna-h1-gb grna-h1-gp grna-h1-rb grna-h1-rp grna-h1-puro grna-h1-bsd grna-u6-gb

More information

psmpuw Universal Lentiviral Expression Vector (Promoterless)

psmpuw Universal Lentiviral Expression Vector (Promoterless) Product Data Sheet psmpuw Universal Lentiviral Expression Vector (Promoterless) CATALOG NUMBER: VPK-211 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector

More information

The Molecular Virology Support Core: Adenoviral Vectors and Beyond

The Molecular Virology Support Core: Adenoviral Vectors and Beyond The : Adenoviral Vectors and Beyond Christoph A. Kahl, Ph.D. Viral Vector Workshop, May 5th, 2011 Outline 1) Overview of the MVSC 2) Adenoviral Vectors 3) Expertise and Services Overview What does the

More information

Your Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs

Your Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

Supplementary Methods pcfd5 cloning protocol

Supplementary Methods pcfd5 cloning protocol Supplementary Methods cloning protocol vermilion trna grna trna grna U6:3 Terminator AmpR attb is a vector for expressing one or multiple trna-flanked Cas9 grnas under the control of the strong, ubiquitous

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Catalog Number. Mouse Unique & Validated TRC 2.0 SHPM2 Pooled shrna Library. Pooled shrna Library SHPHLIBR

Catalog Number. Mouse Unique & Validated TRC 2.0 SHPM2 Pooled shrna Library. Pooled shrna Library SHPHLIBR MISSION LentiPlex Human and Mouse Pooled shrna Libraries Catalog Number Product Description Catalog Number Product Description SHPH01 Human TRC 1.0 Pooled shrna Library SHPM01 Mouse TRC 1.0 Pooled shrna

More information

Molecular Cloning. Restriction Enzymes and Ligases

Molecular Cloning. Restriction Enzymes and Ligases Tools in Genetic engineering The science of using living systems to benefit humankind is called biotechnology. Technically speaking, the domestication of plants and animals through farming and breeding

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Pre-made Reporter Lentivirus for p53 Signal Pathway

Pre-made Reporter Lentivirus for p53 Signal Pathway Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Genetics Lecture Notes Lectures 13 16

Genetics Lecture Notes Lectures 13 16 Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons

More information

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D.

Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More. Ed Davis, Ph.D. TECHNICAL NOTE Genome Editing: Cas9 Stable Cell Lines for CRISPR sgrna Validation, Library Screening, and More Introduction Ed Davis, Ph.D. The CRISPR-Cas9 system has become greatly popular for genome

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

psmpuw-ires-blasticidin Lentiviral Expression Vector

psmpuw-ires-blasticidin Lentiviral Expression Vector Product Data Sheet psmpuw-ires-blasticidin Lentiviral Expression Vector CATALOG NUMBER: VPK-219 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on

More information

Your Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp

Your Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

sherwood - UltramiR shrna Collections

sherwood - UltramiR shrna Collections sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome

More information

Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have

Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have Suppl. Figure 4 LeGO-iG2-Puro+-p53 SIN-LTR ψ RRE cppt SFFV human Wt-p53 IRES egfp2a PuroR_opt wpre SIN-LTR LeGO-G2-Puro+ SIN-LTR ψ RRE cppt SFFV egfp 2A PuroR_opt wpre SIN-LTR Supplementary Figure 4A:

More information

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System

TrueORF TM cdna Clones and PrecisionShuttle TM Vector System TrueORF TM cdna Clones and PrecisionShuttle TM Vector System Application Guide Table of Contents Package Contents and Storage Conditions... 2 Related, Optional Reagents... 2 Related Products... 2 Available

More information

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector)

CELLTECHGEN For Research Only. Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Construction of sgrna expression vector for Lenti-virus system (Example: Lenti-U6 sgrna-ef1 -Puro vector) Catalog number: CTG-CAS9-11 Introduction The vector Lenti-U6 sgrna-ef1 -Puro is designed for expression

More information

GENETIC ENGINEERING worksheet

GENETIC ENGINEERING worksheet Section A: Genetic Engineering Overview 1. What is genetic engineering? 2. Put the steps of genetic engineering in order. Recombinant product is isolated, purified and analyzed before marketing. The DNA

More information

MicroRNA Expression Plasmids

MicroRNA Expression Plasmids MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map

More information

Pre-made expression Adenovirus product manual

Pre-made expression Adenovirus product manual Pre-made expression Adenovirus product manual Catalog# Product Name Amounts AVP001 RFP adenovirus AVP002 AVP004 AVP005 AVP011 AVP012 AVP017 AVP010 AVP013 AVP014 AVP015 AVP016 AVP-Null AVP001-PBS AVP002-PBS

More information

MicroRNA Expression Plasmids

MicroRNA Expression Plasmids MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Ectopic Gene Expression in Mammalian Cells

Ectopic Gene Expression in Mammalian Cells Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc

3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget. Application Guide. OriGene Technologies, Inc 3 UTR (untranslated region) Reporter Clone and its vector, pmirtarget Application Guide OriGene Technologies, Inc Package Contents and Storage Conditions 3 UTR reporter clone as 10ug lyophilized plasmid

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Chapter 4. Recombinant DNA Technology

Chapter 4. Recombinant DNA Technology Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon

More information

Recitation CHAPTER 9 DNA Technologies

Recitation CHAPTER 9 DNA Technologies Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector)

CELLTECHGEN For Research Only. Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Construction of all-in-one vector for Lenti-virus system (Example: Lenti-EF1 -Cas9-EGFP-U6 sgrna vector) Catalog number: CTG-CAS9-18 Introduction The vector Lenti-EF1 -Cas9-EGFP-U6 sgrna is designed for

More information

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary

Use of In-Fusion Cloning for Simple and Efficient Assembly of Gene Constructs No restriction enzymes or ligation reactions necessary No restriction enzymes or ligation reactions necessary Background The creation of genetic circuits and artificial biological systems typically involves the use of modular genetic components biological

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

Product Analysis Certificate

Product Analysis Certificate Product: Catalog #: CRISPR (Linearized) SVCRU6H16-L Lot #: 17062801 Description: The Linearized sgrna Cloning and Expression Vector is a human immunodeficiency virus (HIV) lentiviral vector with a constitutive

More information

MicroRNA Expression Plasmids

MicroRNA Expression Plasmids MicroRNA Expression Plasmids Application Guide Table of Contents Package Contents and Related Products... 2 Related, Optional Reagents... 2 Related OriGene Products... 2 Cloning vector:... 3 Vector map

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Lecture 22: Molecular techniques DNA cloning and DNA libraries

Lecture 22: Molecular techniques DNA cloning and DNA libraries Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived

More information

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE

More information

It s All in the Hands Genetic Engineering

It s All in the Hands Genetic Engineering It s All in the Hands Genetic Engineering Genetic Engineering Genetic Engineering is the technique of modifying the genome of an organism by using recombinant DNA technology. Recombinant DNA (rdna) technology

More information