Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have
|
|
- Cleopatra Miles
- 6 years ago
- Views:
Transcription
1 Suppl. Figure 4 LeGO-iG2-Puro+-p53 SIN-LTR ψ RRE cppt SFFV human Wt-p53 IRES egfp2a PuroR_opt wpre SIN-LTR LeGO-G2-Puro+ SIN-LTR ψ RRE cppt SFFV egfp 2A PuroR_opt wpre SIN-LTR Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have been used in this study (not drawn to scale). SIN-LTR, self-inactivating-long-terminal repeat; Ψ, packaging signal; RRE, rev-responsive element; cppt, central polypurine tract; SFFV, Spleen focus-forming virus enhancer/promoter; human Wt-p53, cdna coding for human wild-type p53; IRES, internal ribosome entry site of the Encephalo myocarditis virus; egfp (enhanced green fluorescent protein), a green fluorescent protein; 2A, self cleaving peptide of Porcine Teschovirus-1 (P2A); PuroR-opt, codon optimized cdna of puromycin resistance (PAC, puromycin N-acetyltransferase); wpre, Woodchuck hepatitis virus post-transcriptional regulatory element.
2 A) UKF-NB-3rNUTLIN10µM B) UKF-NB-3rNUTLIN10µM C) UKF-NB-3rNUTLIN10µMwtp53 D) UKF-NB-3rNUTLIN10µMwtp53 E) UKF-NB-3rNUTLIN10µMcontrol F) UKF-NB-3rNUTLIN10µMcontrol Supplementary Figure 4B: UKF-NB-3rNUTLIN10µM cells (A + B), UKF-NB-3rNutlin10µM cells transduced with LeGO-iG2-Puro+-p53 (UKF-NB-3rNUTLIN10µMwtp53) (C + D) and UKF-NB3rNutlin10µM cells transduced with LeGO-G2-Puro+ (UKF-NB-3rNUTLIN10µMcontrol) (E+ F) were
3 photographed by inverse light microscopy (A, C, E) and by fluorescence microscopy (B, D, F), using an IX71 fluorescence microscope (Olympus, Hamburg, Germany). Fluorescence dye egfp (enhanced green fluorescent protein) was detected at 484/507nm (excitation/emission). The nontransduced control cell line UKF-NB-3 r NUTLIN 10µM showed no fluorescence (B). In contrast, UKF- NB-3 r NUTLIN 10µMwtp53 and UKF-NB-3 r NUTLIN 10µMcontrol cells displayed high fluorescence due to successful transduction with LeGO-vectors (D, F).
4 p53 β-actin Supplementary Figure 4C: Western Blot was carried out with UKF-NB-3, UKF-NB-3 r NUTLIN 10µM, UKF-NB-3 r NUTLIN 10µMcontrol, or UKF-NB-3 r NUTLIN 10µMwtp53 cells, detecting p53 (Alexis Biochemicals via AXXORA Deutschland, Lörrach, Germany) and β-actin as loading control (Sigma, Munich, Germany).
5 MATERIAL AND METHODS Cloning of lentiviral vectors. Standard molecular cloning techniques were used to generate viral vectors based on Lentiviral Gene Ontology (LeGO) vectors [1, also Maps and sequence data of the vectors are available upon request. The human p53-cdna was kindly provided by Eva Lenfert, Department of Tumor Virology, Heinrich-Pette-Institute Hamburg. The 1182 bp cdna coding for human p53 gene (sequence identical to Accession No. NM_000546) was cloned by PCR into LeGO-iG2-Puro+ using EcoRI and NotI. The sequence of p53 was verified by sequencing. The internal SFFV promoter of this vector transcribes a bicistronic mrna with an internal ribosome entry site (IRES) of the Encephalo myocarditis virus (EMCV), expressing human wild type p53 together with a dual marker, the enhanced green fluorescent protein (egfp) coupled to a codon optimized puromycin resistance [2] by a P2A sequence. The monocistronic vector LeGO-G2-Puro+ expressing egfp and puromycin resistance coupled by a P2A sequence served as a control. Generation of viral particles. Cell-free viral supernatants were generated by transient transfection of 293T packaging cells as described [1], using the 3 rd generation packaging plasmids pmdlg/prre and prsv-rev [3] together with phcmv-vsv-g [4]. Supernatants containing pseudotyped vector particles were titrated on 293T target cells. Gene transfer rates were analysed 2 days after transduction by fluorescence activated cell scanning (FACS). Titres of 1 x10 7 (LeGO-iG2-Puro+-p53) and 2,5 x10 7 (LeGO-G2-Puro+) VSV-G pseudotyped vector particles per millilitre unconcentrated supernatants were obtained.
6 Cell culture and lentiviral gene transfer. All cells were cultured in their respective growth media supplemented with penicillin/streptomycin. For transduction of UKF-NB-3 r NUTLIN 10 target cells, 5x10 4 cells in 500µl medium were plated per well in a 24-well plate. The next day, 100µl and 250µl of viral supernatant per well were added and incubated for 3 days. Fluorescence Microscopy. Pictures were taken using an IX71 fluorescence microscope (Olympus, Hamburg, Germany). Fluorescence dye egfp was detected at 484/507nm (excitation/emission) Western Blot. Cells were lysed in Triton X sample buffer and separated by SDS-PAGE, as described before [5]. Proteins were detected using specific antibodies against β-actin (Sigma, Munich, Germany) or p53 (Alexis Biochemicals via AXXORA Deutschland, Lörrach, Germany), and were visualized by enhanced chemiluminescence using a commercially available kit (Amersham via GE Healthcare, Munich, Germany). Viability assay. Cell viability was tested by the 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) dye reduction assay after 96 h incubation, modified as described before [6]. References [1] Weber K, Bartsch U, Stocking C, Fehse B. A Multicolor Panel of Novel Lentiviral Gene Ontology (LeGO) Vectors for Functional Gene Analysis. Mol Ther 2008;16:
7 [2] Weber K, Mock U, Petrowitz B, Bartsch U, Fehse B. Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis. Gene Ther 2010;17(4): [3] Dull T, Zufferey R, Kelly M, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998;72: [4] Beyer WR, Westphal M, Ostertag W, von Laer D. Oncoretrovirus and lentivirus vectors pseudotyped with lymphocytic choriomeningitis virus glycoprotein: generation, concentration, and broad host range. J Virol 2002;76: [5] Michaelis M, Michaelis UR, Fleming I, Suhan T, Cinatl J, Blaheta RA, Hoffmann K, Kotchetkov R, Busse R, Nau H, Cinatl J Jr. Valproic acid inhibits angiogenesis in vitro and in vivo. Mol Pharmacol. 2004;65: [6] Michaelis M, Suhan T, Cinatl J, Driever PH, Cinatl J Jr. Valproic acid and interferonalpha synergistically inhibit neuroblastoma cell growth in vitro and in vivo. Int J Oncol 2004;25:
LoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr
LeGO-C-p53-shRNA SIN-LTR? RRE cppt H1/TO shrna-p53 SFFV mcherry wpre SIN-LTR LeGO-C-scr-shRNA SIN-LTR? RRE cppt H1/TO shrna-scr SFFV mcherry wpre SIN-LTR Supplementary Figure 3A: Scheme of the lentiviral
More informationCertificate of Analysis
Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer
More informationPre-made Reporter Lentivirus for p53 Signal Pathway
Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:
More informationPre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression
Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS
More informationCertificate of Analysis
Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631982
More informationG0752 pfiv3.2mcswtiresegfp
G0752 pfiv3.2mcswtiresegfp Plasmid Features Coordinates Feature 1-682 CMV/5 LTR Hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1653-1738 Multiple Cloning Sites 1739-2325 wtires 2326-3045
More informationEctopic Gene Expression in Mammalian Cells
Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic
More informationpsmpuw-puro Lentiviral Expression Vector
Product Data Sheet psmpuw-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-212 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human
More informationpsmpuw-u6-puro Lentiviral Expression Vector
Product Data Sheet psmpuw-u6-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-221 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human
More informationG0411 pfiv3.2mcsegfp. Plasmid Features
G0411 pfiv3.2mcsegfp Plasmid Features Coordinates Feature CMV/5 LTR hybrid 1:682 Major Splice Donor 926:957 Partial gag 958:1468 Central Polypurine Tract 1494:1653 Multiple cloning sites 1653:1714 egfp
More informationAntibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies
G0656 pfiv3.2rsvmcs Coordinates Plasmid Features 1-682 CMV/5 LTR hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1695-2075 RSV Promoter 2104-2222 Multiple Cloning Sites 2244-2839 WPRE 2868-3009
More informationManufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray
Manufacturing Viral Gene Therapy s: 1 Dr. Vice President, Research & Development Audentes Therapeutics, Inc. San Francisco, USA Natural virus life cycle Late Early Viral Virally infected cell Naïve cell
More informationpsmpuw-ires-blasticidin Lentiviral Expression Vector
Product Data Sheet psmpuw-ires-blasticidin Lentiviral Expression Vector CATALOG NUMBER: VPK-219 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on
More informationCertificate of Analysis
Certificate of Analysis Lenti-X DD-ZsGreen1 Vector Set Table of Contents Product Information... 1 plvx-dd-zsgreen1 Reporter Vector... 3 plvx-dd-zsgreen1 Control Vector... 4 Additional Information... 5
More informationOmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells
OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)
More informationSupplemental Methods Cell lines and culture
Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,
More informationpsmpuw Universal Lentiviral Expression Vector (Promoterless)
Product Data Sheet psmpuw Universal Lentiviral Expression Vector (Promoterless) CATALOG NUMBER: VPK-211 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector
More informationVECTOR SAFETY INFORMATION. AAV Vectors: Material Information
VECTOR SAFETY INFORMATION AAV Vectors: Material Information AAV vectors contain recombinant transgene sequences (e.g. encoding reporter or therapeutic genes) flanked by the AAV inverted terminal repeats
More informationUTR Reporter Vectors and Viruses
UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for
More informationPre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina)
Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina) Cat# Product Name Amounts LVP326 LVP326-PBS LVP325 LVP325-PBS LVP283 LVP283-PBS LVP323 LVP323-PBS LVP020
More informationViraBind Lentivirus Concentration and Purification Kit
Product Manual ViraBind Lentivirus Concentration and Purification Kit Catalog Number VPK-091 VPK-091-5 5 preps 25 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus
More informationViraBind Lentivirus Concentration and Purification Kit
Product Manual ViraBind Lentivirus Concentration and Purification Kit Catalog Number VPK-090 2 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based on
More informationMag4C-Lv Kit - Results
Mag4C-Lv Kit - Results Mag4C-Lv Kit Magnetic capture for viral concentration & storage buffer for superior viral preservation OZ Biosciences is delighted to announce the launching of a new product Mag4C-Lv
More informationPre-made Lentiviral Particles for nuclear permeant CRE recombinase expression
Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE
More informationLenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus
G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40
More informationTransIT -Lenti Transfection Reagent
Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting
More informationMISSION shrna Library: Next Generation RNA Interference
Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology
More informationEfficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and
Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and hybrid microcarriers Alexander S. Timin a, Albert R. Muslimov b, Kirill V. Lepik b, Olga S. Epifanovskaya b, Alena
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1
Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.
More informationCellPlayer CytoLight Green (Lenti, CMV, no selection)
CellPlayer CytoLight Green (Lenti, CMV, no selection) Essen BioScience Catalog Number: 4513 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells
More informationSupplementary
Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived
More informationLenti-Pac HIV Expression Packaging Kit User Manual
G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40
More informationSupplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected
More informationSupplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of
LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of
More informationIncuCyte CytoLight Green (Lenti, EF-1 alpha, puro)
IncuCyte CytoLight Green (Lenti, EF-1 alpha, puro) Essen BioScience Catalog Number: 4481 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationFig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of
Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and
More informationCellPlayer NucLight Red (Lenti, EF-1 alpha, puro)
Essen BioScience Catalog Number: 4476 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells for gene therapy and/or research purposes. The Essen
More informationSupplementary Methods
Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed
More informationYour Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More information(a) Immunoblotting to show the migration position of Flag-tagged MAVS
Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing
More informationSUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement
SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for
More informationThermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles
Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna
More informationVivid Colors plenti6.3/v5-gw/emgfp Expression Control Vector
user guide Vivid Colors plenti6.3/v5-gw/emgfp Expression Control Vector Lentiviral expression plasmid containing EmGFP for optimization of lentivirus production, titer, and transduction using the ViraPower
More informationVHL inhibition as protective during states of mitochondrial dysfunction. Isha H. Jain et al. Science 2016;352:54-61
VHL inhibition as protective during states of mitochondrial dysfunction Isha H. Jain et al. Science 2016;352:54-61 La fosforilazione ossidativa nel mitocondrio Tymoczko et al., PRINCIPI DI BIOCHIMICA,
More informationRGB marking with lentiviral vectors for multicolor clonal cell tracking
RGB marking with lentiviral vectors for multicolor clonal cell tracking Kristoffer Weber 1, Michael Thomaschewski 1, Daniel Benten 2 & Boris Fehse 1 1 Research Department Cell and Gene Therapy, Clinic
More informationViraBind PLUS Lentivirus Concentration and Purification Kit
Product Manual ViraBind PLUS Lentivirus Concentration and Purification Kit Catalog Number VPK-095 2 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based
More informationGaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo
Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453
More informationMutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells
Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.
More informationSUPPLEMENTAL FIGURES AND TABLES
SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2
More informationYour Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp
Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral
More informationSUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION
SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,
More informationTECHNICAL BULLETIN. MISSION shrna Control Transduction Particles
MISSION Transduction Particles Catalog Numbers SHC001V, SHC002V, SHC003V, SHC004V, SHC005V, SHC007V, SHC008V, SHC009V, SHC010V, SHC011V, SHC012V, SHC013V, SHC014V, SHC015V, SHC016V, SHC201V, SHC202V, SHC203V,
More informationViraPower HiPerform Lentiviral Expression Systems
ViraPower HiPerform Lentiviral Expression Systems Lentiviral systems for high-level expression in dividing and non-dividing mammalian cells Cat. nos. K5310-00, K5320-00, K5330-00 and K5340-00 Rev. date:
More informationshrna expression Cloning Kit
shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-
More informationSpecific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors
Nature Methods Specific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors Brigitte Anliker, Tobias Abel, Sabrina Kneissl, Juraj Hlavaty, Antonio Caputi,
More informationFlow cytometric determination of apoptosis by annexin V/propidium iodide double staining.
Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium
More informationVivapure Virus Purification and Concentration Kits
Vivapure Virus Purification and Concentration Kits Fisher Scientific Fast and easy to use kits for virus purification Recombinant virus vectors are the preferred method for a wide range of gene delivery
More informationPremade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications
Premade Lentiviral Particles for ips Stem Factors: Single vector system For generation of induced pluripotent stem (ips) cells and other applications RESEARCH USE ONLY, not for diagnostics or therapeutics
More informationSupporting Information
Supporting Information Nan et al. 10.1073/pnas.1509123112 SI Materials and Methods Plasmids. PAmCherry1-KRas wild type and G12D mutants were generated by subcloning the respective KRas cdna fragments into
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Shear stress determination in microvascular networks.
Supplementary Figure 1 Shear stress determination in microvascular networks. A pressure drop of ~4 mmh2o is applied across the vascular network using a suspension of 2 micron red polystyrene spheres in
More informationViraBind Lentivirus Purification Kit
Product Manual ViraBind Lentivirus Purification Kit Catalog Number VPK-104 10 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based on the human immunodeficiency
More informationViraSafe Universal Lentiviral Expression System, Pantropic
roduct Manual ViraSafe Universal Lentiviral Expression System, antropic Catalog Number VK-211-AN 1 kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vector based on
More informationHeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured
More informationMISSION shrna Plasmid DNA Control Vectors
MISSION Plasmid DNA Vectors Catalog Numbers SHC001, SHC002, SHC003, SHC004, SHC005, SHC007, SHC008, SHC009, SHC010, SHC011, SHC012, SHC013, SHC014, SHC015, SHC016, SHC201, SHC202, SHC203, SHC204, SHC216,
More informationAmplification of Cre- expressing Adenovirus in 293T cells Jointly prepared by Lauren, Kazu, and Bingnan July 2011
Amplification of Cre- expressing Adenovirus in 9T cells Jointly prepared by Lauren, Kazu, and Bingnan July Background on AdenoCre IRE EGFP system (Vector Biolabs, Ad- Cre- IRE- GFP, cat# 7), titer is x
More informationLINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.
Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.
More informationsherwood - UltramiR shrna Collections
sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome
More informationPremade Lentiviral Particles for human ips Stem Factors
Premade Lentiviral Particles for human ips Stem Factors For generating induced pluripotent stem (ips) cells or other applications RESEARCH USE ONLY, not for diagnostics or therapeutics Cat# Product Name
More informationCertificate of Analysis
Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631971
More informationCloning of shrna Templates into shrna Expression Vectors. User Manual
Cloning of shrna Templates into shrna Expression Vectors v3a, 8-29-2013 Table of Contents Page A. Background 2 B. Required Materials 2 C. Cloning of shrna Template Oligonucleotides into shrna Expression
More informationSimple protocol for gene editing using GenCrisprTM Cas9 nuclease
Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of
More informationSupplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/8/347/347ra94/d Supplementary Materials for n mirn-mediated therapy for S6 blocks IRES-driven translation of the N second cistron Yu Miyazaki, Xiaofei
More informationViraSafe mirna Lentiviral Expression System, Ecotropic
Product Manual ViraSafe mirna Lentiviral Expression System, Ecotropic Catalog Number VPK-220-ECO 1 kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18
More informationGene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG
Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More information(Toll Free) (outside US) Page 1
888-266-5066 (Toll Free) 650-968-2200 (outside US) Page 1 System Biosciences (SBI) Contents User Manual I. Introduction and Background... 3 II. Available CytoTracers... 5 III. Protocol... 5 A. Transfection
More informationSUPPLEMENTARY INFORMATION
6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.
More informationSUPPLEMENTAL EXPERIMENTAL PROCEDURES
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla
More informationSupplementary Materials and Methods
Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK
More informationp53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1
Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology
More informationCD93 and dystroglycan cooperation in human endothelial cell adhesion and migration
/, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing
More informationGC GC - AAV2/8-4E10
SUPPLEMENTARY INFORMATION doi:.38/nature660 a Luciferase Expression (Photons/Sec) c f 12 11 11 GC - AAV2/8-Luciferase 9 GC - AAV2/8-Luciferase 0 8 16 24 32 40 48 56 64 Weeks Post-AAV Injection Human IgG
More informationFlow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).
Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationshrna experiment design
97-06-20 shrna experiment design 鄭金松 Core Manager Comparison of sirna and shrna Structure sirna (19-27 nts) shrna (19-27 nts) Advantage vs. disadvantage cost delivery efficiency duration of knockdown renewability
More informationColor-Switch CRE recombinase stable cell line
Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic
More informationNS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5
doi:10.1038/nature09489 Supplementary Figure 1. Methylation pattern of wild type and mutant WNV NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 (N-terminal 300 amino acids) were
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationSparQ Cumate Switch Cat. # QMXXX Series
SparQ Cumate Switch Cat. # QMXXX Series User Manual (ver. 1-090810) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing
More informationZMP Lentiviral shrna-mir Catalog numbers: TLHS1000, TLHK1000, TLMS1001, TLMK1001, TSE0001, TSE0003,TSE0011
ZMP Lentiviral shrna-mir Catalog numbers: TLHS1000, TLHK1000, TLMS1001, TLMK1001, TSE0001, TSE0003,TSE0011 This manual provides information for the propagation, transfection, transduction and viral packaging
More informationcells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to
Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter
More informationIn vitro research method for screening inhibitors of protein translation
WHITE PAPER 1-Step Human Coupled IVT Kit In vitro research method for screening inhibitors of protein translation Use of mammalian in vitro translation (cell-free) systems for high-throughput screening
More informationTITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA 15260
AD Award Number: W81XWH-07-1-0147 TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer PRINCIPAL INVESTIGATOR: Zhou Wang, Ph.D. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA
More informationQuality Control Assays
QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized
More informationVECTOR SYSTEMS. Vector Systems
VECTOR SYSTEMS Vector Systems The vector systems currently available through Penn Vector Core are those derived from adenoassociated virus (AAV), adenovirus and lentivirus. The Core offers AAV-based vectors
More informationCell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).
1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well
More informationPro-DeliverIN TM - Protein Delivery Reagent Results
Pro-DeliverIN TM - Protein Delivery Reagent Results OZ Biosciences is delighted to announce the launching of the innovative Pro-DeliverIN - Protein Delivery Reagent. Pro-DeliverIN is a lipid based formulation
More information