Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have

Size: px
Start display at page:

Download "Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have"

Transcription

1 Suppl. Figure 4 LeGO-iG2-Puro+-p53 SIN-LTR ψ RRE cppt SFFV human Wt-p53 IRES egfp2a PuroR_opt wpre SIN-LTR LeGO-G2-Puro+ SIN-LTR ψ RRE cppt SFFV egfp 2A PuroR_opt wpre SIN-LTR Supplementary Figure 4A: Scheme of the lentiviral vectors, as integrated proviruses, that have been used in this study (not drawn to scale). SIN-LTR, self-inactivating-long-terminal repeat; Ψ, packaging signal; RRE, rev-responsive element; cppt, central polypurine tract; SFFV, Spleen focus-forming virus enhancer/promoter; human Wt-p53, cdna coding for human wild-type p53; IRES, internal ribosome entry site of the Encephalo myocarditis virus; egfp (enhanced green fluorescent protein), a green fluorescent protein; 2A, self cleaving peptide of Porcine Teschovirus-1 (P2A); PuroR-opt, codon optimized cdna of puromycin resistance (PAC, puromycin N-acetyltransferase); wpre, Woodchuck hepatitis virus post-transcriptional regulatory element.

2 A) UKF-NB-3rNUTLIN10µM B) UKF-NB-3rNUTLIN10µM C) UKF-NB-3rNUTLIN10µMwtp53 D) UKF-NB-3rNUTLIN10µMwtp53 E) UKF-NB-3rNUTLIN10µMcontrol F) UKF-NB-3rNUTLIN10µMcontrol Supplementary Figure 4B: UKF-NB-3rNUTLIN10µM cells (A + B), UKF-NB-3rNutlin10µM cells transduced with LeGO-iG2-Puro+-p53 (UKF-NB-3rNUTLIN10µMwtp53) (C + D) and UKF-NB3rNutlin10µM cells transduced with LeGO-G2-Puro+ (UKF-NB-3rNUTLIN10µMcontrol) (E+ F) were

3 photographed by inverse light microscopy (A, C, E) and by fluorescence microscopy (B, D, F), using an IX71 fluorescence microscope (Olympus, Hamburg, Germany). Fluorescence dye egfp (enhanced green fluorescent protein) was detected at 484/507nm (excitation/emission). The nontransduced control cell line UKF-NB-3 r NUTLIN 10µM showed no fluorescence (B). In contrast, UKF- NB-3 r NUTLIN 10µMwtp53 and UKF-NB-3 r NUTLIN 10µMcontrol cells displayed high fluorescence due to successful transduction with LeGO-vectors (D, F).

4 p53 β-actin Supplementary Figure 4C: Western Blot was carried out with UKF-NB-3, UKF-NB-3 r NUTLIN 10µM, UKF-NB-3 r NUTLIN 10µMcontrol, or UKF-NB-3 r NUTLIN 10µMwtp53 cells, detecting p53 (Alexis Biochemicals via AXXORA Deutschland, Lörrach, Germany) and β-actin as loading control (Sigma, Munich, Germany).

5 MATERIAL AND METHODS Cloning of lentiviral vectors. Standard molecular cloning techniques were used to generate viral vectors based on Lentiviral Gene Ontology (LeGO) vectors [1, also Maps and sequence data of the vectors are available upon request. The human p53-cdna was kindly provided by Eva Lenfert, Department of Tumor Virology, Heinrich-Pette-Institute Hamburg. The 1182 bp cdna coding for human p53 gene (sequence identical to Accession No. NM_000546) was cloned by PCR into LeGO-iG2-Puro+ using EcoRI and NotI. The sequence of p53 was verified by sequencing. The internal SFFV promoter of this vector transcribes a bicistronic mrna with an internal ribosome entry site (IRES) of the Encephalo myocarditis virus (EMCV), expressing human wild type p53 together with a dual marker, the enhanced green fluorescent protein (egfp) coupled to a codon optimized puromycin resistance [2] by a P2A sequence. The monocistronic vector LeGO-G2-Puro+ expressing egfp and puromycin resistance coupled by a P2A sequence served as a control. Generation of viral particles. Cell-free viral supernatants were generated by transient transfection of 293T packaging cells as described [1], using the 3 rd generation packaging plasmids pmdlg/prre and prsv-rev [3] together with phcmv-vsv-g [4]. Supernatants containing pseudotyped vector particles were titrated on 293T target cells. Gene transfer rates were analysed 2 days after transduction by fluorescence activated cell scanning (FACS). Titres of 1 x10 7 (LeGO-iG2-Puro+-p53) and 2,5 x10 7 (LeGO-G2-Puro+) VSV-G pseudotyped vector particles per millilitre unconcentrated supernatants were obtained.

6 Cell culture and lentiviral gene transfer. All cells were cultured in their respective growth media supplemented with penicillin/streptomycin. For transduction of UKF-NB-3 r NUTLIN 10 target cells, 5x10 4 cells in 500µl medium were plated per well in a 24-well plate. The next day, 100µl and 250µl of viral supernatant per well were added and incubated for 3 days. Fluorescence Microscopy. Pictures were taken using an IX71 fluorescence microscope (Olympus, Hamburg, Germany). Fluorescence dye egfp was detected at 484/507nm (excitation/emission) Western Blot. Cells were lysed in Triton X sample buffer and separated by SDS-PAGE, as described before [5]. Proteins were detected using specific antibodies against β-actin (Sigma, Munich, Germany) or p53 (Alexis Biochemicals via AXXORA Deutschland, Lörrach, Germany), and were visualized by enhanced chemiluminescence using a commercially available kit (Amersham via GE Healthcare, Munich, Germany). Viability assay. Cell viability was tested by the 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) dye reduction assay after 96 h incubation, modified as described before [6]. References [1] Weber K, Bartsch U, Stocking C, Fehse B. A Multicolor Panel of Novel Lentiviral Gene Ontology (LeGO) Vectors for Functional Gene Analysis. Mol Ther 2008;16:

7 [2] Weber K, Mock U, Petrowitz B, Bartsch U, Fehse B. Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis. Gene Ther 2010;17(4): [3] Dull T, Zufferey R, Kelly M, et al. A third-generation lentivirus vector with a conditional packaging system. J Virol 1998;72: [4] Beyer WR, Westphal M, Ostertag W, von Laer D. Oncoretrovirus and lentivirus vectors pseudotyped with lymphocytic choriomeningitis virus glycoprotein: generation, concentration, and broad host range. J Virol 2002;76: [5] Michaelis M, Michaelis UR, Fleming I, Suhan T, Cinatl J, Blaheta RA, Hoffmann K, Kotchetkov R, Busse R, Nau H, Cinatl J Jr. Valproic acid inhibits angiogenesis in vitro and in vivo. Mol Pharmacol. 2004;65: [6] Michaelis M, Suhan T, Cinatl J, Driever PH, Cinatl J Jr. Valproic acid and interferonalpha synergistically inhibit neuroblastoma cell growth in vitro and in vivo. Int J Oncol 2004;25:

LoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr

LoxP. SFFV mcherry wpre SIN-LTR. shrna-p53. LoxP. shrna-scr LeGO-C-p53-shRNA SIN-LTR? RRE cppt H1/TO shrna-p53 SFFV mcherry wpre SIN-LTR LeGO-C-scr-shRNA SIN-LTR? RRE cppt H1/TO shrna-scr SFFV mcherry wpre SIN-LTR Supplementary Figure 3A: Scheme of the lentiviral

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Catalog No. Amount Lot Number 631986 10 μg Specified on product label. Product Information plvx-ef1α-mcherry-n1 is a lentiviral expression vector that can be used to generate high-titer

More information

Pre-made Reporter Lentivirus for p53 Signal Pathway

Pre-made Reporter Lentivirus for p53 Signal Pathway Pre-made Reporter for p53 Signal Pathway Cat# Product Name Amounts LVP977-P or: LVP977-P-PBS P53-GFP (Puro) LVP978-P or: LVP978-P-PBS P53-RFP (Puro) LVP979-P or: LVP979-P-PBS P53-Luc (Puro) LVP980-P or:

More information

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression

Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression Pre-made Lentiviral Particles for Nuclear Permeant CRE Recombinase Expression LVP336 LVP336-PBS LVP339 LVP339-PBS LVP297 LVP297-PBS LVP013 LVP013-PBS LVP338 LVP338-PBS LVP027 LVP027-PBS LVP337 LVP337-PBS

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631982

More information

G0752 pfiv3.2mcswtiresegfp

G0752 pfiv3.2mcswtiresegfp G0752 pfiv3.2mcswtiresegfp Plasmid Features Coordinates Feature 1-682 CMV/5 LTR Hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1653-1738 Multiple Cloning Sites 1739-2325 wtires 2326-3045

More information

Ectopic Gene Expression in Mammalian Cells

Ectopic Gene Expression in Mammalian Cells Ectopic Gene Expression in Mammalian Cells Dr. Stefan Stein AG Grez Methodenseminar BCII Praktikum am Georg-Speyer-Haus 11.01. & 01.02.2012 1 Ectopic Gene Expression in Mammalian Cells Definition: ectopic

More information

psmpuw-puro Lentiviral Expression Vector

psmpuw-puro Lentiviral Expression Vector Product Data Sheet psmpuw-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-212 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human

More information

psmpuw-u6-puro Lentiviral Expression Vector

psmpuw-u6-puro Lentiviral Expression Vector Product Data Sheet psmpuw-u6-puro Lentiviral Expression Vector CATALOG NUMBER: VPK-221 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on the human

More information

G0411 pfiv3.2mcsegfp. Plasmid Features

G0411 pfiv3.2mcsegfp. Plasmid Features G0411 pfiv3.2mcsegfp Plasmid Features Coordinates Feature CMV/5 LTR hybrid 1:682 Major Splice Donor 926:957 Partial gag 958:1468 Central Polypurine Tract 1494:1653 Multiple cloning sites 1653:1714 egfp

More information

Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies

Antibiotic Resistance: Ampicillin Bacterial Backbone: pbluescriptksii(+), Agilent Technologies G0656 pfiv3.2rsvmcs Coordinates Plasmid Features 1-682 CMV/5 LTR hybrid 958-1468 Partial Gag 1494-1653 Central Polypurine Tract 1695-2075 RSV Promoter 2104-2222 Multiple Cloning Sites 2244-2839 WPRE 2868-3009

More information

Manufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray

Manufacturing Viral Gene Therapy Vectors: General Approaches and Challenges John T. Gray Manufacturing Viral Gene Therapy s: 1 Dr. Vice President, Research & Development Audentes Therapeutics, Inc. San Francisco, USA Natural virus life cycle Late Early Viral Virally infected cell Naïve cell

More information

psmpuw-ires-blasticidin Lentiviral Expression Vector

psmpuw-ires-blasticidin Lentiviral Expression Vector Product Data Sheet psmpuw-ires-blasticidin Lentiviral Expression Vector CATALOG NUMBER: VPK-219 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector based on

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Lenti-X DD-ZsGreen1 Vector Set Table of Contents Product Information... 1 plvx-dd-zsgreen1 Reporter Vector... 3 plvx-dd-zsgreen1 Control Vector... 4 Additional Information... 5

More information

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells

OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna Clones guaranteed knockdown even in difficult-to-transfect cells OmicsLink shrna clone collections consist of lentiviral, and other mammalian expression vector based small hairpin RNA (shrna)

More information

Supplemental Methods Cell lines and culture

Supplemental Methods Cell lines and culture Supplemental Methods Cell lines and culture AGS, CL5, BT549, and SKBR were propagated in RPMI 64 medium (Mediatech Inc., Manassas, VA) supplemented with % fetal bovine serum (FBS, Atlanta Biologicals,

More information

psmpuw Universal Lentiviral Expression Vector (Promoterless)

psmpuw Universal Lentiviral Expression Vector (Promoterless) Product Data Sheet psmpuw Universal Lentiviral Expression Vector (Promoterless) CATALOG NUMBER: VPK-211 STORAGE: -20ºC QUANTITY AND CONCENTRATION: 10 µg at 0.25 µg/µl in TE Background Lentivirus vector

More information

VECTOR SAFETY INFORMATION. AAV Vectors: Material Information

VECTOR SAFETY INFORMATION. AAV Vectors: Material Information VECTOR SAFETY INFORMATION AAV Vectors: Material Information AAV vectors contain recombinant transgene sequences (e.g. encoding reporter or therapeutic genes) flanked by the AAV inverted terminal repeats

More information

UTR Reporter Vectors and Viruses

UTR Reporter Vectors and Viruses UTR Reporter Vectors and Viruses 3 UTR, 5 UTR, Promoter Reporter (Version 1) Applied Biological Materials Inc. #1-3671 Viking Way Richmond, BC V6V 2J5 Canada Notice to Purchaser All abm products are for

More information

Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina)

Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina) Pre-made Lentiviral Expression Particles for Luciferase (firefly, Gaussia, Renilla and Cypridina) Cat# Product Name Amounts LVP326 LVP326-PBS LVP325 LVP325-PBS LVP283 LVP283-PBS LVP323 LVP323-PBS LVP020

More information

ViraBind Lentivirus Concentration and Purification Kit

ViraBind Lentivirus Concentration and Purification Kit Product Manual ViraBind Lentivirus Concentration and Purification Kit Catalog Number VPK-091 VPK-091-5 5 preps 25 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus

More information

ViraBind Lentivirus Concentration and Purification Kit

ViraBind Lentivirus Concentration and Purification Kit Product Manual ViraBind Lentivirus Concentration and Purification Kit Catalog Number VPK-090 2 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based on

More information

Mag4C-Lv Kit - Results

Mag4C-Lv Kit - Results Mag4C-Lv Kit - Results Mag4C-Lv Kit Magnetic capture for viral concentration & storage buffer for superior viral preservation OZ Biosciences is delighted to announce the launching of a new product Mag4C-Lv

More information

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression

Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Pre-made Lentiviral Particles for nuclear permeant CRE recombinase expression Cat# Product Name Amounts* LVP336 NLS-CRE (Bsd) LVP336-PBS NLS-CRE (Bsd), in vivo ready LVP339 NLS-CRE (Puro) LVP339-PBS NLS-CRE

More information

Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus

Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

MISSION shrna Library: Next Generation RNA Interference

MISSION shrna Library: Next Generation RNA Interference Page 1 of 6 Page 1 of 6 Return to Web Version MISSION shrna Library: Next Generation RNA Interference By: Stephanie Uder, Henry George, Betsy Boedeker, LSI Volume 6 Article 2 Introduction The technology

More information

Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and

Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and hybrid microcarriers Alexander S. Timin a, Albert R. Muslimov b, Kirill V. Lepik b, Olga S. Epifanovskaya b, Alena

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1

Nature Biotechnology: doi: /nbt Supplementary Figure 1 Supplementary Figure 1 Generation of the AARE-Gene system construct. (a) Position and sequence alignment of AAREs extracted from human Trb3, Chop or Atf3 promoters. AARE core sequences are boxed in grey.

More information

CellPlayer CytoLight Green (Lenti, CMV, no selection)

CellPlayer CytoLight Green (Lenti, CMV, no selection) CellPlayer CytoLight Green (Lenti, CMV, no selection) Essen BioScience Catalog Number: 4513 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells

More information

Supplementary

Supplementary Supplementary information Supplementary Material and Methods Plasmid construction The transposable element vectors for inducible expression of RFP-FUS wt and EGFP-FUS R521C and EGFP-FUS P525L were derived

More information

Lenti-Pac HIV Expression Packaging Kit User Manual

Lenti-Pac HIV Expression Packaging Kit User Manual G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40

More information

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the

Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Reintroduction of HDAC1 in HDAC1-/- ES cells reverts the phenotype of HDAC1-/- teratomas. 3x10 6 HDAC1 reintroduced (HDAC1-/-re) and empty vector infected

More information

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of

Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LEGEND FOR SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Cell proliferative ability and (B) the invasiveness of LLC-1, LLC-3, and LLC-5 cell line series were quantified by BrdU assay after 72 h of

More information

IncuCyte CytoLight Green (Lenti, EF-1 alpha, puro)

IncuCyte CytoLight Green (Lenti, EF-1 alpha, puro) IncuCyte CytoLight Green (Lenti, EF-1 alpha, puro) Essen BioScience Catalog Number: 4481 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells

More information

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,

RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe, Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5

More information

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of

Fig. S1 TGF RI inhibitor SB effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of Fig. S1 TGF RI inhibitor SB525334 effectively blocks phosphorylation of Smad2 induced by TGF. FET cells were treated with TGF in the presence of different concentrations of SB525334. Cells were lysed and

More information

CellPlayer NucLight Red (Lenti, EF-1 alpha, puro)

CellPlayer NucLight Red (Lenti, EF-1 alpha, puro) Essen BioScience Catalog Number: 4476 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells for gene therapy and/or research purposes. The Essen

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Reverse transcribed Quantitative PCR. Total RNA was isolated from bone marrow derived macrophages using RNeasy Mini Kit (Qiagen), DNase-treated (Promega RQ1), and reverse transcribed

More information

Your Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs

Your Gene GGT ATG. 5' UTR_CMV P_CMV_IE1_Hs. P_PGK-Mm pd2119-cmv CMV-ORF, Lenti-ElecD 8313 bp. E_CMV_IE1_Hs Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral

More information

(a) Immunoblotting to show the migration position of Flag-tagged MAVS

(a) Immunoblotting to show the migration position of Flag-tagged MAVS Supplementary Figure 1 Characterization of six MAVS isoforms. (a) Immunoblotting to show the migration position of Flag-tagged MAVS isoforms. HEK293T Mavs -/- cells were transfected with constructs expressing

More information

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement

SUPPLEMENTAL MATERIAL. Supplemental Methods. Cumate solution was from System Biosciences. Human complement C1q and complement SUPPLEMENTAL MATERIAL Supplemental Methods Reagents Cumate solution was from System Biosciences. Human complement Cq and complement C-esterase inhibitor (C-INH) were from Calbiochem. C-INH (Berinert) for

More information

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles

Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Thermo Scientific Dharmacon SMARTvector 2.0 Lentiviral shrna Particles Long-term gene silencing shrna-specific design algorithm High titer, purified particles Thermo Scientific Dharmacon SMARTvector shrna

More information

Vivid Colors plenti6.3/v5-gw/emgfp Expression Control Vector

Vivid Colors plenti6.3/v5-gw/emgfp Expression Control Vector user guide Vivid Colors plenti6.3/v5-gw/emgfp Expression Control Vector Lentiviral expression plasmid containing EmGFP for optimization of lentivirus production, titer, and transduction using the ViraPower

More information

VHL inhibition as protective during states of mitochondrial dysfunction. Isha H. Jain et al. Science 2016;352:54-61

VHL inhibition as protective during states of mitochondrial dysfunction. Isha H. Jain et al. Science 2016;352:54-61 VHL inhibition as protective during states of mitochondrial dysfunction Isha H. Jain et al. Science 2016;352:54-61 La fosforilazione ossidativa nel mitocondrio Tymoczko et al., PRINCIPI DI BIOCHIMICA,

More information

RGB marking with lentiviral vectors for multicolor clonal cell tracking

RGB marking with lentiviral vectors for multicolor clonal cell tracking RGB marking with lentiviral vectors for multicolor clonal cell tracking Kristoffer Weber 1, Michael Thomaschewski 1, Daniel Benten 2 & Boris Fehse 1 1 Research Department Cell and Gene Therapy, Clinic

More information

ViraBind PLUS Lentivirus Concentration and Purification Kit

ViraBind PLUS Lentivirus Concentration and Purification Kit Product Manual ViraBind PLUS Lentivirus Concentration and Purification Kit Catalog Number VPK-095 2 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based

More information

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo

Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Gaussia Luciferase-a Novel Bioluminescent Reporter for Tracking Stem Cells Survival, Proliferation and Differentiation in Vivo Rampyari Raja Walia and Bakhos A. Tannous 1 2 1 Pluristem Innovations, 1453

More information

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells

Mutagenesis and generation of expression vectors Gene expression profiling Lentiviral production and infection of TF1 cells Mutagenesis and generation of expression vectors Human c-kit wild-type cdna encoding the short c-kit isoform was excised from vector pbshkitwt (kind gift from Dr. L Gros, France) by Sal I-Acc65 I digestion.

More information

SUPPLEMENTAL FIGURES AND TABLES

SUPPLEMENTAL FIGURES AND TABLES SUPPLEMENTAL FIGURES AND TABLES A B Flag-ALDH1A1 IP: α-ac HEK293T WT 91R 128R 252Q 367R 41/ 419R 435R 495R 412R C Flag-ALDH1A1 NAM IP: HEK293T + + - + D NAM - + + E Relative ALDH1A1 activity 1..8.6.4.2

More information

Your Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp

Your Gene GGT ATG. pd2109-efs EF1a-ORF, Lenti-ElecD 8337 bp Mammalian Expression Vectors has mammalian expression vectors suitable for transient or stable expression. These vectors are available with features including various promoters, markers, and fusions. Lentiviral

More information

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION

SUPPLEMENTAL MATERIALS SIRTUIN 1 PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF2 ACTIVATION SUPPLEMENTAL MATERIALS SIRTUIN PROMOTES HYPEROXIA-INDUCED LUNG EPITHELIAL DEATH INDEPENDENT OF NRF ACTIVATION Haranatha R. Potteti*, Subbiah Rajasekaran*, Senthilkumar B. Rajamohan*, Chandramohan R. Tamatam,

More information

TECHNICAL BULLETIN. MISSION shrna Control Transduction Particles

TECHNICAL BULLETIN. MISSION shrna Control Transduction Particles MISSION Transduction Particles Catalog Numbers SHC001V, SHC002V, SHC003V, SHC004V, SHC005V, SHC007V, SHC008V, SHC009V, SHC010V, SHC011V, SHC012V, SHC013V, SHC014V, SHC015V, SHC016V, SHC201V, SHC202V, SHC203V,

More information

ViraPower HiPerform Lentiviral Expression Systems

ViraPower HiPerform Lentiviral Expression Systems ViraPower HiPerform Lentiviral Expression Systems Lentiviral systems for high-level expression in dividing and non-dividing mammalian cells Cat. nos. K5310-00, K5320-00, K5330-00 and K5340-00 Rev. date:

More information

shrna expression Cloning Kit

shrna expression Cloning Kit shrna expression Cloning Kit User Manual for making lentiviral and non-lentiviral shrna expression clones Cat# Product Name Amount Application LTSH-GB LTSH-GP LTSH-RB LTSH-RP SH-GB peco-lenti-h1-shrna-

More information

Specific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors

Specific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors Nature Methods Specific gene transfer to neurons, endothelial cells and hematopoietic progenitors with lentiviral vectors Brigitte Anliker, Tobias Abel, Sabrina Kneissl, Juraj Hlavaty, Antonio Caputi,

More information

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining.

Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Supplementary materials and methods Flow cytometric determination of apoptosis by annexin V/propidium iodide double staining. Cells were analyzed for phosphatidylserine exposure by an annexin-v FITC/propidium

More information

Vivapure Virus Purification and Concentration Kits

Vivapure Virus Purification and Concentration Kits Vivapure Virus Purification and Concentration Kits Fisher Scientific Fast and easy to use kits for virus purification Recombinant virus vectors are the preferred method for a wide range of gene delivery

More information

Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications

Premade Lentiviral Particles for ips Stem Factors: Single vector system. For generation of induced pluripotent stem (ips) cells and other applications Premade Lentiviral Particles for ips Stem Factors: Single vector system For generation of induced pluripotent stem (ips) cells and other applications RESEARCH USE ONLY, not for diagnostics or therapeutics

More information

Supporting Information

Supporting Information Supporting Information Nan et al. 10.1073/pnas.1509123112 SI Materials and Methods Plasmids. PAmCherry1-KRas wild type and G12D mutants were generated by subcloning the respective KRas cdna fragments into

More information

Nature Protocols: doi: /nprot Supplementary Figure 1. Shear stress determination in microvascular networks.

Nature Protocols: doi: /nprot Supplementary Figure 1. Shear stress determination in microvascular networks. Supplementary Figure 1 Shear stress determination in microvascular networks. A pressure drop of ~4 mmh2o is applied across the vascular network using a suspension of 2 micron red polystyrene spheres in

More information

ViraBind Lentivirus Purification Kit

ViraBind Lentivirus Purification Kit Product Manual ViraBind Lentivirus Purification Kit Catalog Number VPK-104 10 preps FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vectors based on the human immunodeficiency

More information

ViraSafe Universal Lentiviral Expression System, Pantropic

ViraSafe Universal Lentiviral Expression System, Pantropic roduct Manual ViraSafe Universal Lentiviral Expression System, antropic Catalog Number VK-211-AN 1 kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Lentivirus vector based on

More information

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid

HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured

More information

MISSION shrna Plasmid DNA Control Vectors

MISSION shrna Plasmid DNA Control Vectors MISSION Plasmid DNA Vectors Catalog Numbers SHC001, SHC002, SHC003, SHC004, SHC005, SHC007, SHC008, SHC009, SHC010, SHC011, SHC012, SHC013, SHC014, SHC015, SHC016, SHC201, SHC202, SHC203, SHC204, SHC216,

More information

Amplification of Cre- expressing Adenovirus in 293T cells Jointly prepared by Lauren, Kazu, and Bingnan July 2011

Amplification of Cre- expressing Adenovirus in 293T cells Jointly prepared by Lauren, Kazu, and Bingnan July 2011 Amplification of Cre- expressing Adenovirus in 9T cells Jointly prepared by Lauren, Kazu, and Bingnan July Background on AdenoCre IRE EGFP system (Vector Biolabs, Ad- Cre- IRE- GFP, cat# 7), titer is x

More information

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS.

LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Supplemental Data: LINGO-1, A TRANSMEMBRANE SIGNALING PROTEIN, INHIBITS OLIGODENDROCYTE DIFFERENTIATION AND MYELINATION THROUGH INTERCELLULAR SELF- INTERACTIONS. Scott Jepson, Bryan Vought, Christian H.

More information

sherwood - UltramiR shrna Collections

sherwood - UltramiR shrna Collections sherwood - UltramiR shrna Collections Incorporating advances in shrna design and processing for superior potency and specificity sherwood - UltramiR shrna Collections Enabling Discovery Across the Genome

More information

Premade Lentiviral Particles for human ips Stem Factors

Premade Lentiviral Particles for human ips Stem Factors Premade Lentiviral Particles for human ips Stem Factors For generating induced pluripotent stem (ips) cells or other applications RESEARCH USE ONLY, not for diagnostics or therapeutics Cat# Product Name

More information

Certificate of Analysis

Certificate of Analysis Certificate of Analysis Table of Contents Product Information... 1 Description... 2 Location of Features... 3 Additional Information... 3 Quality Control Data... 4 Catalog No. Amount Lot Number 631971

More information

Cloning of shrna Templates into shrna Expression Vectors. User Manual

Cloning of shrna Templates into shrna Expression Vectors. User Manual Cloning of shrna Templates into shrna Expression Vectors v3a, 8-29-2013 Table of Contents Page A. Background 2 B. Required Materials 2 C. Cloning of shrna Template Oligonucleotides into shrna Expression

More information

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease

Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Simple protocol for gene editing using GenCrisprTM Cas9 nuclease Contents Protocol Step 1: Choose the target DNA sequence Step 2: Design sgrna Step 3: Preparation for sgrna 3.1 In vitro transcription of

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/8/347/347ra94/d Supplementary Materials for n mirn-mediated therapy for S6 blocks IRES-driven translation of the N second cistron Yu Miyazaki, Xiaofei

More information

ViraSafe mirna Lentiviral Expression System, Ecotropic

ViraSafe mirna Lentiviral Expression System, Ecotropic Product Manual ViraSafe mirna Lentiviral Expression System, Ecotropic Catalog Number VPK-220-ECO 1 kit FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18

More information

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG

Gene Forward Primer Reverse Primer GAPDH ATCATCCCTGCCTCTACTGG GTCAGGTCCACCACTGACAC SSB1 AACTTCAGTGAGCCAAACCC GTTCTCAGAGGCTGGAGAGG Supplemental Data EXPERIMENTAL PROCEDURES Plasmids and Antibodies- Full length cdna of INT11 or INT12 were cloned into ps- Flag-SBP vector respectively. Anti-RNA pol II (RPB1) was purchased from Santa

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

(Toll Free) (outside US) Page 1

(Toll Free) (outside US) Page 1 888-266-5066 (Toll Free) 650-968-2200 (outside US) Page 1 System Biosciences (SBI) Contents User Manual I. Introduction and Background... 3 II. Available CytoTracers... 5 III. Protocol... 5 A. Transfection

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION 6 Relative levels of ma3 RNA 5 4 3 2 1 LN MG SG PG Spl Thy ma3 ß actin Lymph node Mammary gland Prostate gland Salivary gland Spleen Thymus MMTV target tissues Fig. S1: MMTV target tissues express ma3.

More information

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

SUPPLEMENTAL EXPERIMENTAL PROCEDURES SUPPLEMENTAL EXPERIMENTAL PROCEDURES Luciferase Assays Cells were seeded on 24well plates and grown to 7% confluency. Cells were then transfected with ng of reporter constructs and 1 ng of the renilla

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods sirna sequences used in this study The sequences of Stealth Select RNAi for ALK and FLOT-1 were as follows: ALK sense no.1 (ALK): 5 -AAUACUGACAGCCACAGGCAAUGUC-3 ; ALK

More information

p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1

p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Supplementary Information p53 increases MHC class I expression by upregulating the endoplasmic reticulum aminopeptidase ERAP1 Bei Wang 1, Dandan Niu 1, Liyun Lai 1, & Ee Chee Ren 1,2 1 Singapore Immunology

More information

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration

CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration /, Supplementary Advance Publications Materials 2016 CD93 and dystroglycan cooperation in human endothelial cell adhesion and migration Supplementary Materials Supplementary Figure S1: In ECs CD93 silencing

More information

GC GC - AAV2/8-4E10

GC GC - AAV2/8-4E10 SUPPLEMENTARY INFORMATION doi:.38/nature660 a Luciferase Expression (Photons/Sec) c f 12 11 11 GC - AAV2/8-Luciferase 9 GC - AAV2/8-Luciferase 0 8 16 24 32 40 48 56 64 Weeks Post-AAV Injection Human IgG

More information

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences). Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

More information

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling

Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary

More information

shrna experiment design

shrna experiment design 97-06-20 shrna experiment design 鄭金松 Core Manager Comparison of sirna and shrna Structure sirna (19-27 nts) shrna (19-27 nts) Advantage vs. disadvantage cost delivery efficiency duration of knockdown renewability

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5

NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 doi:10.1038/nature09489 Supplementary Figure 1. Methylation pattern of wild type and mutant WNV NS5 MTases. Recombinant wild type and mutant E218A MTase domain of WNV NS5 (N-terminal 300 amino acids) were

More information

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

SparQ Cumate Switch Cat. # QMXXX Series

SparQ Cumate Switch Cat. # QMXXX Series SparQ Cumate Switch Cat. # QMXXX Series User Manual (ver. 1-090810) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in the Licensing

More information

ZMP Lentiviral shrna-mir Catalog numbers: TLHS1000, TLHK1000, TLMS1001, TLMK1001, TSE0001, TSE0003,TSE0011

ZMP Lentiviral shrna-mir Catalog numbers: TLHS1000, TLHK1000, TLMS1001, TLMK1001, TSE0001, TSE0003,TSE0011 ZMP Lentiviral shrna-mir Catalog numbers: TLHS1000, TLHK1000, TLMS1001, TLMK1001, TSE0001, TSE0003,TSE0011 This manual provides information for the propagation, transfection, transduction and viral packaging

More information

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to

cells (MLEC) that produce luciferase under the control of the PAI-1 promoter in response to Supplemental Materials and Methods TGF bioassay. To quantify the levels of active and total TGF, we used mink lung epithelial cells (MLEC) that produce luciferase under the control of the PAI-1 promoter

More information

In vitro research method for screening inhibitors of protein translation

In vitro research method for screening inhibitors of protein translation WHITE PAPER 1-Step Human Coupled IVT Kit In vitro research method for screening inhibitors of protein translation Use of mammalian in vitro translation (cell-free) systems for high-throughput screening

More information

TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA 15260

TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA 15260 AD Award Number: W81XWH-07-1-0147 TITLE: Role of Hsp90 in Androgen-Refractory Prostate Cancer PRINCIPAL INVESTIGATOR: Zhou Wang, Ph.D. CONTRACTING ORGANIZATION: University of Pittsburgh Pittsburgh, PA

More information

Quality Control Assays

Quality Control Assays QUALITY CONTROL An integral part of the Penn Vector Core is its robust quality control program which is carried out by a separate quality control group. Quality control assays have been developed and optimized

More information

VECTOR SYSTEMS. Vector Systems

VECTOR SYSTEMS. Vector Systems VECTOR SYSTEMS Vector Systems The vector systems currently available through Penn Vector Core are those derived from adenoassociated virus (AAV), adenovirus and lentivirus. The Core offers AAV-based vectors

More information

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan).

Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). 1 2 3 4 5 6 7 8 Supplemental Materials and Methods Cell proliferation assay Cell proliferation was measured with Cell Counting Kit-8 (Dojindo Laboratories, Kumamoto, Japan). GCs were plated at 96-well

More information

Pro-DeliverIN TM - Protein Delivery Reagent Results

Pro-DeliverIN TM - Protein Delivery Reagent Results Pro-DeliverIN TM - Protein Delivery Reagent Results OZ Biosciences is delighted to announce the launching of the innovative Pro-DeliverIN - Protein Delivery Reagent. Pro-DeliverIN is a lipid based formulation

More information