Schizophrenia: Dopamine Dl Receptor Sequence Is Normal, But Has DNA Polymorphisms

Size: px

Start display at page:

Download "Schizophrenia: Dopamine Dl Receptor Sequence Is Normal, But Has DNA Polymorphisms"

Carmella Lyons
6 years ago
Views:

1 NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO Schizophrenia: Dopamine Dl Receptor Sequence Is Normal, But Has DNA Polymorphisms Koichi Ohara, M.D., Ph.D., Carla Ulpian, M.Sc., Philip Seeman, M.D., Ph.D., Roger K. Sunahara, B.Sc., Hubert H. M. Van Tol, Ph.D., and Hyman B. Niznik, Ph.D. Genes that regulate dopamine (DA) receptors may underlie the overactive DA system in schizophrenia. Since it is known that there is an abnormally reduced or Ibsent regulation of the DA D2 receptor by the DA Dl m:eptor in the postmortem schizophrenia brain, the human DA Dl receptor gene was sequenced from genomic deoxyribonucleic acid (DNA) of seven schizophrenic individuals. The tissues from two schizophrenics had previously been found to have a reduced link between DA Dl and D2 receptors. The DJ receptor genes were amplified by the polymerase chain reaction, subcloned, and sequenced. Although three DNA polymorph isms were found, the deduced amino acid sequence of the DA Dl receptor was normal in these tissues. fneuropsychopharmacology 8: , 1993] KEY WORDS: Schizophrenia; Dopamine DJ receptor; Polymorphism; Polymerase chain reaction Patients with schizophrenia may suffer from an overactive dopamine (OA) system in the brain (Wyatt et al. 1989), based on the observations that antipsychotic and neuroleptic medications block brain OA 02 receptors in direct relation to their clinical potencies (Seeman et ai. 1976) and that brain D2 receptors may be more numerous in schizophrenia (Seeman et ai. 1987; Wong et al. 1986, but for a more extensive analysis and discussion, see Farde et ai and Seeman et al. 1990, 1992). The activity of the D2 receptor is normally moderated by its link to the D1 receptor (Seeman et al. 1989). This D1-D2Iink, although present in control brain tissues and in Parkinson's-diseased or Alzheimer-diseased brain tissues, is missing or reduced in schizophrenia brain tissue (Seeman et al. 1989). In addition, Memo et al. (1983) found D1-stimulated adenylate cyclase to be elevated in schizophrenia brain tissue. These fmdings justify a search for a possible abnormality in the gene for the human DA D1 receptor in schizophrenia. The recent cloning of this gene (Sunahara et al. 1990; Dearry et al. 1990; hou et al. 1990) permitted us to examine the D1 receptor sequence in schizophrenia. We report here that the amino acid sequence of the D1 receptor in schizophrenia was normal in seven subjects, but there were three apparent polymorphisms in the deoxyribonucleic acid (DNA) sequence. From the Departments of Pharmacology (KO, CU, PS, RKS, HHMVT), and Psychiatry, Clarke Institute of Psychiatry, Molecular Neurobiology Section (HBN, HHMVT), University of Toronto, Toronto, Ontario. Address reprint requests to: Philip Seeman, M.D., Ph.D., Department of Pharmacology, Medical Sciences Building, Universitv of Toronto, Toronto, Ontario, Canada M5S 1A8. Received November 12, 1991; revised March 26, 1992; accepted March 31, Tissues MATERIALS AND METHODS Post mortem brain samples were obtained at autopsy from five patients who had schizophrenia, and from one control individual, as previously described (See- C 1993 American College of Neuropsychopharmacology Published by Elsevier Science Publishing Co., Inc. 655 Avenue of the Americas, New York, NY X/93/$6.00

132 K. Ohara et al. NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO.2 man et al. 1987). The tissues were obtained through the Canadian Brain Tissue Bank (Toronto) and the Lainz Hospital (Vienna).

2 132 K. Ohara et al. NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO.2 man et al. 1987). The tissues were obtained through the Canadian Brain Tissue Bank (Toronto) and the Lainz Hospital (Vienna). Tissues from schizophrenia Patients T751 and T708 had previously been found to have a reduced link between 01 and 02 receptors, being absent in T751 and reduced by 60% in T708 (Seeman et al. 1989). An additional two blood samples were obtained from two schizophrenic outpatients. The diagnosis of schizophrenia met the criteria of International ClassifIcation of Disease version 9 (World Health Organization 1979) for tissues from Vienna or DSM-III-R (American Psychiatric Association 1987) for cases from Toronto. Table 1. Tissues Used for Genomic DNA Case No. Sex Age Tissue Criteria V F 77 Striatum ICD-9" V F 80 Striatum ICD-9 V F 56 Striatum ICD-9 T751 F 85 Striatum DSM-III Rb T708 F 82 Striatum DSM-III-R TB1 M 37 Blood DSM-llI-R TB2 M 31 Blood DSM-llI-R T813 M 81 Striatum Control a International ClassifIcation of Diseases, Version 9. b Diagnostic and Statistical Manual, 3rd ed, Revised. Genomic DNA Preparation Genomic DNA was extracted from each tissue or blood sample (Ausubel et al. 1988). The brain tissues (weighing 100 mg) were homogenized in 1.2 ml of 10 mmol/l Tris-HCl (ph 8) containing 0.1 mg/ml proteinase K, 100 mmol/l NaCl, 25 mmol/l ethylenediaminetetraacetic acid (EDTA) and 0.5% sodium dodecylsulfate (50S), followed by overnight incubation at 50 C. Proteins were removed using phenol and chloroform extraction. The genomic DNA was precipitated with ethanol and resuspended in 10 mmol/l Tris-EDT A buffer (ph 8) and stored at 4 C. Genomic DNA from the blood samples was extracted by the method of Miller et al. (1988). Briefly, 10 ml of blood was mixed with 10 mmolll Tris-HCl (ph 7.6) in 320 mmolll sucrose, 1% Triton X-lOO, 5 mmol/l MgCh to a fmal volume of 40 ml. After centrifugation at 3000 x g for 10 minutes at 4 C, the remaining leukocytes were digested overnight with proteinase K (125 Ilg/ml) in 3 ml of nucleus-lysing buffer (400 mmolll NaCl, 2 mmolll EDTA, 0.5% 505, 10 mmol/l Tris-HCl, ph 8.2) at 37 C. Proteins were precipitated with 1 ml of 6 molll NaCl. The DNA was precipitated with ethanol, dried, and dissolved in 500 III of 20 mmolll Tris EDTA buffer (ph 8) and stored at 4 C. DNA Amplification by the Polymerase Chain Reaction Genomic DNA was amplified in vitro by the polymerase chain reaction (PCR) using Taq polymerase (Cetus, Norwalk, CT) with oligonucleotide primers 758 and 757 (Biotechnology Service Centre, Hospital for Sick Children Research Institute, Toronto). Primer 758 was 5'-tac ggatccaagcaatctggctgtgcaaagtgctgc CTGGT-3', where the first 9 nucleotide bases (in lower case) encode a BamHI site, and where the other nucleotides correspond to bases at positions -123 to -92 in the human DA 01 receptor sequence (Fig. 2). Primer 757 was 5'-tacggatccCTCACCGT ACCTT AGTTTCTI AATAGCAAA-3', where the bases in lower case cor respond to the BamHI site, and the other bases are com plementary to the DNA coding sequence of bases 1403 to 1432 in the 01 sequence (Fig. 2). The PCR was carried out by the method of Saiki et al. (1988) in tubes containing 200 ng genomic DNA, 11-1g of each primer, 200 Ilmol each of adenosine 5'-triphosphate, cytidine 5'-triphosphate, guanosine 5'-triphosphate, and thymi dine 5'-triphosphate, and 2.5 U of Taq polymerase in a final total volume of 100 III GeneAmp buffer (Perkin Elmer Cetus Instruments, Norwalk, CT). The conditions for the PCR were as follows: denaturing time of 1.5 minutes at 94 C; annealing time of 3 minutes at 60 C, and elongation time of 4 minutes at 72 C, using a DNA Thermal Cycler (Perkin-Elmer Cetus Instru Unused oligo's E CI I:: - c. Q!'oil.- - Col VJ v -< Q CI r,i) E N VJ - 1.S k. - lkb Figure 1. Agarose gel electrophoresis of amplified products. Thirty III of amplified DNA were run in 1% agarose gel and visualized by ethidium bromide (lllg/ml). Lane 1 shows size markers. Lanes 2 and 3 show PCR-amplifIed genomic DNA from control and schizophrenia individuals, respectively. The arrow indicates the 1.5 kb fragment that contains the entire DA D1 receptor gene.

3 NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO.2 01 Receptors in Schizophrenia 133 ments}. Following 30 cycles, the samples were given an additional elongation period of 7 minutes at 72 e. An aliquot was removed and analyzed by gel electrophoresis in 1% low-melt agarose containing ethidium bromide. Subcloning and Sequencing The per products were extracted in phenol and chloroform, precipitated with ethanol and digested with BamHI. The cloning vector plasmid psp73 (Promega) was digested with BamHI for 40 minutes followed by 30- minute incubation period with alkaline phosphatase. The per product and plasmid psp73 were extracted from the 0.8% low-melt agarose gel following electrophoresis, mixed in the same tube in the presence of T4 DNA ligase, and incubated overnight at room temperature. Transformation was done under standard conditions using AG1 cells (Stratagene) as the host. The DA D1 gene was screened by digestion of the plasmid DNA (extracted from the colony) with BamHI, generating a fragment of approximately 1.5 kb. The nucleotide sequence of the cloned fragment was obtained by the dideoxy chain termination method (Sanger et al. 1987), using Sequenase V.2 (USB, Cleveland, OH). RESULTS The size of the D1 receptor gene fragment from control and schizophrenia samples were the same (Fig. 1). Dideoxy sequencing confirmed the fragments encoding the D1 receptor in both control and schizophrenia tissues. There were three DNA polymorphisms (see Fig. 2). I} The nucleotide at position -48 was an A in our earlier work on one human individual (Sunahara et a ), as well as in one sample by Dearry et a1. (1990) and in another by hou et a1. (1990). In patient T708, however, this nucleotide was a G. A total, therefore, of 10 humans had an A, and only one revealed a G. 2} Nucleotide 90 in all cases (except V433-88) revealed an A to G change. This did not, however, alter the coded amino acid, leucine. Other groups (Dearry et al. 1990; hou et a ) also found a G. Thus, a total of nine humans have revealed a G with two exhibiting an A. 3} Nucleotide 222 in all individuals had an A to C change, but this did not affect the coding of the amino acid, alanine. DISCUSSION The results indicate that the amino acid sequence of the DA D1 receptor from seven schizophrenic individuals was normal, but that there were three apparent polymorphisms in the DNA sequence. Concerning the DNA polymorph isms, it should be noted that the Taq polymerase used in these experiments has an error rate or base misincorporation rate of about 0.1%. Thus, it is possible that the apparent DNA polymorphisms may arise as a PCR-generated artifact. Although various types of PCR procedures may rule out such artifacts, at least two of the three polymorphisms were identical in more than one subject. Tissues from schizophrenia Patients T751 and T708 had previously been found (Seeman et al. 1989) to have a reduced link between D1 and 02 (absent link in T751, and 60% reduction of the link in T708). These schizophrenia patients, however, revealed ONA sequences identical to control individuals. Since the number of different samples tested here was small, the results do not rule out the existence of an abnormal amino acid sequence in the 01 dopamine receptor of different patients in a more extensive series of schizophrenia patients. For example, it may be estimated statistically that studying only seven subjects is insufficient to rule out a relevant receptor mutation in many (perhaps one-third) of schizophrenic patients. A more rapid method for screening possible mutations in a larger series of tissues is to use PCR and denaturing gradient gel electrophoresis (Sung et a ; Catalano et a ). Furthermore, the absence of any changes in the 01 receptor protein in these seven schizophrenia cases does not preclude possible 01 receptor abnormalities in schizophrenia, since there may be abnormalities in posttranslational processing of these receptors (phosphorylation and glycosylation, for example). ACKNOWLEDGMENTS Koichi Ohara is on leave from the Department of Psychiatry and Neurology, Hamamatsu University School of Medicine, Japan. We thank Dr. Mary V. Seeman (Psychiatry Department, Mount Sinai Hospital, Toronto) for obtaining consent, blood samples, and clinical histories from two schizophrenic patients in her Toronto Schizophrenia Registry. We thank Dr. T. P. Morley and Maria Pataki of the Canadian Brain Tissue Bank (supported by the Medical Research Council of Canada and the Ontario Mental Health Foundation, located at the Banting Institute and the Clarke Institute of Psychiatry, University of Toronto, Toronto) for providing three postmortem brain tissues, and Dr. K. Jellinger (Lainz Hospital, Vienna) for providing an additional three postmortem tissues. We thank Dr. Katherine Siminovitch (Research Institute, Mount Sinai Hospital, Toronto) for preparing the DNA from blood samples. This investigation was supported, in part, by the Medical Research Council of Canada (Grants MA 2951, PG 11121, and Studentship to Roger K. Sunahara), by the Ontario Mental Health Foundation (grant 938 and a Senior Research Fellowship to Philip Seeman); by the Ontario Ministry of Health (Career Scientist Awards to Hyman B. Niznik

4 134 K. Ohara et al. NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO.2 (5' end) T T C A G G G G C -2b_ -264 T T TC TGGT GCCC T T GACAG TGAC C T GC AGCAAGGGAG TCAGAAGA CAGA TGTAGAAA TCAAGAGTGACCA TCCACGGGAT TGAC TTGGA T TGCC AC TC AAGC GG TCC TC TC A TGGAA TGT TGGTGAGGCC C TC TG PRIMER C C AG GGAA GC AA T C T GGC T G TGC AA AG TGC T GC C T GG TGGGGAGG -85 G(-48) -84 ACT C C T G G A A A T C T G ACT G A C C C C TAT T C C C T G C T TG G A ACT T G AGGGGTGTCAGAGCCCCTGATGTGCTTTCTCTTAGGAAG ATG AGG 6 Met Arg 7 ACTCTGAACACCTCTGCCATGGACGGGACTGGGCTGGTG GTG GAG 51 Thr Leu Asn Thr Ser Ala Met Asp Gly Thr Gly Leu Val Val Glu G AGG GAC TTC TCT GTT CGT ATC CTC ACT GCC TGT TTC CT TCG CTG 96 Arg Asp Phe Ser Val Arg lie Leu Thr Ala Cys Phe Leu Ser Leu 97 CTC ATC CTG TCC ACG CTC CTG GGG AAC ACG CTG GTC TGT GCT GCC 141 Leu lie Leu Ser Thr Leu Leu Gly Asn Thr Leu Val Cys Ala Ala 142 GTT ATC AGG TTC CGA CAC CTG CGG TCC AAG GTG ACC AAC TTC TTT 186 Val lie Arg Phe Arg His Leu Arg Ser Lys Val Thr Asn Phe Phe C(222) 187 GTC ATC TCC TTG GCT GTG TCA GAT CTC TTG GTG G GTC CTG GTC 231 Val lie Ser Leu Ala Val Ser Asp Leu Leu Val Ala Val Leu Val 232 ATG CCC TGG AAG GCA GTG GCT GAG ATT GCT GGC TTC TGG CCC TTT 276 Met Pro Trp LYII Ala Val Ala Glu lie Ala Gly Phe Trp Pro Phe 277 GGG TCC TTC TGT AAC ATC TGG GTG GCC TTT GAC ATC ATG TGC TCC 321 Gly Ser Phe CYII Asn lie Trp Val Ala Phe Asp lie Met CYS Ser 322 ACT GCA TCC ATC CTC AAC CTC TGT GTG ATC AGC GTG GAC AGG TAT 366 Thr Ala Ser lie Leu Alln Leu Cys Val lie Ser Val Asp Arg Tyr 367 TGG GCT ATC TCC AGC CCT TTC CGG TAT GAG AGA AAG ATG ACC CCC 411 Trp Ala lie Ser Ser Pro Phe Arg Tyr Glu Arg LYII Met Thr Pro 412 AAG GCA GCC TTC ATC CTG ATC AGT GTG GCA TGG ACC TTG TCT GTIl 456 Lys Ala Ala Phe lie Leu lie Ser Val Ala Trp Thr Leu Ser Val 457 CT C ATC TCC TTC ATC CCA GTG CAG CTC AGC TGG CAC AAG GCA AAA 501 Leu lie Ser Phe lie Pro Val Gin Leu Ser Trp Hill Lys Ala Lys 502 CCC ACA AGC CCC TCT GAT GGA AAT GCC ACT TCC CTG GCT GAG ACC 546 Pro Thr Ser Pro Ser Asp Gly Alln Ala Thr Ser Leu Ala Glu Thr 547 AT A GAC AAC TGT GAC TCC AGC CTC AGC AGG ACA TAT GCC ATC TCA 591 lie Allp Alln cys Asp Ser Ser Leu Ser Arg Thr Tyr Ala lie Ser 592 TCC TCT GTA ATA AGC TTT TAC ATC CCT GTG GCC ATC ATG ATT GTC 636 Ser Ser Val lie Ser Phe Tyr lie Pro Val Ala lie Met lie Val 637 ACC TAC ACC AGG ATC TAC AGG ATT GCT CAG AAA CAA ATA CGG CGC 681 Thr Tyr Thr Arg lie Tyr Arg lie Ala Gin LYII Gin lie Arg Arg 682 ATT GCG GCC TTG GAG AGG GCA GCA GTC CAC GCC AAG AAT TGC CA G 726 lie Ala Ala Leu Glu Arg Ala Ala Val His Ala LYII Asn Cys Gin 727 ACC ACC ACA GGT AAT GGA AAG CCT GTC GAA TGT TCT CAA CCG GA A 771 Thr Thr Thr Gly Asn Gly LYII Pro Val Glu Cys Ser Gin Pro Glu 772 AGT TCT TTT AAG ATG TCC TTC AAA AGA GAA ACT AAA GTC CTG AAG 816 Ser Ser Phe LYII Met Ser Phe Lys Arg Glu Thr Lys Val Leu Lys 817 ACT CTG TCG GTG ATC ATG GGT GTG TTT GTG TGC TGT TGG CTA CCT 861 Thr Leu Ser Val lie Met Gly Val Phe Val Cys Cys Trp Leu Pro 862 TTC TTC ATC TTG AAC TGC ATT TTG CCC TTC TGT GGG TCT GGG GAG 906 Phe Phe lie Leu Asn Cys lie Leu Pro Phe Cys Gly Ser Gly Glu 907 ACG CAG CCC TTC TGC ATT GAT TCC AAC ACC TTT GAC GTG TTT GTG 951 Thr Gin Pro Phe Cys lie Asp Ser Asn Thr Phe Asp Val Phe Val 952 TGG TTT GGG TGG GCT AAT TCA TCC TTG AAC CCC ATC ATT TAT GCC 996 Trp Phe Gly Trp Ala Asn Ser Ser Leu Asn Pro lie lie Tyr Ala 997 TTT AAT GCT GAT TTT CGG AAG GCA TTT TCA ACC CTC TTA GGA TGC1 041 Phe Asn Ala Asp Phe Arg Lys Ala Phe Ser Thr Leu Leu Gly Cys 1042 TAC AGA CTT TGC CCT GCG ACG AAT AAT GCC ATA GAG ACG GTG AGT1 086 Tyr Arg Leu Cys Pro Ala Thr Asn Asn Ala lie Glu Thr Val Ser 1087 AT C AAT AAC AAT GGG GCC GCG ATG TTT TCC AGC CAT CAT GAG CC A1 131 lie Asn Asn Asn Gly Ala Ala Met Phe Ser Ser His His Glu Pro 1132 CG A GGC TCC ATC TCC AAG GAG TGC AAT CTG GTT TAC CTG ATC CCA1 178 Arg Gly Ser lie Ser Lys Glu Cys Asn Leu Val Tyr Leu lie Pro 1177 CAT GCT GTG GGC TC C TC T GAG GAC CTG AAA AAG GAG GAG GCA GCT1 221 His Ala Val Gly Ser Ser Glu Allp Leu LYII Lys Glu Glu Ala Ala 1222 GGC ATC GCC AGA CCC TTG GAG AAG CTG TCC CCA GCC CTA TCG GTC1 266 Gly lie Ala Arg Pro Leu Glu LYII Leu Ser Pro Ala Leu Ser Val 1267 AT A TTG GAC TAT GAC ACT GAC GTC TCT CTG GAG AAG ATC CAA CC C1 311 lie Leu Allp Tyr Asp Thr Allp Val Ser Leu Glu Lys lie Gin Pro 1312 ATC ACA CAA AAC GGT CAG CAC CCA ACC TGA ACTCGCAGATGAATC1 356 lie Thr Gin Asn Gly Gin His Pro Thr Stop 1357 C T G C C A C A CAT G C T CAT C C C A A A A G C TAG A G GAG A T T G C T C T G G G G T T T G C TAT T A A G A A ACT A A G G T A C G G T GAG (3' end) AAACGATAATTCTTTGATTCCATGCCACTC-CCTAGGCAT PRIMER BamH1 oligo Figure 2. The DNA and amino acidse quences of the human DA Dl receptor (Sunahara et al. 1990). Primers 757 (in italics) and 758 were used to amplify DNA from control and schizophrenia tissues; each primer had a 9-base se quence attached for the BamHI restric tion enzyme. Three polymorphisms are shown at base positions -48, 90, and 222. and Hubert H. M. Van Tol); by The Canadian Psychiatric Research Foundation (to Drs. Mary V. Seeman and K. Siminovitch); by the National Alliance for Research in Schizophrenia and Depression (Chicago and New York); by the Constance E. and Stephen Lieber Award in Schizophrenia Research; and by the Joey and Toby Tannenbaum Award of the Canadian Psychiatric Research Foundation. REFERENCES American Psychiatric Association (1987): Diagnostic and Statistical Manual of Mental Disorders, ed 3, revised. Washington, DC, American Psychiatric Press Ausubel FM, Brent R, Kingston RE, Moore DD, SeidmanJG,

5 NEUROPSYCHOPHARMACOLOGY 1993-VOL. 8, NO.2 01 Receptors in Schizophrenia 135 Smith JA, Struhl K (1988): Current Protocols in Molecular Biology. Vol 1. New York, Wiley Interscience Catalano M, Nobile M, Novelli E, Marino C, Smeraldi E (1991): Use of PCR and DGGE to detect possible genetic variations in dopamine D2 receptor gene: A preliminary report. In Racagni G, Brunello N, Fukuda T (eds), Biological Psychiatry, Vol 2. Amsterdam, Excerpta Medica, pp !learry A, Gingrich JA, Falardeau P, Fremeau RT Jr, Bates MO, Caron MG (1990): Molecular cloning and expression of the gene for human D1 dopamine receptor. Nature 34:72-76 Farde L, Wiesel F-A, Stone-Elander S, Halldin C, Nordstrom A-L, Hall H, Sedvall G (1990): D2 dopamine receptors in neuroleptic-naive schizophrenic patients: a positron emission tomography study with [llc]raciopride. Arch Gen Psychiatry 47: Memo M, Kleinman JE, Hanbauer I (1983): Coupling of dopamine 01 recognition sites with adenylate cyclase in nuclei accumbens and caudatus of schizophrenics. Science 221: Miller SA, Dykes DD, Polesky HF (1988): A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215 Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich H (1988): Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: Sanger F, Nicklen S, Coulson AR (1977): DNA sequencing with chain termination inhibitors. Proc Natl Acad Sci USA 74: Seeman P, Lee T, Chau-Wong M, Wong K (1976): Antipsychotic drug doses and neuroleptic/dopamine receptors. Nature 261: Seeman P, Bzowej NH, Guan H-C, Bergeron C, Reynolds GP, Bird ED, Riederer P, Jellinger K, Tourtellotte WW (1987): Human brain 01 and D2 dopamine receptors in schizophrenia, Alzheimer's, Parkinson's and Huntington's diseases. Neuropsychopharmacology 1:5-15 Seeman P, Niznik HB, Guan H-C, Booth G, Ulpian C (1989): Link between 01 and D2 dopamine receptors is reduced in schizophrenia and Huntington diseased brain. Proc Natl Acad Sci USA 86: Seeman P, Niznik HB, Guan H-C (1990): Elevation of dopamine 02 receptors in schizophrenia is underestimated by radioactive raclopride. Arch Gen Psychiatry 47: Seeman P, Ohara K, Ulpian C, Seeman MV, Jellinger K, Van Tol HHM, Niznik HB (1992): Schizophrenia: Normal sequence in the dopamine D2 receptor region which couples to G proteins. DNA polymorphisms found in D2. Neuropsychopharmacology (In press) Sunahara RK, Niznik HB, Weiner DM, Stormann TM, Brann MR, Kennedy JL, Gelernter JE, Rozmahel R, Yang Y, Israel Y, Seeman P, O'Dowd BF (1990): Human dopamine D1 receptor encoded by an intronless gene on chromosome 5. Nature 347:80-83 Sung CH, Davenport CM, Hennessey Je, Maumenee IH, Jacobson SG, Heckenlively JR, Nowakowski R, Fishman G, Gouras P, Nathans J (1991): Rhodopsin mutations in autosomal retinitis pigmentosa. Proc Natl Acad Sci USA 88: Wong DF, Wagner Jr HN, Tune LE, Dannals RF, Pearlson GD, Links JM, Tamminga CA, Broussolle EP, Ravert HT, Wilson AA, Toung JKT, Malat J, Williams JA, O'Tuama LA, Snyder SH, Kuhar MH, Gjedde A (1986). Positron emission tomography reveals elevated D2 dopamine receptors in drug-naive schizophrenics. Science 234: World Health Organization (1979): Manual of the International ClassifIcation of Diseases, Injuries, and Causes of Death. 9th Revision, Clinical ModifIcation. Geneva, World Health Organization Wyatt RJ, Kirch DG, Delisi LE (1989): Schizophrenia: Biochemical, endocrine and immunological studies. In Kaplan HI, Sadock BJ (eds), Comprehensive Textbook of Psychiatry. Baltimore, Williams & Wilkins, pp hou Q-Y, Grandy DK, Thambi L, Kushner JA, Van Tol HHM, Cone R, Pribnow D, Salon J, Bunzow JR, Civelli 0(1990): Cloning and expression of human and rat D1 dopamine receptors. Nature 347:76-80

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR

Lecture 10, 20/2/2002: The process of solution development - The CODEHOP strategy for automatic design of consensus-degenerate primers for PCR 1 The problem We wish to clone a yet unknown gene from a known