Supplementary Figure 1. BLASTN search of human ESTs using TSLC1-109 to. Supplementary Figure 2. The Minimal Promoter of TSLC1 was verified using a
|
|
- Garry Watson
- 6 years ago
- Views:
Transcription
1 Supplementary Figure Legend Click here to download Figure: Supplementary FigureLegends.doc Supplementary Figure 1. BLASTN search of human ESTs using TSLC1-109 to +91. The results of this BLASTN search were copied and displayed on this page. Supplementary Figure 2. The Minimal Promoter of TSLC1 was verified using a different reporter construct. Firefly luciferase reporter genes containing the TSLC1 promoter fragment from -233 to +63 or no promoter (pgl3-basic) were co-transfected with prl-cmv into NCI-H522 cells and transient activity was assayed. Firefly luciferase activities were normalized to prl-cmv (Renilla luciferase). The bars represent the average of firefly luciferase activity normalized to Renilla luciferase activity. The error bars denote the standard deviation. The pgl3-basic activity was 0.35 Relative Light Units in this experiment.
2 Supplementary Figure 1 Click here to download Figure: SupplementaryFigure1.doc NCBI/ BLAST/ blastn suite/ Formatting Results D2701R Your search is limited to records matching entrez query: txid9606 [ORGN]. Edit and Resubmit Save Search Strategies Formatting options Download Download Alignment Text XML ASN.1 Hit Table(text) Hit Table(csv) Search Strategies ASN.1 Biose q ASN.1 [? ] TSLC1-109 to +91 lcl TSLC1-109 to +91 nucleic acid 200 est Database of GenBank+EMBL+DDBJ sequences from EST Divisions Query ID Description Molecule type Query Length Database Name Description Program BLASTN Citation Other reports: Search Summary [Taxonomy reports] [Distance tree of results] Graphic Summary Distribution of 83 Blast Hits on the Query Sequence [?] Descriptions Legend for links to other resources: UniGene GEO Gene Structure Map Viewer Sequences producing significant alignments: (Click headers to sort columns)
3 BI BI F1 NIH_MGC_121 Homo sapiens cdna clone IMAGE: ', mrna sequence F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE: ', mrna sequence % DB DA DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013069G09 5', mrna sequence DA BRHIP3 Homo sapiens cdna clone BRHIP ', mrna sequence % % 5e BP BP Sugano cdna library, testis Homo sapiens cdna clone TST ', mrna sequence BP BP BP Sugano cdna library, thymus Homo sapiens cdna clone TMS ', mrna sequence BP Sugano cdna library, testis Homo sapiens cdna clone TST ', mrna sequence DB DB TESTI4 Homo sapiens cdna clone TESTI ', mrna sequence DB BP DB TESTI4 Homo sapiens cdna clone TESTI ', mrna sequence BP Sugano cdna library, brain Homo sapiens cdna clone ADB ', mrna sequence DB DB TESTI2 Homo sapiens cdna clone TESTI ', mrna sequence CD H1 FLP Homo sapiens cdna, mrna sequence CD H1 FLP Homo sapiens cdna, mrna sequence DB DB TRACH3 Homo sapiens cdna clone TRACH ', mrna sequence BP BP Sugano cdna library, kidney epithelial cell
4 Homo sapiens cdna clone HRC ', mrna sequence CD H1 FLP Homo sapiens cdna, mrna sequence DB DB RIKEN full-length enriched human cdna library, hypothalamus Homo sapiens cdna clone H033003E12 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013050H12 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, hippocampus Homo sapiens cdna clone H023038C19 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013042E13 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013018E13 5', mrna sequence DB DB DB TKIDN2 Homo sapiens cdna clone TKIDN ', mrna sequence DB TESTI4 Homo sapiens cdna clone TESTI ', mrna sequence DB DB TRACH3 Homo sapiens cdna clone TRACH ', mrna sequence DB DA DB DB TESTI2 Homo sapiens cdna clone TESTI ', mrna sequence DA NT2RI2 Homo sapiens cdna clone NT2RI ', mrna sequence DB TESTI2 Homo sapiens cdna clone TESTI ', mrna sequence DA DA OCBBF3 Homo sapiens cdna clone OCBBF ', mrna sequence
5 DA DA DA OCBBF3 Homo sapiens cdna clone OCBBF ', mrna sequence DA FEBRA2 Homo sapiens cdna clone FEBRA ', mrna sequence DA DA HLUNG2 Homo sapiens cdna clone HLUNG ', mrna sequence DA DA DA DA NT2NE2 Homo sapiens cdna clone NT2NE ', mrna sequence DA FELNG2 Homo sapiens cdna clone FELNG ', mrna sequence DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna sequence DA DA DA DA BRAMY3 Homo sapiens cdna clone BRAMY ', mrna sequence DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna sequence DA BRHIP2 Homo sapiens cdna clone BRHIP ', mrna sequence DA DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna sequence DA DA DA BRALZ2 Homo sapiens cdna clone BRALZ ', mrna sequence DA BRAMY2 Homo sapiens cdna clone BRAMY ', mrna sequence AU AU human 4S neuroblastoma cdna Homo sapiens cdna clone Nbla ', mrna sequence BP BP BP Sugano cdna library, testis Homo sapiens cdna clone TST ', mrna sequence BP Sugano cdna library, mammary gland T47D Homo sapiens cdna clone TDR ', mrna sequence BP BP Sugano cdna library, brain Homo sapiens
6 cdna clone SZB ', mrna sequence BP BP Sugano cdna library, brain Homo sapiens cdna clone SZB ', mrna sequence BP BP BP Sugano cdna library, placenta Homo sapiens cdna clone PLR ', mrna sequence BP Sugano cdna library, brain Homo sapiens cdna clone NRB ', mrna sequence BP BP Sugano cdna library, kidney epithelial cell Homo sapiens cdna clone HRC ', mrna sequence BP BP Sugano cdna library, cerebrum Homo sapiens cdna clone CBR ', mrna sequence BP BP BP BP Sugano cdna library, cerebellum Homo sapiens cdna clone CBL ', mrna sequence BP Sugano cdna library, brain Homo sapiens cdna clone ADB ', mrna sequence BP Sugano cdna library, brain Homo sapiens cdna clone ADB ', mrna sequence BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB ', mrna sequence CK BI AGENCOURT_ NIH_MGC_228 Homo sapiens cdna clone IMAGE: ', mrna sequence F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: ', mrna sequence BI F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE: ', mrna sequence BG BG F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE: ', mrna sequence F1 NIH_MGC_77 Homo sapiens cdna clone IMAGE: ', mrna sequence BI F1 NIH_MGC_95 Homo sapiens cdna clone
7 IMAGE: ', mrna sequence BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: ', mrna sequence DA DA HEMBA1 Homo sapiens cdna clone HEMBA ', mrna sequence CD J1 FLP Homo sapiens cdna, mrna sequence CB K-EST B2N Homo sapiens cdna clone B2N G06 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, hippocampus Homo sapiens cdna clone H023021F06 5', mrna sequence DB BP DB THYMU2 Homo sapiens cdna clone THYMU ', mrna sequence BP Sugano cdna library, thalamus Homo sapiens cdna clone THR ', mrna sequence BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: ', mrna sequence AL BF DKFZp313B2029_r1 313 (synonym: hlcc2) Homo sapiens cdna clone DKFZp313B2029 5', mrna sequence F1 NIH_MGC_58 Homo sapiens cdna clone IMAGE: ', mrna sequence CX HESC2_6_H04.g1_A035 NIH_MGC_258 Homo sapiens cdna clone IMAGE: ', mrna sequence BU io40b04.y1 Human insulinoma Homo sapiens cdna clone IMAGE: ' similar to TR:Q9Y4A4 Q9Y4A4 F22162_1 ;, mrna sequence BQ hd25a01.y1 Human Retina cdna (Un-normalized, unamplified): hd/he Homo sapiens cdna clone hd25a01 5', mrna sequence DB DB RIKEN full-length enriched human cdna library, hypothalamus Homo sapiens cdna clone H033078L23 5', mrna sequence
8 BG BQ BQ F1 NIH_MGC_14 Homo sapiens cdna clone IMAGE: ', mrna sequence AGENCOURT_ NIH_MGC_47 Homo sapiens cdna clone IMAGE: ', mrna sequence AGENCOURT_ NIH_MGC_47 Homo sapiens cdna clone IMAGE: ', mrna sequence BQ AGENCOURT_ NIH_MGC_72 Homo sapiens cdna clone IMAGE: ', mrna sequence BP CD BP Sugano cdna library, brain Homo sapiens cdna clone ADB ', mrna sequence AGENCOURT_ NIH_MGC_181 Homo sapiens cdna clone IMAGE: ', mrna sequence BI F1 NIH_MGC_121 Homo sapiens cdna clone IMAGE: ', mrna sequence DN TC Human adult whole brain, large insert, pcmv expression library Homo sapiens cdna clone TC ' similar to Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mrna sequence BQ AGENCOURT_ Lupski_sciatic_nerve Homo sapiens cdna clone IMAGE: ', mrna sequence BQ ik08a10.y1 Human insulinoma Homo sapiens cdna clone IMAGE: ' similar to TR:Q9Y4A4 Q9Y4A4 F22162_1 ;, mrna sequence Alignments Select All Get selected sequences Distance tree of results Multiple alignment >gb BI F1 NIH_MGC_121 Homo sapiens cdna clone IMAGE: Length=737
9 GENE ID: CADM1 cell adhesion molecule 1 [Homo sapiens] (Over 10 PubMed links) Score = 283 bits (153), Expect = 3e-74 Identities = 153/153 (100%), Gaps = 0/153 (0%) Query 48 GGTTGGGCTCGCGGCGCTGTGATTGGTCTGCCCGGACTCCGCCTCCAGCGCATGTCATTA 107 Sbjct 1 GGTTGGGCTCGCGGCGCTGTGATTGGTCTGCCCGGACTCCGCCTCCAGCGCATGTCATTA 60 Query 108 GCATCTCATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAG 167 Sbjct 61 GCATCTCATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAG 120 Query 168 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 121 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 153 >gb BI F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE: Length=142 Score = 228 bits (123), Expect = 1e-57 Identities = 128/130 (98%), Gaps = 1/130 (0%) Query 1 GCGCCAgggggcggggtgggggAGGGAGCGAGGCCCTCCGAGAGCCGGGTTGGGCTCGCG 60 Sbjct 14 GCGCCA- GGGGCGGGGTGGGGGAGGGAGCCAGGCCCTCCGAGAGCCGGGTTGGGCTCGCG 72 Query 61 GCGCTGTGATTGGTCTGCCCGGACTCCGCCTCCAGCGCATGTCATTAGCATCTCATTAGC 120 Sbjct 73 GCGCTGTGATTGGTCTGCCCGGACTCCGCCTCCAGCGCATGTCATTAGCATCTCATTAGC 132 Query 121 TGTCCGCTCG 130 Sbjct 133 TGTCCGCTCG 142 >dbj DB DB RIKEN full-length enriched human cdna
10 library, testis Homo sapiens cdna clone H013069G09 Length=726 Score = 159 bits (86), Expect = 5e-37 Identities = 86/86 (100%), Gaps = 0/86 (0%) Query 115 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 174 Sbjct 1 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 60 Query 175 ACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 61 ACATGGCGAGTGTAGTGCTGCCGAGC 86 >dbj DA DA BRHIP3 Homo sapiens cdna clone BRHIP ', mrna Length=541 Score = 159 bits (86), Expect = 5e-37 Identities = 86/86 (100%), Gaps = 0/86 (0%) Query 115 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 174 Sbjct 1 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 60 Query 175 ACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 61 ACATGGCGAGTGTAGTGCTGCCGAGC 86 >dbj BP BP Sugano cdna library, testis Homo sapiens cdna clone TST08402 Length=551 Score = 159 bits (86), Expect = 5e-37 Identities = 86/86 (100%), Gaps = 0/86 (0%) Query 115 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 174 Sbjct 4 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 63
11 Query 175 ACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 64 ACATGGCGAGTGTAGTGCTGCCGAGC 89 >dbj BP BP Sugano cdna library, thymus Homo sapiens cdna clone TMS07222 Length=578 Score = 159 bits (86), Expect = 5e-37 Identities = 86/86 (100%), Gaps = 0/86 (0%) Query 115 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 174 Sbjct 1 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 60 Query 175 ACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 61 ACATGGCGAGTGTAGTGCTGCCGAGC 86 >dbj BP BP Sugano cdna library, testis Homo sapiens cdna clone TST00109 Length=554 Score = 143 bits (77), Expect = 5e-32 Identities = 83/86 (96%), Gaps = 0/86 (0%) Query 115 ATTAGCTGTCCGCTCGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 174 Sbjct 1 ATTAGCTGTCCGGGGGGGCTCCGGAGGCAGCCAACGCCGCCAGTCTGAGGCAGGTGCCCG 60 Query 175 ACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 61 ACATGGCGAGTGTAGTGCTGCCGAGC 86 >dbj DB DB TESTI4 Homo sapiens cdna clone TESTI ', mrna Length=548 Score = 108 bits (58), Expect = 2e-21 Identities = 58/58 (100%), Gaps = 0/58 (0%)
12 Query 143 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 58 >dbj DB DB TESTI4 Homo sapiens cdna clone TESTI ', mrna Length=552 Score = 108 bits (58), Expect = 2e-21 Identities = 58/58 (100%), Gaps = 0/58 (0%) Query 143 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 3 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 60 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB01649 Length=581 Score = 108 bits (58), Expect = 2e-21 Identities = 58/58 (100%), Gaps = 0/58 (0%) Query 143 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 58 >dbj DB DB TESTI2 Homo sapiens cdna clone TESTI ', mrna Length=546 Score = 102 bits (55), Expect = 8e-20 Identities = 57/58 (98%), Gaps = 0/58 (0%) Query 143 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200
13 Sbjct 1 AGCCAACGCCGCCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTACTGCTGCCGAGC 58 >gb CD H1 FLP Homo sapiens cdna, mrna Length=717 Score = 87.9 bits (47), Expect = 2e-15 Identities = 47/47 (100%), Gaps = 0/47 (0%) Query 154 CCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 24 CCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 70 >gb CD H1 FLP Homo sapiens cdna, mrna Length=657 Score = 87.9 bits (47), Expect = 2e-15 Identities = 47/47 (100%), Gaps = 0/47 (0%) Query 154 CCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 23 CCAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 69 >dbj DB DB TRACH3 Homo sapiens cdna clone TRACH ', mrna Length=590 Score = 86.1 bits (46), Expect = 8e-15 Identities = 46/46 (100%), Gaps = 0/46 (0%) Query 155 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 46 >dbj BP BP Sugano cdna library, kidney epithelial cell Homo sapiens cdna clone HRC07849 Length=586 Score = 86.1 bits (46), Expect = 8e-15 Identities = 46/46 (100%), Gaps = 0/46 (0%) Query 155 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 46
14 >gb CD H1 FLP Homo sapiens cdna, mrna Length=675 Score = 86.1 bits (46), Expect = 8e-15 Identities = 46/46 (100%), Gaps = 0/46 (0%) Query 155 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 24 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 69 >dbj DB DB RIKEN full-length enriched human cdna library, hypothalamus Homo sapiens cdna clone H033003E12 Length=750 >dbj DB DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013050H12 Length=718 >dbj DB DB RIKEN full-length enriched human cdna library, hippocampus Homo sapiens cdna clone H023038C19 Length=709 >dbj DB DB RIKEN full-length enriched human cdna library, testis
15 Homo sapiens cdna clone H013042E13 Length=646 >dbj DB DB RIKEN full-length enriched human cdna library, testis Homo sapiens cdna clone H013018E13 Length=396 >dbj DB DB TKIDN2 Homo sapiens cdna clone TKIDN ', mrna Length=563 >dbj DB DB TESTI4 Homo sapiens cdna clone TESTI ', mrna Length=575 >dbj DB DB TRACH3 Homo sapiens cdna clone TRACH ', mrna
16 Length=551 >dbj DB DB TESTI2 Homo sapiens cdna clone TESTI ', mrna Length=569 >dbj DA DA NT2RI2 Homo sapiens cdna clone NT2RI ', mrna Length=570 >dbj DB DB TESTI2 Homo sapiens cdna clone TESTI ', mrna Length=549 >dbj DA DA OCBBF3 Homo sapiens cdna clone OCBBF ', mrna
17 Length=558 >dbj DA DA OCBBF3 Homo sapiens cdna clone OCBBF ', mrna Length=467 >dbj DA DA FEBRA2 Homo sapiens cdna clone FEBRA ', mrna Length=567 >dbj DA DA HLUNG2 Homo sapiens cdna clone HLUNG ', mrna Length=564 >dbj DA DA NT2NE2 Homo sapiens cdna clone NT2NE ', mrna
18 Length=547 >dbj DA DA FELNG2 Homo sapiens cdna clone FELNG ', mrna Length=594 >dbj DA DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna Length=506 >dbj DA DA BRAMY3 Homo sapiens cdna clone BRAMY ', mrna Length=597 >dbj DA DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna
19 Length=495 >dbj DA DA BRHIP2 Homo sapiens cdna clone BRHIP ', mrna Length=566 >dbj DA DA BRAWH3 Homo sapiens cdna clone BRAWH ', mrna Length=594 >dbj DA DA BRALZ2 Homo sapiens cdna clone BRALZ ', mrna Length=550 >dbj DA DA BRAMY2 Homo sapiens cdna clone BRAMY ', mrna
20 Length=563 >dbj AU AU human 4S neuroblastoma cdna Homo sapiens cdna clone Nbla Length=571 >dbj BP BP Sugano cdna library, testis Homo sapiens cdna clone TST05569 Length=567 >dbj BP BP Sugano cdna library, mammary gland T47D Homo sapiens cdna clone TDR07644 Length=583 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone SZB05947
21 Length=583 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone SZB00120 Length=581 >dbj BP BP Sugano cdna library, placenta Homo sapiens cdna clone PLR06586 Length=583 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone NRB08832 Length=590 >dbj BP BP Sugano cdna library, kidney epithelial cell Homo sapiens
22 cdna clone HRC02950 Length=579 >dbj BP BP Sugano cdna library, cerebrum Homo sapiens cdna clone CBR02696 Length=572 >dbj BP BP Sugano cdna library, cerebellum Homo sapiens cdna clone CBL06968 Length=580 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB09207 Length=581 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB09107
23 Length=581 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB05734 Length=582 >gb CK AGENCOURT_ NIH_MGC_228 Homo sapiens cdna clone IMAGE: Length=671 Sbjct 4 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 48 >gb BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: Length=801 Sbjct 6 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 50 >gb BI F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE:
24 Length=799 Sbjct 7 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 51 >gb BG F1 NIH_MGC_97 Homo sapiens cdna clone IMAGE: Length=674 Sbjct 6 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 50 >gb BG F1 NIH_MGC_77 Homo sapiens cdna clone IMAGE: Length=733 Sbjct 2 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 46 >gb BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: Length=946 Score = 82.4 bits (44), Expect = 1e-13 Identities = 44/44 (100%), Gaps = 0/44 (0%) Query 157 GTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 7 GTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 50 >gb BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE:
25 Length=746 Score = 82.4 bits (44), Expect = 1e-13 Identities = 44/44 (100%), Gaps = 0/44 (0%) Query 157 GTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 7 GTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 50 >dbj DA DA HEMBA1 Homo sapiens cdna clone HEMBA ', mrna Length=905 Score = 80.5 bits (43), Expect = 4e-13 Identities = 43/43 (100%), Gaps = 0/43 (0%) Query 158 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 43 >gb CD J1 FLP Homo sapiens cdna, mrna Length=694 Score = 80.5 bits (43), Expect = 4e-13 Identities = 43/43 (100%), Gaps = 0/43 (0%) Query 158 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 25 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 67 >gb CB K-EST B2N Homo sapiens cdna clone B2N G06 Length=549 Score = 80.5 bits (43), Expect = 4e-13 Identities = 43/43 (100%), Gaps = 0/43 (0%) Query 158 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 TCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 43 >dbj DB DB RIKEN full-length enriched human cdna library, hippocampus Homo sapiens cdna clone H023021F06 Length=713
26 Score = 78.7 bits (42), Expect = 1e-12 Identities = 44/45 (97%), Gaps = 0/45 (0%) Sbjct 1 AGTCTGAGGCATGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 45 >dbj DB DB THYMU2 Homo sapiens cdna clone THYMU ', mrna Length=553 Score = 78.7 bits (42), Expect = 1e-12 Identities = 44/45 (97%), Gaps = 0/45 (0%) Sbjct 1 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTACTGCTGCCGAGC 45 >dbj BP BP Sugano cdna library, thalamus Homo sapiens cdna clone THR04392 Length=582 Score = 78.7 bits (42), Expect = 1e-12 Identities = 44/45 (97%), Gaps = 0/45 (0%) Sbjct 1 AGTCTGAGGCAGGTGCCCGACATGGCGAGTGTACTGCTGCCGAGC 45 >gb BI F1 NIH_MGC_95 Homo sapiens cdna clone IMAGE: Length=631 Score = 78.7 bits (42), Expect = 1e-12 Identities = 44/45 (97%), Gaps = 0/45 (0%) Sbjct 6 AGTCAGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 50 >emb AL DKFZp313B2029_r1 313 (synonym: hlcc2) Homo sapiens cdna clone DKFZp313B2029 Length=368
27 Score = 78.7 bits (42), Expect = 1e-12 Identities = 44/45 (97%), Gaps = 0/45 (0%) Sbjct 5 AGTCTGATGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 49 >gb BF F1 NIH_MGC_58 Homo sapiens cdna clone IMAGE: Length=840 Score = 78.7 bits (42), Expect = 1e-12 Identities = 45/46 (97%), Gaps = 1/46 (2%) Query 155 CAGTCTGAGGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 2 CAGTCTGAGGCAGGTG-CCGACATGGCGAGTGTAGTGCTGCCGAGC 46 >gb CX HESC2_6_H04.g1_A035 NIH_MGC_258 Homo sapiens cdna clone IMAGE: Length=901 Score = 71.3 bits (38), Expect = 2e-10 Identities = 38/38 (100%), Gaps = 0/38 (0%) Query 163 GGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 19 GGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 56 >gb BU io40b04.y1 Human insulinoma Homo sapiens cdna clone IMAGE: ' similar to TR:Q9Y4A4 Q9Y4A4 F22162_1 ;, mrna Length=603 Score = 71.3 bits (38), Expect = 2e-10 Identities = 38/38 (100%), Gaps = 0/38 (0%) Query 163 GGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 8 GGCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 45 >gb BQ hd25a01.y1 Human Retina cdna (Un-normalized, unamplified): hd/he Homo sapiens cdna clone hd25a01 Length=610
28 Score = 69.4 bits (37), Expect = 9e-10 Identities = 37/37 (100%), Gaps = 0/37 (0%) Query 164 GCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 GCAGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 37 >dbj DB DB RIKEN full-length enriched human cdna library, hypothalamus Homo sapiens cdna clone H033078L23 Length=487 Score = 65.8 bits (35), Expect = 1e-08 Identities = 35/35 (100%), Gaps = 0/35 (0%) Query 166 AGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 AGGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 35 >gb BG F1 NIH_MGC_14 Homo sapiens cdna clone IMAGE: Length=979 Score = 63.9 bits (34), Expect = 4e-08 Identities = 34/34 (100%), Gaps = 0/34 (0%) Query 167 GGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 2 GGTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 35 >gb BQ AGENCOURT_ NIH_MGC_47 Homo sapiens cdna clone IMAGE: Length=816 Score = 62.1 bits (33), Expect = 1e-07 Identities = 33/33 (100%), Gaps = 0/33 (0%) Query 168 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 33 >gb BQ AGENCOURT_ NIH_MGC_47 Homo sapiens cdna clone IMAGE: Length=1086
29 Score = 62.1 bits (33), Expect = 1e-07 Identities = 33/33 (100%), Gaps = 0/33 (0%) Query 168 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 GTGCCCGACATGGCGAGTGTAGTGCTGCCGAGC 33 >gb BQ AGENCOURT_ NIH_MGC_72 Homo sapiens cdna clone IMAGE: Length=909 Score = 58.4 bits (31), Expect = 2e-06 Identities = 31/31 (100%), Gaps = 0/31 (0%) Query 170 GCCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 12 GCCCGACATGGCGAGTGTAGTGCTGCCGAGC 42 >dbj BP BP Sugano cdna library, brain Homo sapiens cdna clone ADB02584 Length=581 Score = 56.5 bits (30), Expect = 7e-06 Identities = 42/47 (89%), Gaps = 3/47 (6%) Query 156 AGT-CTGAGGCAGGTGCC-CGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 AGTCCTGA-GCACGAGCCTCGACATGGCGAGTGTAGTGCTGCCGAGC 46 >gb CD AGENCOURT_ NIH_MGC_181 Homo sapiens cdna clone IMAGE: Length=863 Score = 56.5 bits (30), Expect = 7e-06 Identities = 30/30 (100%), Gaps = 0/30 (0%) Query 171 CCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 CCCGACATGGCGAGTGTAGTGCTGCCGAGC 30 >gb BI F1 NIH_MGC_121 Homo sapiens cdna clone IMAGE: Length=706
30 Score = 56.5 bits (30), Expect = 7e-06 Identities = 30/30 (100%), Gaps = 0/30 (0%) Query 171 CCCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 CCCGACATGGCGAGTGTAGTGCTGCCGAGC 30 >gb DN TC Human adult whole brain, large insert, pcmv expression library Homo sapiens cdna clone TC ' similar to Homo sapiens immunoglobulin superfamily, member 4 (IGSF4), mrna Length=632 Score = 54.7 bits (29), Expect = 2e-05 Identities = 29/29 (100%), Gaps = 0/29 (0%) Query 172 CCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 8 CCGACATGGCGAGTGTAGTGCTGCCGAGC 36 >gb BQ AGENCOURT_ Lupski_sciatic_nerve Homo sapiens cdna clone IMAGE: Length=898 Score = 54.7 bits (29), Expect = 2e-05 Identities = 29/29 (100%), Gaps = 0/29 (0%) Query 172 CCGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 1 CCGACATGGCGAGTGTAGTGCTGCCGAGC 29 >gb BQ ik08a10.y1 Human insulinoma Homo sapiens cdna clone IMAGE: ' similar to TR:Q9Y4A4 Q9Y4A4 F22162_1 ;, mrna Length=587 Score = 52.8 bits (28), Expect = 9e-05 Identities = 28/28 (100%), Gaps = 0/28 (0%) Query 173 CGACATGGCGAGTGTAGTGCTGCCGAGC 200 Sbjct 8 CGACATGGCGAGTGTAGTGCTGCCGAGC 35
31 Select All Get selected sequences Distance tree of results Multiple alignment NCBI NLM NIH DHHS Copyright Disclaimer Privacy Accessibility Contact Send feedback
32 Supplementary Figure 2 Click here to download Figure: SupplementaryFigure2.eps
BLASTing through the kingdom of life
Information for students Instructions: In short, you will copy one of the sequences from the data set, use blastn to identify it, and use the information from your search to answer the questions below.
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the main database of nucleotide sequences at the National Center for Biotechnology
More informationBLASTing through the kingdom of life
Information for teachers Description: In this activity, students copy unknown DNA sequences and use them to search GenBank, the database of nucleotide sequences at the National Center for Biotechnology
More informationData Retrieval from GenBank
Data Retrieval from GenBank Peter J. Myler Bioinformatics of Intracellular Pathogens JNU, Feb 7-0, 2009 http://www.ncbi.nlm.nih.gov (January, 2007) http://ncbi.nlm.nih.gov/sitemap/resourceguide.html Accessing
More informationWSSP-10 Chapter 9 Determine ORF and BLASTP
WSSP-10 Chapter 9 Determine ORF and BLASTP Steps and terms used in protein expression 1 st ATG in mrna p 9-1 Cloning the cdna library p 9-1 Possible reading frames p 9-2 Possible types of clones in the
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationEECS 730 Introduction to Bioinformatics Sequence Alignment. Luke Huan Electrical Engineering and Computer Science
EECS 730 Introduction to Bioinformatics Sequence Alignment Luke Huan Electrical Engineering and Computer Science http://people.eecs.ku.edu/~jhuan/ Database What is database An organized set of data Can
More informationNCBI web resources I: databases and Entrez
NCBI web resources I: databases and Entrez Yanbin Yin Most materials are downloaded from ftp://ftp.ncbi.nih.gov/pub/education/ 1 Homework assignment 1 Two parts: Extract the gene IDs reported in table
More informationIntroduction to Bioinformatics CPSC 265. What is bioinformatics? Textbooks
Introduction to Bioinformatics CPSC 265 Thanks to Jonathan Pevsner, Ph.D. Textbooks Johnathan Pevsner, who I stole most of these slides from (thanks!) has written a textbook, Bioinformatics and Functional
More informationGenomics and Database Mining (HCS 604.3) April 2005
Genomics and Database Mining (HCS 604.3) April 2005 David M. Francis OARDC 1680 Madison Ave Wooster, OH 44691 e-mail: francis.77@osu.edu Introduction: Computers have changed the way biologists go about
More informationWeb-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide.
Page 1 of 18 Web-based tools for Bioinformatics; A (free) introduction to (freely available) NCBI, MUSC and World-wide. When and Where---Wednesdays 1-2pm Room 438 Library Admin Building Beginning September
More informationHot Topics. What s New with BLAST?
Hot Topics What s New with BLAST? Slides based on NCBI talk at American Society of Human Genetics October 2005 Hot Topics Outline I. New BLAST Algorithm: Discontiguous MegaBLAST II. New Databases III.
More informationBioinformatics Tools. Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine
Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Bioinformatics Tools Stuart M. Brown, Ph.D Dept of Cell Biology NYU School of Medicine Overview This lecture will
More informationEntrez Gene: gene-centered information at NCBI
D54 D58 Nucleic Acids Research, 2005, Vol. 33, Database issue doi:10.1093/nar/gki031 Entrez Gene: gene-centered information at NCBI Donna Maglott*, Jim Ostell, Kim D. Pruitt and Tatiana Tatusova National
More informationGene Annotation Project. Group 1. Tyler Tiede Yanzhu Ji Jenae Skelton
Gene Annotation Project Group 1 Tyler Tiede Yanzhu Ji Jenae Skelton Outline Tools Overview of 150kb region Overview of annotation process Characterization of 5 putative gene regions Analysis of masked
More informationDatabases in genomics
Databases in genomics Search in biological databases: The most common task of molecular biologist researcher, to answer to the following ques7ons:! Are they new sequences deposited in biological databases
More informationSeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen
SeattleSNPs Interactive Tutorial: Database Inteface Entrez, dbsnp, HapMap, Perlegen The tutorial is designed to take you through the steps necessary to access SNP data from the primary database resources:
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Data mining in Ensembl with BioMart Worked Example The human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28. Which other genes related to human
More informationNCBI Molecular Biology Resources
NCBI Molecular Biology Resources Part 2: Using NCBI BLAST December 2009 Using BLAST Basics of using NCBI BLAST Using the new Interface Improved organism and filter options New Services Primer BLAST Align
More informationBIOINFORMATICS IN BIOCHEMISTRY
BIOINFORMATICS IN BIOCHEMISTRY Bioinformatics a field at the interface of molecular biology, computer science, and mathematics Bioinformatics focuses on the analysis of molecular sequences (DNA, RNA, and
More informationHost : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama
Method to assign the coding regions of ESTs Céline Becquet Summer Program 2002 Structural Neuropathology Lab Molecular Neuropathology Group RIKEN Brain Science Institute Host : Dr. Nobuyuki Nukina Tutor
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationDeakin Research Online
Deakin Research Online This is the published version: Church, Philip, Goscinski, Andrzej, Wong, Adam and Lefevre, Christophe 2011, Simplifying gene expression microarray comparative analysis., in BIOCOM
More informationSequence Alignments. Week 3
Sequence Alignments Week 3 Independent Project Gene Due: 9/25 (Monday--must be submitted by email) Rough Draft Due: 11/13 (hard copy due at the beginning of class, and emailed to me) Final Version Due:
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationOutline. Evolution. Adaptive convergence. Common similarity problems. Chapter 7: Similarity searches on sequence databases
Chapter 7: Similarity searches on sequence databases All science is either physics or stamp collection. Ernest Rutherford Outline Why is similarity important BLAST Protein and DNA Interpreting BLAST Individualizing
More information1. Primers used for PCR and sequencing of 13 MFRP exon coding regions.
page 1 Supporting Information 1. Primers used for PCR and sequencing of 13 MFRP exon coding regions. Fig. 7. Coding exons of membrane-type, Frizzled-related protein (MFRP). Diagram showing genomic interval
More informationChapter 2: Access to Information
Chapter 2: Access to Information Outline Introduction to biological databases Centralized databases store DNA sequences Contents of DNA, RNA, and protein databases Central bioinformatics resources: NCBI
More informationTo generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR
Plasmids To generate the luciferase fusion to the human 3 UTRs, we sub-cloned the 3 UTR fragments downstream of firefly luciferase (luc) in pgl3 control (Promega). pgl3- CDK6 was made by amplifying a 2,886
More informationAssemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz
Assemblytics: a web analytics tool for the detection of assembly-based variants Maria Nattestad and Michael C. Schatz Table of Contents Supplementary Note 1: Unique Anchor Filtering Supplementary Figure
More informationData and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup
Data and Metadata Models Recommendations Version 1.2 Developed by the IHEC Metadata Standards Workgroup 1. Introduction The data produced by IHEC is illustrated in Figure 1. Figure 1. The space of epigenomic
More informationQuick reference guide
Quick reference guide Our Invitrogen GeneArt CRISPR Search and Design Tool allows you to search our database of >600,000 predesigned CRISPR guide RNA (grna) sequences or analyze your sequence of interest
More informationA Field Guide to GenBank and NCBI Molecular Biology Resources
A Field Guide to GenBank and NCBI Molecular Biology Resources slightly modified from Peter Cooper ftp://ftp.ncbi.nih.gov/pub/cooper/fieldguide/ Eric Sayers ftp://ftp.ncbi.nih.gov/pub/sayers/field_guide/u_penn/
More informationCAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU
CAP 5510/CGS 5166: Bioinformatics & Bioinformatic Tools GIRI NARASIMHAN, SCIS, FIU Three major public DNA databases!2! GenBank NCBI (Natl Center for Biotechnology Information) www.ncbi.nlm.nih.gov! EMBL
More informationAPPENDIX. Appendix. Table of Contents. Ethics Background. Creating Discussion Ground Rules. Amino Acid Abbreviations and Chemistry Resources
Appendix Table of Contents A2 A3 A4 A5 A6 A7 A9 Ethics Background Creating Discussion Ground Rules Amino Acid Abbreviations and Chemistry Resources Codons and Amino Acid Chemistry Behind the Scenes with
More informationBIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1
BIOINF525: INTRODUCTION TO BIOINFORMATICS LAB SESSION 1 Bioinformatics Databases http://bioboot.github.io/bioinf525_w17/module1/#1.1 Dr. Barry Grant Jan 2017 Overview: The purpose of this lab session is
More information!"#$%&'()!*"+,-).!!/0#'1(2'01!3"'&"4051)6!7('&
!!!!""#$%&'("!)*+! Escalation rate 3% 3% 3% 3% 3% 3% 3% 3% 3% 0001 AA01 Administrative Assistant Level I HR $43.34 $44.64 $45.98 $47.36 $48.78 $50.24 $51.75 $53.30 $54.90 $56.55 0001 AA02 Administrative
More informationBIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM)
BIO 152 Principles of Biology III: Molecules & Cells Acquiring information from NCBI (PubMed/Bookshelf/OMIM) Note: This material is adapted from Web-based Bioinformatics Tutorials: Exploring Genomes by
More informationThe University of California, Santa Cruz (UCSC) Genome Browser
The University of California, Santa Cruz (UCSC) Genome Browser There are hundreds of available userselected tracks in categories such as mapping and sequencing, phenotype and disease associations, genes,
More informationChief Information Officer - Solutions and Partners (CIO-SP3) (Unrestricted) Request for Proposal (RFP) NIHJT ACS Federal Solutions LLC
0001 AA01 Administrative Assistant Level I HR $35.41 $36.33 $37.28 $38.24 $39.24 $40.26 $41.31 $42.38 $43.48 $44.61 0001 AA02 Administrative Assistant Level II HR $45.42 $46.60 $47.81 $49.06 $50.33 $51.64
More informationTUTORIAL. Revised in Apr 2015
TUTORIAL Revised in Apr 2015 Contents I. Overview II. Fly prioritizer Function prioritization III. Fly prioritizer Gene prioritization Gene Set Analysis IV. Human prioritizer Human disease prioritization
More informationVARIQ CV JV, LLC Contractor Site Hourly Rate. Page 1 of. Contract Year ITEM DESCRIPTION U/M
Escalation rate 2.5% 2.5% 2.5% 2.5% 2.5% 0001 AA01 Administrative Assistant Level I HR $46.72 $47.89 $49.09 $50.31 $51.57 $52.86 0001 AA02 Administrative Assistant Level II HR $63.71 $65.30 $66.94 $68.61
More informationVARIQ CV JV, LLC Government Site Hourly Rate. Page 1 of 5. Contract Year ITEM DESCRIPTION U/M
Escalation rate 2.5% 2.5% 2.5% 2.5% 2.5% 0002 AA01 Administrative Assistant Level I HR $41.71 $42.75 $43.82 $44.92 $46.04 $47.19 0002 AA02 Administrative Assistant Level II HR $56.88 $58.30 $59.76 $61.25
More informationSynectics CIOSP3 Small Business Hourly Rates (Government Site)
ITEM DESCRIPTION U/M Escalation rate 3% 3% 3% 3% 3% 3% 3% 3% 3% 0002 AA01 Administrative Assistant Level I HR $57.83 $59.56 $61.35 $63.19 $65.09 $67.04 $69.05 $71.12 $73.26 $75.46 0002 AA02 Administrative
More informationEvolutionary Genetics. LV Lecture with exercises 6KP
Evolutionary Genetics LV 25600-01 Lecture with exercises 6KP HS2017 >What_is_it? AATGATACGGCGACCACCGAGATCTACACNNNTC GTCGGCAGCGTC 2 NCBI MegaBlast search (09/14) 3 NCBI MegaBlast search (09/14) 4 Submitted
More informationStrategic Operational Solutions Inc. Contractor Site-Hourly Rate Page 1 of 10
Escalation rate 2.5% 2.5% 2.5% 2.5% 2.5% 0001 AA01 Administrative Assistant Level I HR $34.14 $35.00 $35.87 $36.77 $37.69 $38.63 0001 AA02 Administrative Assistant Level II HR $43.63 $44.72 $45.84 $46.98
More informationBIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP
Jasper Decuyper BIOINFORMATICS FOR DUMMIES MB&C2017 WORKSHOP MB&C2017 Workshop Bioinformatics for dummies 2 INTRODUCTION Imagine your workspace without the computers Both in research laboratories and in
More informationTypes of Databases - By Scope
Biological Databases Bioinformatics Workshop 2009 Chi-Cheng Lin, Ph.D. Department of Computer Science Winona State University clin@winona.edu Biological Databases Data Domains - By Scope - By Level of
More informationRELI GROUP, INC. Contractor Site Hourly Rate Page 1 of 10
Escalation rate 2% 2% 2% 2% 2% 0001 AA01 Administrative Assistant Level I HR $42.85 $43.71 $44.58 $45.47 $46.38 $47.31 0001 AA02 Administrative Assistant Level II HR $53.06 $54.12 $55.20 $56.31 $57.43
More informationDirectViz Solutions LLC Contractor Site-Hourly Rate Page 1 of 10
Escalation rate 2% 2% 2% 2% 2% 0001 AA01 Administrative Assistant Level I HR $38.69 $39.46 $40.25 $41.06 $41.88 $42.72 0001 AA02 Administrative Assistant Level II HR $53.42 $54.49 $55.58 $56.69 $57.82
More informationDV United Labor Categories and Rates - Government Site
DV United Labor Categories and Rates - Government Site Escalation rate 2.4% 2.4% 2.4% 2.4% 2.4% 2.4% 2.4% 2.4% 2.4% 0002 AA01 Administrative Assistant Level I HR $30.47 $31.20 $31.95 $32.72 $33.50 $34.31
More informationCLOUD NINE TECHNOLOGIES INC Government Site Hourly Rate Page 6 of 10
Escalation rate 3% 3% 3% 3% 3% 0002 AA01 Administrative Assistant Level I HR $40.63 $41.84 $43.10 $44.39 $45.72 $47.10 0002 AA02 Administrative Assistant Level II HR $47.13 $48.54 $49.99 $51.49 $53.04
More informationALL POINTS LOGISTICS, LLC Government Site Hourly Rate Page 6 of 10
Escalation rate 2% 2% 2% 2% 2% 0002 AA01 Administrative Assistant Level I HR $43.52 $44.39 $45.28 $46.18 $47.11 $48.05 0002 AA02 Administrative Assistant Level II HR $50.42 $51.43 $52.46 $53.51 $54.58
More informationENLIGHTENED, INC. Contractor Site Hourly Rate Page 1 of 10
Escalation rate 3% 3% 3% 3% 3% 0001 AA01 Administrative Assistant Level I HR $49.45 $50.93 $52.46 $54.04 $55.66 $57.33 0001 AA02 Administrative Assistant Level II HR $58.56 $60.32 $62.13 $63.99 $65.91
More informationThis software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part
This software/database/presentation is a "United States Government Work" under the terms of the United States Copyright Act. It was written as part of the author's official duties as a United States Government
More informationAMAR Health IT LLC_J 1 Government Site Hourly Rate Page 6 of 10
Escalation rate 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 0002 AA01 Administrative Assistant Level I HR $37.95 $39.05 $40.18 $41.35 $42.55 $43.78 $45.05 $46.36 $47.70 $49.09 0002 AA02 Administrative
More informationCLOUD NINE TECHNOLOGIES INC Contractor Site Hourly Rate Page 1 of 10
Escalation rate 3% 3% 3% 3% 3% 0001 AA01 Administrative Assistant Level I HR $43.27 $44.57 $45.90 $47.28 $48.70 $50.16 0001 AA02 Administrative Assistant Level II HR $50.19 $51.70 $53.25 $54.85 $56.49
More informationALL POINTS LOGISTICS, LLC Contractor Site Hourly Rate Page 1 of 10
Escalation rate 2% 2% 2% 2% 2% 0001 AA01 Administrative Assistant Level I HR $45.70 $46.61 $47.54 $48.49 $49.46 $50.45 0001 AA02 Administrative Assistant Level II HR $52.94 $54.00 $55.08 $56.18 $57.31
More informationAMAR Health IT LLC_J 1 Contractor Site Hourly Rate Page 1 of 10
Escalation rate 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 2.90% 0001 AA01 Administrative Assistant Level I HR $40.69 $41.87 $43.08 $44.33 $45.62 $46.94 $48.30 $49.70 $51.15 $52.63 0001 AA02 Administrative
More informationRIGHTDIRECTION TECHNOLOGY SOLUTIONS, LLC - Contractor Site-Hourly Rate Page 1 of 10
Escalation rate 2.50% 2.50% 2.50% 2.50% 2.50% 0001 AA01 Administrative Assistant Level I HR $46.03 $47.18 $48.36 $49.56 $50.80 $52.07 0001 AA02 Administrative Assistant Level II HR $53.90 $55.25 $56.63
More informationAttachment J-1: Government Site Hourly Rates - CIO-SP3 SB (Restricted)
Government Site Hourly Rates CIOSP3 SB (Small Business Category) : July 15, 2012 July 14, 2022 Attachment J1: Government Site Hourly Rates CIOSP3 SB (Restricted) 0002 AA01 Administrative Assistant Level
More informationComputational Biology and Bioinformatics
Computational Biology and Bioinformatics Computational biology Development of algorithms to solve problems in biology Bioinformatics Application of computational biology to the analysis and management
More informationWhy Use BLAST? David Form - August 15,
Wolbachia Workshop 2017 Bioinformatics BLAST Basic Local Alignment Search Tool Finding Model Organisms for Study of Disease Can yeast be used as a model organism to study cystic fibrosis? BLAST Why Use
More informationHands-On Four Investigating Inherited Diseases
Hands-On Four Investigating Inherited Diseases The purpose of these exercises is to introduce bioinformatics databases and tools. We investigate an important human gene and see how mutations give rise
More informationCAP 5510: Introduction to Bioinformatics CGS 5166: Bioinformatics Tools
CAP 5510: Introduction to Bioinformatics : Bioinformatics Tools ECS 254A / EC 2474; Phone x3748; Email: giri@cis.fiu.edu My Homepage: http://www.cs.fiu.edu/~giri http://www.cs.fiu.edu/~giri/teach/bioinfs15.html
More informationSynectics CIOSP3 Small Business Hourly Rates (Contractor Site)
Synectics CIOSP3 Small Business Hourly Rates (Contractor Site) ITEM DESCRIPTION U/M Escalation rate 3% 3% 3% 3% 3% 3% 3% 3% 3% 0002 AA01 Administrative Assistant Level I HR $57.83 $59.56 $61.35 $63.19
More informationSupplementary Figure 1. Design of the control microarray. a, Genomic DNA from the
Supplementary Information Supplementary Figures Supplementary Figure 1. Design of the control microarray. a, Genomic DNA from the strain M8 of S. ruber and a fosmid containing the S. ruber M8 virus M8CR4
More informationAnalyzing an individual sequence in the Sequence Editor
BioNumerics Tutorial: Analyzing an individual sequence in the Sequence Editor 1 Aim The Sequence editor window is a convenient tool implemented in BioNumerics to edit and analyze nucleotide and amino acid
More informationNature Methods: doi: /nmeth.4396
Supplementary Figure 1 Comparison of technical replicate consistency between and across the standard ATAC-seq method, DNase-seq, and Omni-ATAC. (a) Heatmap-based representation of ATAC-seq quality control
More informationBiology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
More informationWeek 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers
Week 1 BCHM 6280 Tutorial: Gene specific information using NCBI, Ensembl and genome viewers Web resources: NCBI database: http://www.ncbi.nlm.nih.gov/ Ensembl database: http://useast.ensembl.org/index.html
More informationGenome Resources. Genome Resources. Maj Gen (R) Suhaib Ahmed, HI (M)
Maj Gen (R) Suhaib Ahmed, I (M) The human genome comprises DNA sequences mostly contained in the nucleus. A small portion is also present in the mitochondria. The nuclear DNA is present in chromosomes.
More informationFast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing:
Fast, Accurate and Sensitive DNA Variant Detection from Sanger Sequencing: Patented, Anti-Correlation Technology Provides 99.5% Accuracy & Sensitivity to 5% Variant Knowledge Base and External Annotation
More informationIntegration of data management and analysis for genome research
Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa
More informationAntigen 43 Primer Design
Antigen 43 Primer Design 7-29-2010 Background We want to amplify the flu operon off of the E. coli K12 chromosome using PCR in order to make the cell surface of E. coli and other Pseudomonas species frizzy.
More informationContractor Site Hourly Rates
Contractor Site Hourly Rates Escalation rate 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% 2.5% 0001 AA01 Administrative Assistant Level I HR $43.83 $44.93 $46.05 $47.20 $48.38 $49.59 $50.83 $52.10 $53.40 $54.74
More informationFUNCTIONAL BIOINFORMATICS
Molecular Biology-2018 1 FUNCTIONAL BIOINFORMATICS PREDICTING THE FUNCTION OF AN UNKNOWN PROTEIN Suppose you have found the amino acid sequence of an unknown protein and wish to find its potential function.
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationBioinformatics for Proteomics. Ann Loraine
Bioinformatics for Proteomics Ann Loraine aloraine@uab.edu What is bioinformatics? The science of collecting, processing, organizing, storing, analyzing, and mining biological information, especially data
More informationBacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
More informationuser s guide Question 1
Question 1 How does one find a gene of interest and determine that gene s structure? Once the gene has been located on the map, how does one easily examine other genes in that same region? doi:10.1038/ng966
More informationuser s guide Question 3
Question 3 During a positional cloning project aimed at finding a human disease gene, linkage data have been obtained suggesting that the gene of interest lies between two sequence-tagged site markers.
More informationSupplementary Information
Supplementary Information MicroRNA-212/132 family is required for epithelial stromal interactions necessary for mouse mammary gland development Ahmet Ucar, Vida Vafaizadeh, Hubertus Jarry, Jan Fiedler,
More informationNiemann-Pick Type C Disease Gene Variation Database ( )
NPC-db (vs. 1.1) User Manual An introduction to the Niemann-Pick Type C Disease Gene Variation Database ( http://npc.fzk.de ) curated 2007/2008 by Dirk Dolle and Heiko Runz, Institute of Human Genetics,
More informationDatabases NCBI - ENTREZ
Databases NCBI - ENTREZ Data & Software Resources BLAST CDD COG GENSAT GenBank Whole Genome Shotgun Sequences Gene Gene Expression Nervous System Atlas (GENSAT) Gene Expression Omnibus (GEO) Profiles
More informationIdentifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M.
Identifying Genes and Pseudogenes in a Chimpanzee Sequence Adapted from Chimp BAC analysis: TWINSCAN and UCSC Browser by Dr. M. Brent Prerequisites: A Simple Introduction to NCBI BLAST Resources: The GENSCAN
More informationMegaMan Human Transcriptome Library
MegaMan Human Transcriptome Library INSTRUCTION MANUAL Catalog #790000 MegaMan Human Transcriptome Library (20 reactions) #790001 MegaMan Human Transcriptome Library (100 reactions) Revision A.01 For In
More informationSequence Analysis Lab Protocol
Sequence Analysis Lab Protocol You will need this handout of instructions The sequence of your plasmid from the ABI The Accession number for Lambda DNA J02459 The Accession number for puc 18 is L09136
More informationCollecTF Documentation
CollecTF Documentation Release 1.0.0 Sefa Kilic August 15, 2016 Contents 1 Curation submission guide 3 1.1 Data.................................................... 3 1.2 Before you start.............................................
More information(Candidate Gene Selection Protocol for Pig cdna Chip Manufacture Using TIGR Gene Indices)
(Candidate Gene Selection Protocol for Pig Chip Manufacture Using TIGR Gene Indices) Chip Chip Chip Red Hat Linux 80 MySQL Perl Script TIGR(The Institute for Genome Research http://wwwtigrorg) SsGI (Sus
More informationInvestigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures
Investigation of Genomic Variation in the Rising Era of Individual Genome Sequence: A Primer on Some Available Datasets and Structures September 28, 2015 A 10,000 Foot View Genomics Data at NCBI Organizational
More informationExercise I, Sequence Analysis
Exercise I, Sequence Analysis atgcacttgagcagggaagaaatccacaaggactcaccagtctcctggtctgcagagaagacagaatcaacatgagcacagcaggaaaa gtaatcaaatgcaaagcagctgtgctatgggagttaaagaaacccttttccattgaggaggtggaggttgcacctcctaaggcccatgaagt
More informationBiotechnology Explorer
Biotechnology Explorer C. elegans Behavior Kit Bioinformatics Supplement explorer.bio-rad.com Catalog #166-5120EDU This kit contains temperature-sensitive reagents. Open immediately and see individual
More informationNUCLEIC ACIDS. DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides.
NUCLEIC ACIDS DNA (Deoxyribonucleic Acid) and RNA (Ribonucleic Acid): information storage molecules made up of nucleotides. Base Adenine Guanine Cytosine Uracil Thymine Abbreviation A G C U T DNA RNA 2
More informationCOMPUTER RESOURCES II:
COMPUTER RESOURCES II: Using the computer to analyze data, using the internet, and accessing online databases Bio 210, Fall 2006 Linda S. Huang, Ph.D. University of Massachusetts Boston In the first computer
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools News About NCBI Site Map
More informationBrain Transcriptome Database (BrainTx) User s guide
www.cdtdb.neuroinf.jp Brain Transcriptome Database (BrainTx) (formerly CDT-DB) User s guide 1. About BrainTx project p. 2 2. BrainTx search p. 3 3. Database search results p. 7 4. Gene information and
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationsupplementary information
Figure S1 ZEB1 full length mrna. (a) Analysis of the ZEB1 mrna using the UCSC genome browser (http://genome.ucsc.edu) revealed truncation of the annotated Refseq sequence (NM_030751). The probable terminus
More informationOsMYC2, an essential factor for JA-inductive sakuranetin production in rice,
Supplementary information OsMYC2, an essential factor for JA-inductive sakuranetin production in rice, interacts with MYC2-like proteins that enhance its transactivation ability Satoshi Ogawa 1, Koji Miyamoto
More information