Bioinformatics for High Throughput Sequencing
|
|
- Godfrey Banks
- 6 years ago
- Views:
Transcription
1 Bioinformatics for High Throughput Sequencing
2
3 Naiara Rodríguez-Ezpeleta Ana M. Aransay Editors Michael Hackenberg Bioinformatics for High Throughput Sequencing
4 Editors Naiara Rodríguez-Ezpeleta Genome Analysis Platform CIC biogune Derio, Bizkaia, Spain Ana M. Aransay Genome Analysis Platform CIC biogune Derio, Bizkaia, Spain Michael Hackenberg Computational Genomics and Bioinformatics Group Genetics Department & Biomedical Research Center (CIBM) University of Granada, Spain ISBN e-isbn DOI / Springer New York Dordrecht Heidelberg London Library of Congress Control Number: Springer Science+Business Media, LLC 2012 All rights reserved. This work may not be translated or copied in whole or in part without the written permission of the publisher (Springer Science+Business Media, LLC, 233 Spring Street, New York, NY 10013, USA), except for brief excerpts in connection with reviews or scholarly analysis. Use in connection with any form of information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed is forbidden. The use in this publication of trade names, trademarks, service marks, and similar terms, even if they are not identified as such, is not to be taken as an expression of opinion as to whether or not they are subject to proprietary rights. Printed on acid-free paper Springer is part of Springer Science+Business Media (
5 Preface The purpose of this book is to collect in a single volume the essentials of high throughput sequencing data analysis. These new technologies allow performing, at an unprecedented low cost and high speed, a panoply of experiments spanning the sequencing of whole genomes or transcriptomes, the profiling of DNA methylation, and the detection of protein DNA interaction sites, among others. In each experiment a massive amount of sequence information is generated, making data analysis the major challenge in high throughput sequencing-based projects. Hundreds of bioinformatics applications have been developed so far, most of them focusing on specific tasks. Indeed, numerous approaches have been proposed for each analysis step, while integrated analysis applications and protocols are generally missing. As a result, even experienced bioinformaticians struggle when they have to discern among countless possibilities to analyze their data. This, together with a lack of enough qualified personnel, reveals an urgent need to train bioinformaticians in existing approaches and to develop integrated, from start to end software applications to face present and future challenges in data analysis. Given this scenario, our motivation was to assemble a book covering the aforementioned aspects. Following three fundamental introductory chapters, the core of the book focuses on the bioinformatics aspects, presenting a comprehensive review of the methods and programs existing to analyze the raw data obtained from each experiment type. In addition, the book is meant to provide insight into challenges and opportunities faced by both, biologists and bioinformaticians, during this new era of sequencing data analysis. Given the vast range of high throughput sequencing applications, we set out to edit a book suitable for readers from different research areas, academic backgrounds and degrees of acquaintance with this new technology. At the same time, we expect the book to be equally useful to researchers involved in the different steps of a high throughput sequencing project. The newbies eager to learn the basics of high throughput sequencing technologies and data analysis will find what they yearn for specially by reading the first introductory chapters, but also by obviating the details and getting the rudiments of the v
6 vi Preface core chapters. On the other hand, biologists that are familiar with the fundamentals of the technology and analysis steps, but that have little bioinformatic training will find in the core chapters an invaluable resource where to learn about the different existing approaches, file formats, software, parameters, etc. for data analysis. The book will also be useful to those scientists performing downstream analyses on the output of high throughput sequencing data, as a perfect understanding of how their initial data was generated is crucial for an accurate interpretation of further outcomes. Additionally, we expect the book to be appealing to computer scientists or biologists with a strong bioinformatics background, who will hopefully find in the problematic issues and challenges raised in each chapter motivation and inspiration for the improvement of existing and the development of new tools for high throughput data analysis. Naiara Rodríguez-Ezpeleta Michael Hackenberg Ana M. Aransay
7 Contents 1 Introduction... 1 Naiara Rodríguez-Ezpeleta and Ana M. Aransay 2 Overview of Sequencing Technology Platforms Samuel Myllykangas, Jason Buenrostro, and Hanlee P. Ji 3 Applications of High-Throughput Sequencing Rodrigo Goya, Irmtraud M. Meyer, and Marco A. Marra 4 Computational Infrastructure and Basic Data Analysis for High-Throughput Sequencing David Sexton 5 Base-Calling for Bioinformaticians Mona A. Sheikh and Yaniv Erlich 6 De Novo Short-Read Assembly Douglas W. Bryant Jr. and Todd C. Mockler 7 Short-Read Mapping Paolo Ribeca 8 DNA Protein Interaction Analysis (ChIP-Seq) Geetu Tuteja 9 Generation and Analysis of Genome-Wide DNA Methylation Maps Martin Kerick, Axel Fischer, and Michal-Ruth Schweiger 10 Differential Expression for RNA Sequencing (RNA-Seq) Data: Mapping, Summarization, Statistical Analysis, and Experimental Design Matthew D. Young, Davis J. McCarthy, Matthew J. Wakefield, Gordon K. Smyth, Alicia Oshlack, and Mark D. Robinson vii
8 viii Contents 11 MicroRNA Expression Profiling and Discovery Michael Hackenberg 12 Dissecting Splicing Regulatory Network by Integrative Analysis of CLIP-Seq Data Michael Q. Zhang 13 Analysis of Metagenomics Data Elizabeth M. Glass and Folker Meyer 14 High-Throughput Sequencing Data Analysis Software: Current State and Future Developments Konrad Paszkiewicz and David J. Studholme Index
9 Contributors Ana M. Aransay Genome Analysis Platform, CIC biogune, Parque Tecnológico de Bizkaia, Derio, Spain Douglas W. Bryant, Jr. Department of Botany and Plant Pathology, Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR, USA Department of Electrical Engineering and Computer Science, Oregon State University, Corvallis, OR, USA Jason Buenrostro Division of Oncology, Department of Medicine, Stanford Genome Technology Center, Stanford University School of Medicine, Stanford, CA, USA Yaniv Erlich Whitehead Institute for Biomedical Research, Cambridge, MA, USA Axel Fischer Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany Elizabeth M. Glass Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, IL, USA Computation Institute, The University of Chicago, Chicago, IL, USA Rodrigo Goya Canada s Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, Canada Centre for High-Throughput Biology, University of British Columbia, Vancouver, BC, Canada Department of Computer Science, University of British Columbia, Vancouver, BC, Canada Michael Hackenberg Computational Genomics and Bioinformatics Group, Genetics Department, University of Granada, Granada, Spain ix
10 x Contributors Hanlee P. Ji Division of Oncology, Department of Medicine, Stanford Genome Technology Center,, Stanford University School of Medicine, Stanford, CA, USA Martin Kerick Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany Marco A. Marra Canada s Michael Smith Genome Sciences Centre, BC Cancer Agency, Vancouver, BC, Canada Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada Davis J. McCarthy Bioinformatics Division, Walter and Eliza Hall Institute, Folker Meyer Mathematics and Computer Science Division, Argonne National Laboratory, Argonne, IL, USA Computation Institute, The University of Chicago, Chicago, IL, USA Institute for Genomics and Systems Biology, The University of Chicago, Chicago, IL, USA Irmtraud M. Meyer Centre for High-Throughput Biology, University of British Columbia, Vancouver, BC, Canada Department of Computer Science, University of British Columbia, Vancouver, BC, Canada Department of Medical Genetics, University of British Columbia, Vancouver, BC, Canada Todd C. Mockler Department of Botany and Plant Pathology, Center for Genome Research and Biocomputing, Oregon State University, Corvallis, OR, USA Samuel Myllykangas Division of Oncology, Department of Medicine, Stanford Genome Technology Center, Stanford University School of Medicine, Stanford, CA, USA Alicia Oshlack Bioinformatics Division, Walter and Eliza Hall Institute, School of Physics, University of Melbourne, Murdoch Childrens Research Institute, Parkville, Australia Konrad Paszkiewicz School of Biosciences, University of Exeter, Exeter, UK Paolo Ribeca Centro Nacional de Análisis Genómico, Baldiri Reixac 4, Barcelona, Spain
11 Contributors xi Mark D. Robinson Bioinformatics Division, Walter and Eliza Hall Institute, Department of Medical Biology, University of Melbourne, Epigenetics Laboratory, Cancer Research Program, Garvan Institute of Medical Research, Darlinghurst, NSW, Australia Naiara Rodríguez-Ezpeleta Genome Analysis Platform, CIC biogune, Parque Tecnológico de Bizkaia, Derio, Spain Michal-Ruth Schweiger Cancer Genomics Group, Department of Vertebrate Genomics, Max Planck Institute for Molecular Genetics, Berlin, Germany David Sexton Center for Human Genetics Research, Vanderbilt University, Nashville, TN, USA Mona A. Sheikh Whitehead Institute for Biomedical Research, Cambridge, MA, USA Gordon K. Smyth Bioinformatics Division, Walter and Eliza Hall Institute, Department of Mathematics and Statistics, University of Melbourne, David J. Studholme School of Biosciences, University of Exeter, Exeter, UK Geetu Tuteja Department of Developmental Biology, Stanford University, Stanford, CA, USA Matthew J. Wakefield Bioinformatics Division, Walter and Eliza Hall Institute, Department of Zoology, University of Melbourne, Matthew D. Young Bioinformatics Division, Walter and Eliza Hall Institute, Michael Q. Zhang Department of Molecular and Cell Biology, Center for Systems Biology, The University of Texas at Dallas, Richardson, TX, USA Bioinformatics Division, TNLIST, Tsinghua University, Beijing, China
12 wwwwwwwwwww
Bioinformatics for High Throughput Sequencing
Bioinformatics for High Throughput Sequencing Naiara Rodríguez-Ezpeleta Ana M. Aransay Editors Michael Hackenberg Bioinformatics for High Throughput Sequencing Editors Naiara Rodríguez-Ezpeleta Genome
More informationMicroarrays in Diagnostics and Biomarker Development
Microarrays in Diagnostics and Biomarker Development . Editor Microarrays in Diagnostics and Biomarker Development Current and Future Applications Editor CoReBio PACA Luminy Science Park 13288 Marseille
More informationThe Genetics of Obesity
The Genetics of Obesity Struan F.A. Grant Editor The Genetics of Obesity Editor Struan F.A. Grant Children s Hospital of Philadelphia Research Institute Philadelphia, PA, USA ISBN 978-1-4614-8641-1 ISBN
More informationMarine Bioactive Compounds
Marine Bioactive Compounds Maria Hayes Editor Marine Bioactive Compounds Sources, Characterization and Applications Editor Maria Hayes Food BioSciences Department Teagasc Food Research Centre Ashtown,
More informationE E. International Series in Operations Research & Management Science. Series Editor: Fredrick S. Hillier Stanford University
E E International Series in Operations Research & Management Science Series Editor: Fredrick S. Hillier Stanford University Special Editorial Consultant: Camille C. Price Stephen F. Austin State University
More informationOperations Research/Computer Science Interfaces Series
Operations Research/Computer Science Interfaces Series Volume 50 Series Editors: Ramesh Sharda Oklahoma State University, Stillwater, Oklahoma, USA Stefan Voß University of Hamburg, Hamburg, Germany For
More informationInfectious Disease. Vassil St. Georgiev. For further volumes:
Infectious Disease Vassil St. Georgiev For further volumes: http://www.springer.com/series/7646 John B. Cliff Helen W. Kreuzer Christopher J. Ehrhardt David S. Wunschel Editors Chemical and Physical Signatures
More informationADVANCED MEDIA PLANNING
ADVANCED MEDIA PLANNING ADVANCED MEDIA PLANNING by JOHN R. ROSSITER Australian Graduate School of Management and PETER J. DANAHER University of Auckland, New Zealand " ~ SPRINGER SCIENCE+BUSINESS MEDIA,
More informationExercises in Environmental Physics
Exercises in Environmental Physics Valerio Faraoni Exercises in Environmental Physics Valerio Faraoni Physics Department Bishop s University Lennoxville, Quebec J1M 1Z7 Canada vfaraoni@cs-linux.ubishops.ca
More informationLecture Notes in Energy 5
Lecture Notes in Energy 5 For further volumes: http://www.springer.com/series/8874 . Hortensia Amaris Monica Alonso Carlos Alvarez Ortega Reactive Power Management of Power Networks with Wind Generation
More informationA Computer Scientist s Guide to Cell Biology
A Computer Scientist s Guide to Cell Biology A Computer Scientist s Guide to Cell Biology A Travelogue from a Stranger in a Strange Land William W. Cohen Machine Learning Department Carnegie Mellon University
More informationGenetic and Molecular Epidemiology of Multiple Myeloma
Genetic and Molecular Epidemiology of Multiple Myeloma Suzanne Lentzsch Editor Genetic and Molecular Epidemiology of Multiple Myeloma Editor Suzanne Lentzsch College of Physicians and Surgeons Multiple
More informationInternational Series in Operations Research & Management Science
International Series in Operations Research & Management Science Volume 143 Series Editor: Frederick S. Hillier Stanford University For further volumes: http://www.springer.com/series/6161 T.C. Edwin
More informationFrom reads to results: differential. Alicia Oshlack Head of Bioinformatics
From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts
More informationSimulation Strategies to Reduce Recidivism
Simulation Strategies to Reduce Recidivism Faye S. Taxman April Pattavina Editors Simulation Strategies to Reduce Recidivism Risk Need Responsivity (RNR) Modeling for the Criminal Justice System Editors
More informationPrinciples of Food Sanitation. Fifth Edition
Principles of Food Sanitation Fifth Edition Principles of Food Sanitation Fifth Edition Norman G. Marriott, PhD Extension Food Scientist and Professor Emeritus Department of Food Science and Technology
More informationField Guidelines for Genetic Experimental Designs in High-Throughput Sequencing
Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing Ana M. Aransay José Luis Lavín Trueba Editors Field Guidelines for Genetic Experimental Designs in High-Throughput Sequencing
More informationGenomic Elements in Health, Disease and Evolution
Genomic Elements in Health, Disease and Evolution Kyriacos Felekkis Konstantinos Voskarides Editors Genomic Elements in Health, Disease and Evolution Junk DNA Editors Kyriacos Felekkis Department of Life
More informationResearch & Management Science
EInternational E Series in Operations Research & Management Science Series Editor: Frederick S. Hillier Stanford University, CA, USA Special Editorial Consultant: Camille C. Price Stephen F. Austin State
More informationShabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti. United Arab Emirates Keys to Soil Taxonomy
Shabbir A. Shahid Mahmoud A. Abdelfattah Michael A. Wilson John A. Kelley Joseph V. Chiaretti United Arab Emirates Keys to Soil Taxonomy United Arab Emirates Keys to Soil Taxonomy Shabbir A. Shahid Mahmoud
More informationEnvironmental Radiation Effects on Mammals
Environmental Radiation Effects on Mammals Olga A. Smirnova Environmental Radiation Effects on Mammals A Dynamical Modeling Approach 123 Dr.OlgaA.Smirnova Research and Technical Center of Radiation-Chemical
More informationBiomaterials. Third Edition
Biomaterials Third Edition Joon Park R.S. Lakes Biomaterials An Introduction Third Edition Joon Park Biomedical and Mechanical Engineering University of Iowa Iowa City, IA 52242-1414 USA joon-park@uiowa.edu
More informationEthics for Biomedical Engineers
Ethics for Biomedical Engineers Jong Yong Abdiel Foo Stephen J. Wilson Andrew P. Bradley Winston Gwee Dennis Kwok-Wing Tam Ethics for Biomedical Engineers Jong Yong Abdiel Foo Electronic and Computer
More informationMachining of Polymer Composites
Machining of Polymer Composites Jamal Y. Sheikh-Ahmad Machining of Polymer Composites 123 Jamal Y. Sheikh-Ahmad The Petroleum Institute Department of Mechanical Engineering Abu Dhabi United Arab Emirates
More informationReliability of Microtechnology
Reliability of Microtechnology Johan Liu Olli Salmela Jussi Särkkä l l James E. Morris Per-Erik Tegehall l Cristina Andersson Reliability of Microtechnology Interconnects, Devices and Systems Johan Liu
More informationChapter 3: Assessing and Measuring Wetland Hydrology
Chapter 3: Assessing and Measuring Wetland Hydrology Donald O. Rosenberry and Masaki Hayashi This sample file is posted on the web site for preliminary viewing of contents. If you would like to have a
More informationPhilip Simpson. FPGA Design. Best Practices for Team-based Design
FPGA Design 5 Philip Simpson FPGA Design Best Practices for Team-based Design Philip Simpson Altera Corporation San Jose, CA 95134 USA Feilmidh@sbcglobal.net ISBN 978-1-4419-6338-3 e-isbn 978-1-4419-6339-0
More informationSpringerBriefs in Food, Health, and Nutrition Series
SpringerBriefs in Food, Health, and Nutrition Series Springer Briefs in Food, Health, and Nutrition present concise summaries of cutting edge research and practical applications across a wide range of
More informationLecture Notes in Earth System Sciences 144
Lecture Notes in Earth System Sciences 144 Editors: P. Blondel, Bath J. Reitner, G ottingen K. St uwe, Graz M.H. Trauth, Potsdam D. Yuen, Minneapolis Founding Editors: G. M. Friedman, Brooklyn and Troy
More informationBiomphalaria Snails and Larval Trematodes
Biomphalaria Snails and Larval Trematodes w Rafael Toledo Bernard Fried Editors Biomphalaria Snails and Larval Trematodes Editors Rafael Toledo Departamento de Biología Celular y Parasitología Facultad
More informationM ETHODS IN MOLECULAR BIOLOGY
M ETHODS IN MOLECULAR BIOLOGY Series Editor John M. Walker School of Life Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For further volumes: http://www.springer.com/series/7651
More informationresequencing storage SNP ncrna metagenomics private trio de novo exome ncrna RNA DNA bioinformatics RNA-seq comparative genomics
RNA Sequencing T TM variation genetics validation SNP ncrna metagenomics private trio de novo exome mendelian ChIP-seq RNA DNA bioinformatics custom target high-throughput resequencing storage ncrna comparative
More informationJinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang. Mercury Emission and its Control in Chinese Coal-Fired Power Plants
Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang Mercury Emission and its Control in Chinese Coal-Fired Power Plants Jinsong Zhou Zhongyang Luo Yanqun Zhu Mengxiang Fang Mercury Emission and its Control
More informationInformation and Organization Design Series
ORGANIZATION DESIGN Information and Organization Design Series series editors Richard M. Burton B0rge Obel ORGANIZATIONAL LEARNING: Creating, Retaining and Transferring Knowledge, by Linda Argote STRATEGIC
More informationStructure and Chemistry of Crystalline Solids
Structure and Chemistry of Crystalline Solids Bodie E. Douglas Shih-Ming Ho Structure and Chemistry of Crystalline Solids Bodie E. Douglas Shih-Ming Ho University of Pittsburgh Pittsburgh, PA USA Library
More informationRecombinant Enzymes From Basic Science to Commercialization
Recombinant Enzymes From Basic Science to Commercialization Azura Amid Editor Recombinant Enzymes From Basic Science to Commercialization 1 3 Editor Azura Amid Department of Biotechnology Engineering Kulliyyah
More informationMaterials Research and Engineering Edited by B. Ilschner and N.J. Grant
Materials Research and Engineering Edited by B. Ilschner and N.J. Grant Julian Szekely Goran Carlsson Lars Helle Ladle Metallurgy With 137 Figures and 24 Tables Springer-Verlag New York Berlin Heidelberg
More informationMicrosystems for Pharmatechnology
Microsystems for Pharmatechnology Andreas Dietzel Editor Microsystems for Pharmatechnology Manipulation of Fluids, Particles, Droplets, and Cells Editor Andreas Dietzel Institute of Microtechnology Technische
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationESSENTIAL BIOINFORMATICS
ESSENTIAL BIOINFORMATICS Essential Bioinformatics is a concise yet comprehensive textbook of bioinformatics that provides a broad introduction to the entire field. Written specifically for a life science
More informationMANAGING IN THE INFORMATION ECONOMY. Current Research Issues
MANAGING IN THE INFORMATION ECONOMY Current Research Issues MANAGING IN THE INFORMATION ECONOMY Current Research Issues Edited by Uday Apte And Uday Karmarkar Uday Apte Naval Postgraduate School Monterey,
More informationAgile Project Management: Managing for Success
Agile Project Management: Managing for Success James A. Crowder Shelli Friess Agile Project Management: Managing for Success James A. Crowder Raytheon Denver, CO, USA Shelli Friess Englewood, CO, USA
More informationOPTIMIZATION IN PUBLIC TRANSPORTATION. Stop Location, Delay Management and Tariff Zone Design in a Public Transportation Network
OPTIMIZATION IN PUBLIC TRANSPORTATION Stop Location, Delay Management and Tariff Zone Design in a Public Transportation Network Optimization and Its Applications VOLUME 3 Managing Editor Panos M. Pardalos
More informationStem Cell Biology and Regenerative Medicine
Stem Cell Biology and Regenerative Medicine Series Editor Kursad Turksen, Ph.D. kturksen@ohri.ca For other titles published in this series, go to http://www.springer.com/series/7896 Donald G. Phinney Editor
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics Richard Corbett Canada s Michael Smith Genome Sciences Centre Vancouver, British Columbia June 28, 2017 Our mandate is to advance knowledge about cancer and other diseases
More informationManaging e-business Projects
Managing e-business Projects Springer-Verlag Berlin Heidelberg GmbH Thomas Stoehr Managing e-business Projects 99 Key Success Factors With 37 Figures and 12 Tables Springer Thomas Stoehr Overbeckstr. 7
More informationQuickstart Molecular Biology
Quickstart Molecular Biology An Introduction for Mathematicians, Physicists, and Computational Scientists ALSO FROM COLD SPRING HARBOR LABORATORY PRESS A Genetic Switch, Third Edition, Phage Lambda Revisited
More informationEngineering Genetic Circuits
Engineering Genetic Circuits I use the book and slides of Chris J. Myers Lecture 0: Preface Chris J. Myers (Lecture 0: Preface) Engineering Genetic Circuits 1 / 19 Samuel Florman Engineering is the art
More informationLecture Notes in Management and Industrial Engineering
Lecture Notes in Management and Industrial Engineering Volume 1 Series Editor: Adolfo López-Paredes Valladolid, Spain This bookseries provides a means for the dissemination of current theoretical and applied
More informationNanotechnology Enabled In situ Sensors for Monitoring Health
Nanotechnology Enabled In situ Sensors for Monitoring Health Thomas J. Webster Editor Nanotechnology Enabled In situ Sensors for Monitoring Health Editor Thomas J. Webster School of Engineering Brown
More informationM e t h o d s in Molecular Biology
M e t h o d s in Molecular Biology Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, AL10 9AB, UK For further volumes: http://www.springer.com/series/7651
More informationDIRECT -CONTACT HEAT TRANSFER
DIRECT -CONTACT HEAT TRANSFER DIRECT -CONTACT HEAT TRANSFER Edited by Frank Kreith Solar Energy Research Institute Golden, Colorado and University of Colorado, Boulder R. F. Boehm University of Utah Salt
More informationEnergy-Efficient HVAC Design
Energy-Efficient HVAC Design Javad Khazaii Energy-Efficient HVAC Design An Essential Guide for Sustainable Building Javad Khazaii Engineering Department Southern Polytechnic State University Marietta,
More informationAdvances in Soil Science
Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal C.W. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B.Yaron Advances in Soil Science Volume 19 Limitations
More informationThe Search for Human Chromosomes
The Search for Human Chromosomes ThiS is a FM Blank Page Wilson John Wall The Search for Human Chromosomes A History of Discovery Wilson John Wall Bewdley United Kingdom ISBN 978-3-319-26334-2 ISBN 978-3-319-26336-6
More informationAdvances in Soil Science
Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal CW. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B. Yaron Advances in Soil Science Volume 10 Edited
More informationManagement of Network Organizations
Management of Network Organizations ThiS is a FM Blank Page Włodzimierz Sroka Štefan Hittmár Editors Management of Network Organizations Theoretical Problems and the Dilemmas in Practice Editors Włodzimierz
More informationA. McDermott R. H. Burdon A. E. Smith C. Jones P. Cohen R. Denton, C. I. Pogson D. M. Moore L. M. Cook H. H. Rees
LIST OF TITLES Already published Cell Differentiation Functions of Biological Membranes Cellular Development Brain Biochemistry Immunochemistry The Selectivity of Drugs Biomechanics Molecular Virology
More informationAAPS Advances in the Pharmaceutical Sciences Series
AAPS Advances in the Pharmaceutical Sciences Series Volume 20 Series Editors Daan J. A. Crommelin Utrecht University, Utrecht, The Netherlands Robert A. Lipper Back Cove Pharma, LLC, Waldoboro, Maine,
More informationManagement for Professionals
Management for Professionals For further volumes: http://www.springer.com/series/10101 ThiS is a FM Blank Page Erik Jannesson Fredrik Nilsson Birger Rapp Editors Strategy, Control and Competitive Advantage
More informationTREE CODE PRODUCT BROCHURE
TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for
More informationIntroduction to Bioinformatics
Introduction to Bioinformatics If the 19 th century was the century of chemistry and 20 th century was the century of physic, the 21 st century promises to be the century of biology...professor Dr. Satoru
More informationIntegrated Pest Management
Integrated Pest Management Integrated Pest Management Edited by J. Lawrence Apple North Carolina State University at Raleigh and Ray F. Smith University of California at Berkeley PLENUM PRESS. NEW YORK
More informationLeading Pharmaceutical Operational Excellence
Leading Pharmaceutical Operational Excellence ThiS is a FM Blank Page Thomas Friedli Prabir Basu Daniel Bellm Jürgen Werani Editors Leading Pharmaceutical Operational Excellence Outstanding Practices and
More informationManagement for Professionals
Management for Professionals For further volumes: http://www.springer.com/series/10101 ThiS is a FM Blank Page Akram Al Ariss Editor Global Talent Management Challenges, Strategies, and Opportunities Editor
More informationStructural Design Guide to the
Structural Design Guide to the Building Code Structural Design Guide to the Building: Code Edward S. Hoffman President Edward S. Hoffman, Ltd., Chicago, IL David P. Gustafson Vice President of Engineering
More informationNested Partitions Method, Theory and Applications
Nested Partitions Method, Theory and Applications Recent titles in the INTERNATIONAL SERIES IN OPERATIONS RESEARCH & MANAGEMENT SCIENCE Frederick S. Hillier, Series Editor, Stanford University Gass & Assad/
More informationTree and Forest Measurement
Tree and Forest Measurement P.W. West Tree and Forest Measurement 2 nd Edition With 33 Figures and 11 Tables P.W. West School of Environmental Science and Management Southern Cross University Lismore,
More informationLee-Jun C. Wong Editor. Next Generation Sequencing. Translation to Clinical Diagnostics
Lee-Jun C. Wong Editor Next Generation Sequencing Translation to Clinical Diagnostics Next Generation Sequencing Lee-Jun C. Wong Editor Next Generation Sequencing Translation to Clinical Diagnostics Editor
More informationDNA. bioinformatics. epigenetics methylation structural variation. custom. assembly. gene. tumor-normal. mendelian. BS-seq. prediction.
Epigenomics T TM activation SNP target ncrna validation metagenomics genetics private RRBS-seq de novo trio RIP-seq exome mendelian comparative genomics DNA NGS ChIP-seq bioinformatics assembly tumor-normal
More informationRESEARCH AREA NEUROSCIENCE
RESEARCH AREA NEUROSCIENCE coordinator MATHEW E. DIAMOND area committee Alessandro Treves Raffaella Rumiati Giuseppe Legname Andrea Nistri Dario Olivieri A variety of research groups are active in Neuroscience.
More informationHandbook of Media Branding
Handbook of Media Branding ThiS is a FM Blank Page Gabriele Siegert Kati F orster Sylvia M. Chan-Olmsted Mart Ots Editors Handbook of Media Branding Editors Gabriele Siegert University of Zurich IPMZ Institute
More informationDesign and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems
Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems Younghyun Kim Naehyuck Chang Design and Management of Energy-Efficient Hybrid Electrical Energy Storage Systems 123 Younghyun
More informationNext-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
More informationSpringerBriefs in Microbiology
SpringerBriefs in Microbiology For further volumes: http://www.springer.com/series/8911 Naowarat Cheeptham Editor Cave Microbiomes: A Novel Resource for Drug Discovery Editor Naowarat Cheeptham Thompson
More informationEnvironmental Sustainability Issues in the South Texas Mexico Border Region
Environmental Sustainability Issues in the South Texas Mexico Border Region David Ramirez Jianhong Ren Kim D. Jones Harriet Lamm Editors Environmental Sustainability Issues in the South Texas Mexico Border
More informationADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY BACHELOR OF SCIENCE (Honours) SEMESTER - I
NEW CHOICE BASED CREDIT SYSTEM (TOTAL CREDIT = 22+22+28+28+26+26 = 152) Type of the Paper Paper Code ADAMAS UNIVERSITY FACULTY OF SCIENCE - DEPARTMENT OF BIOTECHNOLOGY SEMESTER - I / Brief Contents I BT1201
More informationDNA Microarray Technology and Data Analysis in Cancer Research Downloaded from
This page intentionally left blank Shaoguang Li University of Massachusetts Medical School, USA Dongguang Li Edith Cowan University, Australia World Scientific N E W J E R S E Y L O N D O N S I N G A P
More informationEnergy Systems. Series Editor: Panos M. Pardalos, University of Florida, USA. For further volumes:
Energy Systems Series Editor: Panos M. Pardalos, University of Florida, USA For further volumes: http://www.springer.com/series/8368 . Alexey Sorokin l Steffen Rebennack l Panos M. Pardalos l Niko A. Iliadis
More informationAdvances in Soil Science
Advances in Soil Science Advances in Soil Science B.A. Stewart, Editor Editorial Board R. Lal C.W. Rose U. Schwertmann B.A. Stewart P.B. Tinker R.J. Wagenet B.Yaron Advances in Soil Science Volume 17 Soil
More informationManagement of Permanent Change
Management of Permanent Change Horst Albach Heribert Meffert Andreas Pinkwart Ralf Reichwald Editors Management of Permanent Change Editors Horst Albach Center for Advanced Studies in Management HHL Leipzig
More informationPublic Administration, Governance and Globalization
Public Administration, Governance and Globalization Volume 16 Series Editor Ali Farazmand Florida Atlantic University Fort Lauderdale Florida USA Public Administration, Governance and Globalization Ali
More informationbioinformatica 6EF2F181AA1830ABC10ABAC56EA5E191 Bioinformatica 1 / 5
Bioinformatica 1 / 5 2 / 5 3 / 5 Bioinformatica Bioinformatics is the name given to these mathematical and computing approaches used to glean understanding of biological processes. Common activities in
More informationBasics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
More informationPharmaceutical Prices in the 21st Century
Pharmaceutical Prices in the 21st Century ThiS is a FM Blank Page Zaheer-Ud-Din Babar Editor Pharmaceutical Prices in the 21st Century Editor Zaheer-Ud-Din Babar Faculty of Medical and Health Sciences
More informationEntrepreneurial Marketing for SMEs
Entrepreneurial Marketing for SMEs This page intentionally left blank Entrepreneurial Marketing for SMEs Luca Cacciolatti University of Westminster, UK and Soo Hee Lee University of Kent, UK Luca Cacciolatti
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationThe GMO Handbook. Genetically Modified Animals, Microbes, and Plants in Biotechnology. Edited by. Sarad R. Parekh, PhD
The GMO Handbook The GMO Handbook Genetically Modified Animals, Microbes, and Plants in Biotechnology Edited by Sarad R. Parekh, PhD Dow AgroSciences, Indianapolis, IN * Springer Science+Business Media,
More informationSpringer New York Berlin Heidelberg Barcelona Budapest Hong Kong London Milan Paris Santa Clara Singapore Tokyo
Developmental Biology Springer New York Berlin Heidelberg Barcelona Budapest Hong Kong London Milan Paris Santa Clara Singapore Tokyo Werner A. Miiller Developmental Biology With 123 Figure Springer Werner
More informationComputational Challenges of Medical Genomics
Talk at the VSC User Workshop Neusiedl am See, 27 February 2012 [cbock@cemm.oeaw.ac.at] http://medical-epigenomics.org (lab) http://www.cemm.oeaw.ac.at (institute) Introducing myself to Vienna s scientific
More informationBiology 644: Bioinformatics
Processes Activation Repression Initiation Elongation.... Processes Splicing Editing Degradation Translation.... Transcription Translation DNA Regulators DNA-Binding Transcription Factors Chromatin Remodelers....
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationSOCIAL DIMENSIONS OF INFORMATION AND COMMUNICATION TECHNOLOGY POLICY
SOCIAL DIMENSIONS OF INFORMATION AND COMMUNICATION TECHNOLOGY POLICY IFIP The International Federation for Information Processing IFIP was founded in 1960 under the auspices of UNESCO, following the First
More informationBiotechnology Fifth edition
Biotechnology Fifth edition Biotechnology is the major technology of the twenty-first century yet few people realise how much it impacts on many aspects of human society. The defining aim of this new fifth
More informationNucleic Acids and Molecular Biology
Nucleic Acids and Molecular Biology 20 Series Editor H. J. Gross H. Ulrich Göringer (Ed.) RNA Editing Professor Dr. H. Ulrich Göringer Institute of Microbiology and Genetics Technical University Darmstadt
More informationMETHODS OF MICROARRAY DATA ANALYSIS III
METHODS OF MICROARRAY DATA ANALYSIS III METHODS OF MICROARRAY DATA ANALYSIS III Papers from CAMDA 02 edited by Kimberly F. Johnson Cancer Center Information Systems Duke University Medical Center Durham,
More informationMicrobial Metabolism Systems Microbiology
1 Microbial Metabolism Systems Microbiology Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Hall, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw MIT OCW Systems Microbiology aims to integrate basic biological
More informationEngineering Materials
Engineering Materials More information about this series at http://www.springer.com/series/4288 Emilio I. Alarcon May Griffith Klas I. Udekwu Editors Silver Nanoparticle Applications In the Fabrication
More informationSustainable Water Resources Planning and Management Under Climate Change
Sustainable Water Resources Planning and Management Under Climate Change Elpida Kolokytha Satoru Oishi Editors Sustainable Water Resources Planning and Management Under Climate Change 123 Editors Elpida
More information