Premium Oligonucleotide Synthesis
|
|
- Opal Norton
- 6 years ago
- Views:
Transcription
1 Premium Oigonuceotide Synthesis QUALITY CONSISTENCY CONFIDENCE Gene Link oigos are for demanding appications and consistent resuts. We beieve that investigators who vaue time and have no room for an experiment to fai due to oigo quaity shoud consider Gene Link. Our numerous quaity contro steps for each oigo assure confidence. GOLD STANDARD Actua Ge Photo An actua ge photo of each oigo is affixed on the oigo report. An absoute testimony of quaity. Gene Link has raised the standard since inception over a decade ago. We have the pictures to prove it! 1 Gene Link
2 Superior to Mass-Produced Factory Oigos Gene Link is not an oigo factory. Each oigo is synthesized, processed and quaity assured to Gene Link s absoute standards. This incudes couping efficiency monitoring of each base during synthesis and eectrophoretic anaysis of each oigo on a poyacryamide ge to visuay assess quaity. Couping Efficiency We maintain a couping efficiency threshod of greater than 99.5% for a oigos by using premium reagents of exacting specifications, membrane synthesis, state-of-the-art instruments and optimized software-driven protocos. This may not be evident when comparing short oigos, as PCR and sequencing reactions are very robust and can toerate up to 50% faiure/truncated sequence oigos. However, you are ceary taking a chance by using ong oigos synthesized at anything beow 99.5% couping efficiency. 100% Yied Yied Yied 100% 100% Couping Efficiency and Fu Length Oigo Yied Oigo Size 99.50% 99.00% 98.00% Oigo size Couping efficiency 99.50% Couping efficiency 99.00% Couping efficiency 98.00% 250 The Gene Link Advantage Stringent Quaity Contro Measures Speciaizing in Long Oigos up to 250 mer Trity Monitoring of A Oigos Poyacryamide Ge Photograph of Each Oigo A Modifications Avaiabe A Oigo Types Avaiabe Easy Onine Ordering System Onine Design and Anaysis Toos Knowedgeabe Technica Support Personaized, Friendy Customer Service Trity Monitoring A Gene Link DNA synthesizers are equipped with trity monitors for monitoring couping efficiency of each added base. The instruments are programmed to hat when it fas beow the threshod. See exampe of routine trity bars. Routine Trity Couping Efficiency GOLD STANDARD Sequence ength Actua trity couping efficiency of a 210 mer. Long Oigos Ask our competitors how often they synthesize 200 to 250 mer oigonuceotides. Gene Link speciaizes in ong oigos. You are invited to compare. Gene Link 2
3 Oigo Design and Anaysis Toos Gene Link has been eading the way by providing the most user friendy onine experience in oigo ordering. From oigo design and anaysis, to the convenient ordering system and the assurance of a secured transaction, Gene Link provides the most comprehensive web resource in the industry. Features incude convenient NCBI basting and secondary structure anaysis, simpe import toos for arge orders in spreadsheet or text fie format, and three eves of review and editing. Custom Oigo Ordering System Cassic ordering system with extensive anaysis features Timesaver muti oigo import from spreadsheet and text fies Abiity to hande mixed oigo types, purity and modifications in a singe order Seection of oigo type (DNA, RNA, Phosphorothioate, Chimeric, etc.) Simpe drop down menu seection for 5', interna or 3' modifications Anayze for oigo hairpin and oops Integrates with NCBI Bast for homoogy checks Fip 3' to 5' and reverse compement Onine Oigo Anaysis Simuate anneaing, oops and hairpin formations Cacuate MW, EC, T m, A 260, etc. Appications incude RNAi Exporer, a robust sirna search and design too, and a standaone Oigo Exporer appication for onine acquisition of sequences and oigo design. Save Session Too busy to order a of your oigos in one session? Gene Link s answer to the mutitasking researcher with endess interruptions is the Save Session feature. Enter as many oigos as you wish, cick the Save Session button and resume at your wi. Your oigos wi be saved. What s more, you' save money on shipping by consoidating your mutipe orders into one. 3 Gene Link
4 Custom Oigonuceotide Synthesis Mutipe Oigo NCBI Bast Cick to ascertain homoogies to other sequences. Perform NCBI Bast of mutipe sequences at once by using Gene Link s onine MutiBast appication. Import a the sequences using a spreadsheet or a text fie. A of your sequences wi be basted and resuts retrieved. Gene Link offers a very convenient approach to perform mutipe bast searches. Oigo Exporer A PC-based appication for standaone DNA sequence retrieva and oigo design. Oigo Exporer was deveoped to design PCR and sequencing primers. Oigo Exporer is an efficient easyto-use too to determine primer properties ike T m, GC%, primer oops and primer dimers. Oigo Exporer aso incudes a powerfu Primer Wizard too that heps you to find suitabe primer pairs. You can set your own parameters for the primer pair search engine or use the defaut parameters. Primer Wizard suggests primer pairs that ampify PCR products of the given ength. Individua primer pairs are suggested that theoreticay wi not form stabe primer dimers or primer oops. Moecuar Bioogy Convenience Appets Gene Link has numerous onine appets for quick cacuations. The BioCacuator is a series of appets for simpifying the routine aboratory cacuations. The foowing convenient cacuators are avaiabe: Oigo Resuspension Oigo Diution Oigo T m Reagent Diution Moarity Determination Ligation Base/Dye Ratio Gene Link 4
5 Oigo Specifications Report Gene Link s Custom Oigonuceotide Synthesis Report specifies each oigo name and sequence aong with its pertinent physica properties such as MW, %GC, T m, A 260 units, etc. Our report is aso unique in that we affix an actua poyacryamide ge eectrophoresis photograph onto each report, so that you aso may visuay attest to the quaity of our product. From your custom oigo to the presentation of our oigo synthesis report, not a step of quaity is overooked. You are invited to compare. Custom Oigo Specifications Gene Link custom oigonuceotides are suppied desated and yophiized. They are ready to use after appropriate reconstitution. Dry oigonuceotides are stabe at room temperature for an extended period of time. Storage & Reconstitution The oigonuceotide shoud preferaby be frozen upon receipt. TE buffer (10 mm Tris, 1 mm EDTA, ph 7.5) is recommended for dissoving the oigonuceotides. After reconstitution store the stock soution at 80 C or 20 C. Purity & Usage The crude, desated oigonuceotide suppied is suitabe for a ampification and sequencing protocos. Ge purification is advised for a oigos used for coning appications and for oigos onger than 50 mer. Biophysica Data Each oigo after desating is quantified by recording A 260. Exact nmos and µg are determined by the extinction coefficient and moecuar weight of the oigo. Ge Photo Documentation An actua ge picture of the synthesized custom oigonuceotide is suppied. A major singe band represents high purity of the crude oigonuceotide. 5 Gene Link
6 Custom Oigonuceotide Synthesis Oigo Scae of Synthesis and Typica Yied Crude Desated RPC Purified** Ge Purified 20 mer oigo* 30 mer oigo* 50 mer oigo* Typica yied Typica yied Typica yied Scae A 260 Units nmos mg A 260 Units nmos mg A 260 Units nmos mg 50 nmo NR* [1-2] NR* [2-4] NR* [ ] 200 nmo µmo Purity & Yied Purity is greater than 80% depending on oigo sequence and structure. Refer to couping efficiency tabe for oigo ength dependent purity and yied. No further purification required for PCR and sequencing appications. Ge purification recommended for oigos above 50 mer and a appications invoving coning and mutagenesis. Purity 85% to 95% depending on oigo sequence and structure. Yied and purity wi be ower for sequences with high GC content. Not recommended for oigos onger than 35 mer. **RPC is reverse phase purification using a cartridge; a substitute for HPLC. Purity 98% to ~100% depending on oigo sequence and structure. Yied wi graduay decrease as ength of oigo increases. Paindromes, hairpins and high GC content oigos and oigos containing stretches of 3 or more G s induces strong secondary structure and base stacking thus decreasing purity and yied. NR* Not Recommended *Yied of 30 µg/a 260 unit for oigos is cacuated for an ~equimoar base composition. Long stretches of a singe base or homopoymers wi have variabe yieds. Exampe for homopoymeric 50 mer: A(50) = ~20/A 260 Unit; G(50) = ~28/A 260 Unit; T(50) = ~35/A 260 Unit and C(50) = ~39/A 260 Unit. Unmodified DNA Oigo Synthesis* Scae of Synthesis Cataog No. Price ($) 50 nmo nmo µmo µmo µmo µmo *minimum charge for 15 mer appies. Pease visit for current ist prices. Ca for institutiona discount pricing structure. Same Day Oigo* Design your oigos today and use them tomorrow morning! Investigators who just can not wait order our rush service (order by 12 noon EST). We ship the same day for next eary morning deivery in the US and 72 hours for most internationa destinations. * Turn-around time stated is for unmodified oigos. Pease inquire about purified and modified oigos Purification Scae of Synthesis Price ($)/purification Product Cataog No. 50 nmo 200 nmo 1 µmo 2 µmo 10 µmo 15 µmo Ge Purification XX Reverse Phase Cartridge XX Gene Link 6
7 Gene Link 140 Od Saw Mi River Road Hawthorne, NY GENELINK te: fax: emai: OLIGO SYNTHESIS CUSTOM OLIGO SPECIFICATIONS Customer Name: Ayson Rodgers Order Number: Customer Number: 10532AJ1 Date: June 13, 2004 Quaity Consistency Confidence Lane Oigo Name Sequence (5' 3') Size MW TM nmos µg A260 Units 1. Primer 1 CATCCTGCAGGGCTAGCTCATAGAGCTTGCGCGTCAATT AGGATACCTAGG 51 15, Primer 2 GGTGCTCTAGATCAGGAGCTTGCGCAGTCCCCGTGGG GATACCTAGTCACGTACTACTATGTCA 64 19, Primer 3 CATCCTGCAGGGCTAGCTCATAGAGCTTGCGCGTCAATT AGAGCTTGG 48 14, Primer 4 CTCAAGCAGGAAATCGGGAGCGGCACTTCGTACGGCG CGTCC 42 12, Primer 5 CGGAATTCGGTCACAGGCTTGGTCA 25 7, Primer 6 GGTCTGTCTGGGATCCCA 18 5, Primer 7 AAGAGAAAGGTAGGAAGCAC 20 6, Primer 8 CCAACCTCCTGTCCACCAACTTTCTTTCGTTGGATGTC CATCTGCGGCGTTTATGTTGGTTCTCCTGTAGGACTG GAA 78 23, Primer 9 TGGTCAGAATTCTAGCCTTTCGTGACGAAATTTTAACATA AAAGAAAGGCTTCTTGATATATTATCAAGAAACCTTTCTT TTCTATTAAATTTACA 96 29, Primer 10 AATTCTCAGTACTGTGTTTCAGCAGAAGGAGTCTTACAT GTGATGGGGTGTTACAACTGAAAAGTCAAAAGAAGTT TGTATTACCATTTTCAATAGCAGTATAAAAGGTTCTCTTT GGATTCCAGTTGTTGCTGCTTTACTACTCTTTCTAGTGC TTAGCT , NOTES 11. Primer 11 CTCAAGCAGGAAATCGAGCGGCACTTCGTACGTAAAT GCCAA 42 12, Oigos 1-7 are crude unpurified. Oigos 8-11 are ge purified. Ge anes for oigos 8-11 correspond to crude foowed by ge purified. Mobiity of an oigonuceotide is dependent upon the size and base composition. Oigos of the same size may not share the same mobiity patterns based on the foowing migration rate C>A>T>G. A stretch G's and GC's induces strong secondary structure that traves as higher mobiity fragments.
8 PRODUCT GUIDE Gene Link OLIGO SYNTHESIS Custom Oigo Specifications Gene Link custom oigonuceotides are suppied desated and yophiized. They are ready to use after appropriate reconstitution. Dry oigonuceotides are stabe at room temperature for an extended period of time. Storage & Reconstitution The oigonuceotide shoud preferaby be frozen upon receipt. TE buffer (10mM Tris, 1mM EDTA, ph 7.5) is recommended for dissoving the oigonuceotides. After reconstitution store the stock soution at -80 C or -20 C. Ge Photo Documentation An actua ge picture of the synthesized custom oigonuceotide is suppied. A major singe band represents high purity of the crude oigonuceotide. Purity & Usage The crude, desated oigonuceotide suppied is suitabe for a ampification and sequencing protocos. Ge purification is advised for a oigos used for coning appications and for oigos onger than 50mer. Biophysica Data Each oigo after desating is quantified by recording A 260. Exact nmos and µg is determined by the extinction coefficient and moecuar weight of the oigo. Oigo Scae of Synthesis and Typica Yied of Unmodified Oigos* Crude Desated RPC Purified*** Ge Purified 20mer oigo** 30mer oigo** 50mer oigo** Scae A 260 Units nmos A 260 Units nmos A 260 Units nmos 50 nmo NR* [1-2] NR* [2-4] 200 nmo µmo Purity & Yied Purity is more than 80% depending on oigo sequence and structure. Purity 85% to 95% depending on oigo sequence and structure. Not recommended for oigos onger than 35mer. Purity 98% to ~100% depending on oigo sequence and structure. Yied wi graduay decrease as ength of oigo increases. *The yied of modified oigos varies based on modification. **Yied of 30µg/A260 unit for oigos is cacuated for an ~equimoar base composition. Long stretches of a singe base or homopoymers wi have variabe yieds. Exampe for homopoymeric 50mer: A(50)= ~20/A260 Unit; G(50)= ~28/A260 Unit; T(50)= ~35/A260 Unit and C(50)= ~39/A260 Unit. ***RPC is reverse phase purification using a cartridge; a substitute for HPLC. NR*Not Recommended. Primer Design Hairpin Loop Formation and Primer Design* Successfu use of oigos as primers for ampification and sequencing starts with functiona primer design foowed by optimized PCR ampification conditions. Fortunatey, both PCR and sequencing reactions are inherenty robust and have been observed to toerate wide variations in quaity of primers when using unique tempates. The same toerance can aso ead to fase priming, poor resuts and frustrating time oss with tempates of higher compexity. Primer specificity aone does not guarantee an optimum ampification yied. Numerous computer appications are avaiabe for primer search and design. Most of these appications do not consider the effect of hairpin structures which tend to be quite stabe thermodynamicay. Genera guideines for primer design are given beow foowed by a brief account of stabe hairpin structure formation and non-watson-crick base pairing induced by a stretch of G s and G s interspersed with A s or C s (1-3). Genera Guideines 1. Specificity: Seect an 18 to 24mer stretch with perfect specificity. 2. Base Composition: Preferaby maintain GC content beow 60% with no stretches of more than 3G s or 4 runs of the same base. 3. Tm: Seect primer Tm within a few degrees of the pair. 4. Cross Homoogies: Perform NCBI bast to determine extent of cross homoogies. 5. Secondary Structure: Perform computer assisted anaysis to view formation of stabe dimers, oops and hairpins. Sequence 5'-CAGCGCACTACAGGCATGACGT-3' 5'-GTCCGCACGTACGGACAT-3' 5'-GTCAGCCGCACGTACGGACAT-3' 5'-AGTAACGCACTACGGACTTACGAC-3' 22mer; dg= -47.5; Tm(NN)= 61.6 C 18mer; dg= -38.4; Tm(NN): 57.0 C 21mer; dg: -46.3; Tm(NN): C 24mer; dg= -47.1; Tm(NN)= 58.8 C *Dimers 5' CAGCGCACTACAGGCATGACGT 3' 5' GTCCGCACGTACGGACAT 3' 5' GTCAGCCGCACGTACGGACAT 3' 5' AGTAACGCACTACGGACTTACGAC 3' ' TGCAGTACGGACATCACGCGAC 5' 3' TACAGGCATGCACGCCTG 5' 3' TACAGGCATGCACGCCGACTG 5' 3' CAGCATTCAGGCATCACGCAATGA 5' STACK AT 3 IS 4 BP LONG. STACK AT 8 IS 6 BP LONG. STACK AT 11 IS 6 BP LONG. STACK AT 2 IS 4 BP LONG. dg= -4.8; Tm= C dg= -5.7; Tm= C dg= -4.65; Tm= C dg=-2.05; Tm=-47.3 C Hairpin None 5' GTCCGCAC 5' GTCAGCCGCAC 5' AGTAACGCACT Loops ] ] ] 3' TACAGGCATG 3' TACAGGCATG 3' CAGCATTCAGGCA STEM AT 1 IS 5 BP LONG. LOOP=6. STEM AT 6 IS 3 BP LONG. LOOP=6 STEM AT 2 IS 4 BP LONG. LOOP=12. dg= -5.3; Tm=87.3 C dg= -2.4; Tm= 68.9 C dg= 0.8; Tm= 13.8 C *Secondary structure resuts are truncated to show the most stabe structures. A thermodynamic vaues incuding Tm and secondary structures cacuated and dispayed soey indicate the reative stabiity of the secondary structures. They shoud ony be used to compare the reative stabiity of the structures. dg vaue unit is kca/mo. Visit to design oigos or cick on the Anayze button whie on the onine oigo ordering page. Hairpin Structures One essentia eement of efficient primer design is to minimize interna secondary structure, especiay hairpin oops which tend to be deceptivey stabe at standard anneaing temperatures. Hairpins are stabe with as few as 4 bases stacked in the stem and a oop size of 4 to 6 bases. The stabiity decines as the oop size increases. The stem and oop size are reated proportionatey such that onger stem sizes can toerate onger oop sizes (4). As a genera rue, avoid hairpins with more than 3 bases in the stem. Stabe hairpin oop formation drasticay reduces the primer concentration avaiabe for hybridization to the target sequence. Base Composition Higher GC content stabiizes hybridization, but a string of G's and C's can exhibit interna Hoogsteen base pairing, non-watson-crick base pairing and shoud be avoided (3,4). Athough this anomaous behavior is difficut to predict, these structures can disrupt stabe primer binding. In genera, avoid runs of more than three consecutive G's in primers. Aso, examine potentia primers for sef-compementary and hairpin structures. Nucear Magnetic Resonance (NMR) studies have shown that a stabe hairpin can form with just four G-C basepairs in the stem and just three bases in the oop (5). References 1. Michae Zuker (2003) Nuceic Acids Res., 31, SantaLucia, J. (1998) Proc. Nat. Acad. Sci. USA 95, Sarochi, M-T., Courtois, Y., Guschbauer, W Eur. J. Biochem. 14: Gene Link, Inc. interna data. 5. Summer, M.F., Byrd R.A., Gao, K.A., Samson, C.J., Zon, G., Egan, W Nuceic Acids Res.13: R XXB Gene Link, Inc A Rights Reserved
O R A C L E H Y P E R I O N E N T E R P R I S E P E R F O R M A N C E M A N A G E M E N T S Y S T E M
O R A C L E H Y P E R I O N E N T E R P R I S E P E R F O R M A N C E M A N A G E M E N T S Y S T E M O R A C L E H Y P E R I O N S T R A T E G I C F I N A N C E, F U S I O N E D I T I O N R E L E A S
More informationCOMPOSITE FLOORS - II
24 COMPOSITE FLOORS - II 1.0 INTRODUCTION This chapter describes the basis for design of composite foors using profied deck sheets adopting the equations described in the chapter on composite foors - I
More informationChapter 2 Understanding the PMBOK Guide
Chapter 2 Understanding the PMBOK Guide Chapter Summary This chapter examines: The PMBOK Guide is a guide rather than a methodoogy and the difference is expored. This section aso summarizes some important
More informationA NEW GRAVITY MODEL WITH VARIABLE DISTANCE DECAY Müge Sandıkcıoğlu 1, Özden Gür Ali 2, Serpil Sayın 3
Internationa Conference 20th EURO Mini Conference Continuous Optimization and Knowedge-Based Technoogies (EurOT-2008) May 20 23, 2008, Neringa, LITHUANIA ISBN 978-9955-28-283-9 L. Sakaauskas, G.W. Weber
More informationSelection of Thermal Transfer Media for Industrial Applications (End User's Perspective)
Seection of Therma Transfer Media for Industria Appications (End User's Perspective) An Appications Overview Whitepaper Dr. James R. Wiiams Poyonics, Inc. Copyright, 2003. Poyonics, Inc. A rights reserved.
More informationName HOUR EXAM II BIOLOGY 108 FALL, 2003
Name First Last PD Number - (Pease Print) HOUR EXAM BOLOGY 108 FALL, 2003 n the spirit of the honor code, pedge that have neith 1 Signature 2 3 4 5 6 7 8 9 10 1. (10 points) From the foowing ist circe
More informationQuality Consistency Confidence
Gene Link Quaity Consistency Confidence For over a decade Gene Link has been providing researchers with the finest critica genetic research toos. Consistenty maintaining our reputation and responsibiity
More informationRole: Sales Manager Name: Sample SM Candidate Date: 26 June 2012
Roe: Name: Saes Manager Sampe SM Candidate Date: 26 June 2012 :: Introduction This Saes Taent Assessment report is designed to hep you understand the candidate s potentia fit to the seected roe. This report
More informationHEMPADUR MULTI-STRENGTH GF 35870
because prevention is better than cure Tough, tougher Product description is an amine cured pure epoxy coating reinforced with a high content of speciay seected amear gass fakes. The product provides exceent
More informationSWOT Analysis. Copyright 2016 The Open University
SWOT Anaysis Copyright 2016 The Open University 2 of 16 Monday 26 February 2018 Contents SWOT Anaysis 4 1 When to use a SWOT anaysis 5 2 Exporing the environment of a project 6 3 The four components of
More informationPegasus CIS (4.01) Guide to enhancements
Pegasus CIS (4.01) Guide to enhancements PEGASUS CIS (4.01): GUIDE TO ENHANCEMENTS Pegasus CIS provides companies operating in the construction industry an unparaeed eve of contro over every aspect of
More informationSingle Ply Roofing System
Insua t i o n Second Revision Juy 2018 Singe Py Roofing System NEXT GENERATION INSULATION SOLUTION FOR FLAT ROOFS Optimum performance rigid vacuum insuation pane Insuating performance up to five times
More informationEPM SYSTEM RELEASE X ON ORACLE EXALYTICS IN-MEMORY MACHINE
ORACLE ENTERPRISE PERFORMANCE MANAGEMENT SYSTEM Reease 11.1.2 EPM SYSTEM RELEASE 11.1.2.X ON ORACLE EXALYTICS IN-MEMORY MACHINE CONTENTS IN BRIEF EPM System Reease 11.1.2.3 on Orace Exaytics In-Memory
More informationAn Employers Guide to. Apprenticeships
An Empoyers Guide to Apprenticeships Contents Case Studies 2 Apprenticeships 3 Apprentice Roes 3 The Assessor 4 Recruitment 4 Funding and Centraised Grants 4 Apprenticeships Framework 5 Length of an Apprenticeship
More informationCover page. Title: Collapse Mechanisms of Composite Slab Panels in Fire. Authors: Anthony Abu Verotiana Ramanitrarivo Ian Burgess
Cover page Tite: Coapse Mechanisms of Composite Sab Panes in Fire Authors: Anthony Abu Verotiana Ramanitrarivo Ian Burgess ABSTRACT The identification of tensie membrane action as a sustainabe, high-capacity
More informationIQ ASSURED. Delivering Building Energy Management
IQ ASSURED Deivering Buiding Energy Management A BEMS can efficienty contro as much as 84% of your buiding s energy consumption but, to do so, it must be working effectivey The Buiding Energy Management
More informationLinear Shafts ov -linear -shaf ts-divider - U pdated
Linear Shafts ov-inear-shafts-divider - Updated - 18-09-2017 163 Linear Shafts Technica Information Linear shaft bars ov-inear-shafts-technica-info - Updated - 18-09-2017 Linear Shafts from Automotion
More informationOnline Sensors. Remote Sensors - the online link between your machines and ultimate reliability
Onine Sensors Remote Sensors - the onine ink between your machines and utimate reiabiity Onine Sensors Monitor machine wear Cut costs Extend oi ife Avoid critica faiure The requirement for on-ine machinery
More informationResearch on Knowledge Gap Recognition Mechanism of Virtual Industry Cluster
Research Journa of Appied Sciences, Engineering and Technoogy 5(14): 3810-3816, 2013 ISSN: 2040-7459; e-issn: 2040-7467 Maxwe Scientific Organization, 2013 Submitted: October 17, 2012 Accepted: December
More informationBitcoin, Blockchain and the Future of Payments
Bitcoin, Bockchain and the Future of Payments Leiani Doye SVP Product Management Apri 2016 doye@usdataworks.com 1 2 WHAT EXPERTS SAY A word with different and new money wi be a different and new word.
More informationTHE FUTURE OF WORK: HOW TO EFFECTIVELY INCORPORATE ROBOTS IN YOUR WORKFORCE
THE FUTURE OF WORK: HOW TO EFFECTIVELY INCORPORATE ROBOTS IN YOUR WORKFORCE Monday, June 5th: 2:30 p.m. 3:15 p.m. This information is not a commitment, promise or ega obigation made by Pegasystems, incuding
More informationIndexing and Retrieval of Degraded Handwritten Medical Forms
Indexing and Retrieva of Degraded Handwritten Medica Forms Huaigu Cao, Faisa Farooq and Venu Govindaraju Center for Unified Biometrics and Sensors (CUBS) Dept. of Computer Science and Engineering University
More informationCareer Development Check List
+ Resources Career Deveopment Check List Simpe To Do List Presentation Check List Stakehoder Anaysis Risk Register Risk Profie Gantt Chart Appraisa Interview Check List Negotiation Check List Option Appraisa
More informationLiability Data Reporting: Lessons Learned from the 2016 data collection process and changes for the 2017 LDT template and collection process
1/31/2017 Fifth Industry Diaogue Liabiity Data Reporting: Lessons Learned from the 2016 data coection process and changes for the 2017 LDT tempate and coection process Dominique Laboureix, Member of the
More informationFramework of Reputation Aggregation Management for Service-Oriented Business Ecosystems
Framework of Reputation Aggregation Management for Service-Oriented Business Ecosystems Le Xin Tsinghua Nationa Laboratory for Information Science and Technoogy, Department of Automation, Tsinghua University
More informationUnlock the Power of Your Auto Attendant
Unock the Power of Your Auto Attendant September 2012 2009 NASDAQ-LISTED: EGHT Unock the Power of Your Auto Attendant Agenda What is an Auto Attendant 5 Steps to Panning and Designing Configuring Your
More informationGatic Vortex gives you control of drainage volume and speed.
Unicass Juy 2014 L731 CI/SfB (52.7) h Gatic Vortex gives you contro of drainage voume and speed. Speciaised Engineering. Specia Advice. Harness the power of Vortex Gatic Vortex has been deveoped to bring
More information2.5. Type 90. MediaManagement system the modern handling of hazardous substances
2.5 MMS System 192 2.5 Type 90 MediaManagement system the modern handing of hazardous substances 193 The MediaManagement System (MMS) is a diverse, mutifunctiona and high-quaity soution for modern aboratory
More information2.5. Type 90. MediaManagement system the modern handling of hazardous substances
2.5 MMS System 192 2.5 Type 90 MediaManagement system the modern handing of hazardous substances 193 The MediaManagement System (MMS) is a diverse, mutifunctiona and high-quaity soution for modern aboratory
More informationANALYSIS AND DESIGN OF CORE METRICS FOR MODERN SOFTWARE PROJECTS
Internationa Journa of Information Technoogy and Knowedge Management Juy-December 2009, Voume 2, No. 2, pp. 277-281 ANALYSIS AND DESIGN OF CORE METRICS FOR MODERN SOFTWARE PROJECTS K. P. Yadav* & Raghuraj
More informationAgility, access and acceleration wherever and whenever needed: supporting and empowering your digitally enabled workforce
Goba IT Infrastructure and Depoyment Speciaists End User Workspace Agiity, access and acceeration wherever and whenever needed: supporting and empowering your digitay enabed workforce We put every resource
More informationSA grid code compliance for medium-high voltage renewable power plants
SA grid code compiance for medium-high votage renewabe power pants by Sanjeeth Sewchurran, Jay Kaichuran, and Sandie Maphumuo, ethekwini Eectricity Renewabe energy with its short ead times has become an
More informationPROGRESS IN THE ADAPTIVE FORECAST MANAGEMENT OF THE ECONOMIC ORGANIZATIONS. Marin ANDREICA 1 Mădălina Ecaterina POPESCU 2 Dragoş MICU 3
PROGRESS IN THE ADAPTIVE FORECAST MANAGEMENT OF THE ECONOMIC ORGANIZATIONS Marin ANDREICA 1 Mădăina Ecaterina POPESCU 2 Dragoş MICU 3 ABSTRACT In times of economic instabiity a cautious and adaptive forecast
More informationEast Asian Trading Ships
EAST ASIAN TRADING SHIPS East Asian Trading Ships BTheme Tami Kaiser-Poge Cary Academy PURPOSE Each student wi work with a partner as an owner of an overseas shipping company with one cargo ship in East
More informationSERVICE QUALITY - THEORETICAL OVERVIEW
SERVCE QUALTY - THEORETCAL OVERVEW Kaidas. M.G Financia services marketing: A study on marketing practices of banks in Keraa on service quaity dimensions Thesis. Department of Commerce and Management Studies,
More informationBenefits and Advantages
Benefits and Advantages A-in-one software. ISOQuaitas.PLM comes with Eiminate consistency errors. A product and process data Powerfu panning toos A panned activities such as Constanty updated to new requirements.
More informationEnergy Prices and the Laws of Supply and Demand
Energy Prices and the Laws of Suppy and Demand Summary: By using the aws of suppy and demand, students demonstrate how the marketpace sets energy prices and show how these prices change. Objectives Students
More informationInternational Laboratory Accreditation Cooperation. Why use an Accredited Laboratory?
Internationa Laboratory Accreditation Cooperation Why use an Accredited Laboratory? What factors shoud you consider when choosing a aboratory? When seecting a aboratory to fufi your testing, caibration
More informationUniversal one coat DPM Nominal thickness 250 microns Technical and installation data sheet. Product description. Standard colours
Atro Proof standard Universa one coat DPM Nomina thickness 250 microns Technica and instaation data sheet October 2016 Product description Atro Proof standard variant is a singe coat, high-buid epoxy surface
More informationAltro Pol. Additive for increasing strength of cementitious systems Technical and installation data sheet. Typical applications. Product description
Atro Po Additive for increasing strength of cementitious systems Technica and instaation data sheet November 2016 Product description Atro Po is a compementary part of the Atro fooring package, faciitating
More informationSPECIALIZED COMPUTING SOFTWARE FOR THE ASSESSMENT OF ENERGY EFFICIENCY AT THE LEVEL OF A STEAM BOILER
Proceedings of 2017 Internationa Conference on Hydrauics and Pneumatics - HERVEX November 8-10, Băie Govora, Romania SPECIALIZED COMPUTING SOFTWARE FOR THE ASSESSMENT OF ENERGY EFFICIENCY AT THE LEVEL
More informationAn Improved Approach to Offshore QRA
An Improved Approach to Offshore QRA Brian Bain 1 and Andreas Fack 2 1 DNV Energy UK 2 DNV Energy Norway QRA is now an estabished method used wordwide for the evauation of risks on offshore instaations.
More informationImprovement in One Day Strength in PPC to Increase the Customer Satisfaction and Sustain/Improve Brand Value
Improvement in One Day Strength in PPC to Increase the Customer Satisfaction and Sustain/Improve Brand Vaue Key words: Portand Gypsum Pozzoana Cement, Baine, Compressive Strength, Abstract In the present
More informationWorld Accreditation Day
Word Accreditation Day 9 June 2016 www.pubicsectorassurance.org Accreditation: A goba too to support Pubic Poicy Accreditation: A goba too to support Pubic Poicy Standards, accreditation and conformity
More informationLandscape Ruggedness in Evolutionary Algorithms
Persona use of this materia is permitted. However, permission to reprint/repubish this materia for advertising or promotiona purposes or for creating new coective works for resae or redistribution to servers
More informationOpenOffice/StarOffice Migration, a methodology in a professional environment
OpenOffice/ Migration, a methodoogy in a professiona environment Herzich Wikommen. Herzich Wikommen. OpenOffice.org Conference Berin, 4.9.4, 5.5 h Lothar K. Becker Foie What you wi see, and what you wi
More informationOptimal Model and Algorithm for Multi-Commodity Logistics Network Design Considering Stochastic Demand and Inventory Control
Systems Engineering Theory & Practice Voume 29, Issue 4, Apri 2009 Onine Engish edition of the Chinese anguage journa Cite this artice as: SETP, 2009, 29(4): 176 183 Optima Mode and Agorithm for Muti-Commodity
More informationSANITATION OF DAIRY EQUIPMENTS (RINSE SOLUTION AND SWAB CONTACT METHODS)
EXPERIMENT 10 Structure 10.1 Introduction 10.2 Objectives 10.3 Experiment Principe Requirement Procedure Observation Resuts 10.4 Precautions TESTS FOR SANITATION OF DAIRY EQUIPMENTS (RINSE SOLUTION AND
More informationSolar Roof Top in Thailand
Soar Roof Top in Thaiand Presentation outine 1 Soar potentia in Thaiand 2 Technoogy and system overview 3 The project deveopment process Soar Systems in Thaiand - Opportunity and Market Deveopment 4 5
More informationAltro Mosaic standard matt, Altro Mosaic standard gloss, Altro Mosaic vertical matt and Altro Mosaic vertical gloss
Atro Mosaic standard matt, Atro Mosaic standard goss, Atro Mosaic vertica matt and Atro Mosaic vertica goss Muti-coour decorative foor finish system Nomina thickness 1-1.5mm Technica and instaation data
More informationAdvanced Diagnostics / Premium Diagnostics for Positioners SRD960 / SRD991
Advanced Diagnostics / Premium Diagnostics for Positioners SRD960 / SRD991, EC EJ= + JH 5 O I JA, + 5 Operation Configuration Diagnosis for faied PST or stuck vave Inteigent Vave Diagnostics for Predictive
More informationProgressive Design-Build
Progressive Design-Buid Progressive Design-Buid Design-Buid Procured with a Progressive Design & Price A Design-Buid Done RightTM Primer 1 Progressive Design-buid Progressive Design-Buid Design-Buid Procured
More informationDeep Hole Drills Deep drilling from 10xD to 3000 mm with classic gun drills and spiral-fluted tools EB100 EB 80 ZB 80 EB 800 RT 100 T solid carbide
2011 Deep Hoe Dris Deep driing from 10xD to 3000 mm with cassic gun dris and spira-futed toos EB100 EB 80 ZB 80 EB 800 RT 100 T soid carbide RT 0 micro-precision dris Contents Singe-futed gun dri EB 100
More informationEnergy Performance Certificate
3 Harequin Road Sieby LOUGHBOROUGH Leicestershire LE12 7UR Dweing type: Date of assessment: Date of certificate: Reference number: Tota foor area: Mid-terrace house 09 November 2007 09 November 2007 9547-1831-6293-0503-2641
More informationScouts of the World Award YOUTH PROGRAMME
1 Scouts of the Word Award YOUTH PROGRAMME Introduction The Scouts of the Word Award chaenges a young peope, Scouts and non-scouts, to think about goba issues and act upon them in their oca community.
More informationPRESENTER: Robert R. Gotwals, Jr.. The Shodor Education Foundation, Inc. Ozone. O3 creation. O Molecules ~ Ozone Guess ~ O3 per cl radical.
Air Quaity Modeing for Teachers PRESENTER: Robert R. Gotwas, Jr.. The Shodor Education Foundation, Inc. O3 creation Ozone O Moecues ~ Ozone Guess ~ O3 per c radica ~ impact of c norma decay Post 1994 message
More informationStudy Session 13 Commercial Opportunities in Urban Sanitation and Waste Management
Study Session 13 Commercia Opportunities in Urban Sanitation and Waste Management Copyright 2016 The Open University Contents Introduction 3 Learning Outcomes for Study Session 13 3 13.1 Opportunities
More informationA Comparison of Design, Construction and Dynamic Performance of Timber Floors in the UK and Finland
Napier University Schoo of Engineering and the Buit Environment Centre for Timber Engineering Merchiston Campus 10 Cointon Road Edinburgh EH10 5DT 26 November 2007 Revised: June 2009 A Comparison of Design,
More informationErik T. Verhoef. VU University Amsterdam, and Tinbergen Institute.
TI 2007-093/3 Tinbergen Institute Discussion Paper Private Roads Auctions and Competition in Networks Erik T. Verhoef VU University Amsterdam, and Tinbergen Institute. Tinbergen Institute The Tinbergen
More informationExact Algorithms for Integrated Facility Location and Production Planning Problems
Exact Agorithms for Integrated Faciity Location and Production Panning Probems Thomas C. Sharkey, 1 Joseph Geunes, 2 H. Edwin Romeijn, 3 Zuo-Jun Max Shen 4 1 Department of Industria and Systems Engineering,
More informationMonitoring vs. Auditing at Investigator Sites ICH GCP (R2) Impact on Investigator Sites
Monitoring vs. Auditing at Investigator Sites ICH GCP (R2) Impact on Investigator Sites Trini Ajazi, MM, Chief Administrative Officer CRP Breakout Session November Aiance Meeting 2017 Agenda Monitoring
More informationPractices for Improving Quality and Safety
2 Practices for Improving Quaity and Safety Practices for Improving Quaity and Safety The capabiity of boards and board quaity committees to function effectivey and to move appropriatey between fiduciary
More informationCompetent Cells. Update 2015/16 CLONING & PROTEIN EXPRESSION
Ces Update 2015/16 CLONING & PROTEIN EXPRESSION STRAIN PROPERTIES & FORMATS Strain Properties There are many properties to consider when choosing a strain for your experiments. Requirements such as high-quaity
More informationFRANCHISE PROSPECTUS
www.thewheespeciaist-franchise.co.uk FRANCHISE PROSPECTUS What Is The Whee Speciaist? A network of speciaists providing an outstanding whee refurbishment and customisation service, from bespoke units,
More informationExtracting Value from the Internet & Connectivity. The ehealth Colloquium August 21, Jay Toole National Director for ehealth
Extracting Vaue from the Internet & Connectivity The eheath Cooquium August 21, 2000 Jay Tooe Nationa Director for eheath The opportunities avaiabe to todayõs heathcare organizations range from protecting
More informationSoC Design Flow & Tools: Introduction
SoC Design Fow & Toos: Introduction Jiun-Lang Huang Graduate Institute of Eectronics Engineering Department of Eectrica Engineering Nationa Taiwan University 1 Contents Moving to SoC Design Design Methodoogies
More informationMANAGEMENT & LEADERSHIP SKILLS
A 2-DAY SEMINAR A 2-day comprehensive seminar providing essentia skis critica to every manager or supervisor MANAGEMENT & Learn the most effective and efficient ways to: Soidify your position Prioritize
More informationRe: Response to NC DEHNR Comments on the Draft REmedial Investigation Report for Operable Unit 1, MCB Camp Lejeune, North Carolina
J. (804) 3224793 5090 1823:LGB:srw CERTIFIED MAIL RETURN RECEIPT REQUESTED North Caroina Department of Environment, Heath, and Natura Resources Attn: Mr. Patrick Watters P.O. Box 27687 401 Oberin Road
More informationBusiness Plan. Wholesaler Name: Territory: Date Prepared: For internal use only. Not for distribution to the public.
Business Pan Whoesaer Name: Territory: Date Prepared: For interna use ony. Not for distribution to the pubic. Deveoping a Business Pan is core to the ongoing stabiity and growth of your business. Taking
More informationAll change in external audit. Managing your audit arrangements in a period of great change and how Independent Audit & Risk Review can help you
A change in externa audit Managing your audit arrangements in a period of great change and how Independent Audit & Risk Review can hep you A change pease Companies are bowing to the inevitabe. Over the
More informationThe FAIDA Market Linkage approach: Facilitating sustainable linkages between smallholders and agricultural companies
Author: John Bet Editor: Marest Artist: Rey DTP: Jeff 3rd Draft #15 The FAIDA Market Linkage approach: Faciitating sustainabe inkages between smahoders and agricutura companies BEFORE AFTER FAIDA MARKET
More informationCommsOffice Professional. Live telephony statistics for informed decisions
CommsOffice Professiona Live teephony statistics for informed decisions CommsOffice Professiona Communications management for every business After saaries, overa communication costs are the argest singe
More informationFight Last Click and see the Whole Picture
Fight Last Cick and see the Whoe Picture November 2017, EyeForTrave Amsterdam Maria Gomez Bada Anaytics & Data Insights, Goba Marketing mbada@homeaway.com 1 Agenda Marketing Attribution Googe Anaytics
More informationThe importance of carbon capture and storage technology in European refineries
storage technoogy in European refineries This artice describes the importance of carbon capture and storage (CCS) in meeting future emission targets. It presents an evauation of the costs of retrofitting
More informationIndustrial Extrusion
Industria Extrusion The Best Twin-Screw Design for Powder Coating Baker Perkins manufactures a comprehensive range of twin-screw extruders specificay for powder coating production, from the MPX19 for sma
More informationAssembly Instructions
Assemby Instructions GENERAL Optoeectronic semiconductor devices can be mounted in any position. Connection wires may be bent provided the bend is not ess than 1.5 mm from the bottom of the case. During
More informationInformation Can guide you
Information Can guide you 02 Do you know me? I'm Huawei's new-generation IP experience O&M expert. Come and find me I can provide a documents you want. Experience what I can do for you Onine Video for
More informationStreamflow Prediction Based on Least Squares Support Vector. Machines
Streamfow Prediction Based on Least Squares Support Vector Machines Nian Zhang nzhang@udc.edu Chares Wiiams chares.wiiams4@udc.edu Esther Ososanya eososanya@udc.edu Wagdy Mahmoud wmahmoud@udc.edu University
More informationReport #4 Agri-Environmental Indicators Report Series. Environmental Sustainability of Canadian Agriculture
Report #4 Agri-Environmenta Indicators Report Series Environmenta Sustainabiity of Canadian Agricuture Environmenta Sustainabiity of Canadian Agricuture: Agri-Environmenta Indicator Report Series Report
More informationFarming with Your Nutrient Management Plan
Farming with Your Nutrient Management Pan A Comprehensive Guide to Maryand s Nutrient Management Reguations and Requirements -- What s Inside: 1 2 3 4 5 Impementing Your Nutrient Management Pan Nutrient
More informationNationally Important Agro-biodiversity Heritage Sites (NIABHS): An Innovative Concept for Sustainable Conservation Efforts
Nationay Important Agro-biodiversity Heritage Sites (NIABHS): An Innovative Concept for Sustainabe Conservation Efforts P. K. Singh ICAR- Indian Institute of Sugarcane Research, Dikusha P.O., Lucknow 226
More informationL10H Midterm, Spring Quarter By Toni Lee (undergraduate student)
L10H Midterm, Spring Quarter 2004 By Toni Lee (undergraduate student) I. Specific Aim Through the use of reverse genetics, methods of disrupting gene function when ony the sequence and position in the
More informationCommissioning Chilled Water Systems
Commissioning Chied Water Systems BUILD. CONNECT. ACHIEVE. James Anderton, CPMP, CxA, LEED GA INDEPENDENT COMMISSIONING CONSULTING, LLC 0 Learning Objectives PRESENTATION OVERVIEW Introduction to Cx CHWS
More informationIntroduction to Alliance Audit
Introduction to Aiance Audit Scott Okuno, MD Audit Committee Chair Audit Preparation Workshop, November 1, 2018 Why Do Audits? Investigators of cinica trias have an obigation to take appropriate steps
More informationCollaborative Practical Oriented Independent Variable Pitch Control Strategy for Wind Power Generation
doi:10.21311/001.39.9.26 Coaborative Practica Oriented Independent Variabe Pitch Contro Strategy for Wind Power Generation Lei Feng, Zhihong Jiang, Yang Liu, Quanyong Sun, Pengfei Lv Schoo of Eectrica
More informationA Measure for Sequence Similarity Based on Dual Nucleotides and Information Discrepancy
The Fourth Internationa Conference on Computationa Systems Bioogy (ISB2010) Suzhou, China, September 9 11, 2010 Copyright 2010 ORSC & APORC, pp. 72 80 A Measure for Sequence Simiarity Based on Dua Nuceotides
More informationEmergency lighting maintenance at your fingertips
Emergency ighting maintenance at your fingertips At Thomas & Betts, our focus is on improving your business performance by providing practica, reiabe eectrica products and services that connect and protect
More informationApproaches to software development
Approaches to software deveopment About this free course This free course is an adapted extract from the Open University course TM354 Software engineering: http://www.open.ac.uk/courses/modues/tm354. This
More informationTemplate Quality and Realtime
Tempate Quaity and Reatime QPCR Infuence of tempate quaity on rea-time QPCR resuts Cathy Cuter Fied Appication Scientist Steps towards successfu Rea-time QPCR experiments 3. RNA/DNA quantification and
More informationVariable speed wastewater pumping
WHITE PAPER Variabe speed wastewater pumping November 2013 Variabe speed wastewater pumping During the ast 10 15 years the industry has seen a significant increase in the adaptation of variabe drives (VFD
More informationVariable speed wastewater pumping
WHITE PAPER Variabe speed wastewater pumping June 2015 Variabe speed wastewater pumping During the ast 10 15 years the industry has seen a significant increase in the adaptation of variabe drives (VFD
More informationVariable speed wastewater pumping
white paper Variabe speed wastewater pumping June 2015 Variabe speed wastewater pumping During the ast 10 15 years the industry has seen a significant increase in the adaptation of variabe drives (VFD
More informationUsing Multiple Regression Analysis to Develop Electricity Consumption Indicators for Public Schools
Using Mutipe Regression Anaysis to Deveop Eectricity Consumption Indicators for Pubic Schoos CorJitz NO&I, Lund Institute of Technoogy, Sweden Jurek Pyrko, Lund Institute of Technoogy, Sweden ABSTRACT
More informationThe role of Independent Reviewing Officers (IROs) in England
Research summary 11 March 2014 The roe of Independent Reviewing Officers (IROs) in Engand Heena Jeicic, Ivana a Vae and Di Hart, with Lisa Homes from the Centre for Chid and Famiy Research, Loughborough
More informationLeadership for Improving Quality and Safety
1 Leadership for Improving Quaity and Safety Leadership for Improving Quaity and Safety Board eadership is a critica ingredient to achieving better, safer care and governing boards can choose to be either
More informationApplication of New Common Structural Rules on Aframax Tankers
TSCF 2016 Shipbuiders Meeting Appication of New Common Structura Rues on Aframax Tankers CAI Shijian 1 SHENG Lixian 2 SHAN Penghao 1 SUN Yu 2 LIUYinhua 1 LIU Kun 2 1: Marine Design & Research Institute
More informationStatistical Assessment of Changes in Bird Certification Rules for Aero-Engines Through Time
University of Nebraska - Lincon DigitaCommons@University of Nebraska - Lincon 2011 Bird Strike North America Conference, Niagara Fas Bird Strike Committee Proceedings 9-2011 Statistica Assessment of Changes
More informationarxiv: v1 [cs.ai] 18 Jun 2015
Smart Pacing for Effective Onine Ad Campaign Optimization Jian Xu, Kuang-chih Lee, Wentong Li, Hang Qi, and Quan Lu Yahoo Inc. 7 First Avenue, Sunnyvae, Caifornia 9489 {xuian,kcee,wentong,hangqi,qu}@yahoo-inc.com
More informationIncident management system for the oil and gas industry. Good practice guidelines for incident management and emergency response personnel
Incident management system for the oi and gas industry Good practice guideines for incident management and emergency response personne The goba oi and gas industry association for environmenta and socia
More informationPROBABILISTIC PRODUCTION COSTING OF TRANSMISSION CONSTRAINED POWER SYSTEMS UNDER GENERATION COST UNCERTAINTY
PROBABILISTIC PRODUCTION COSTING OF TRANSMISSION CONSTRAINED POWER SYSTEMS UNDER GENERATION COST UNCERTAINTY P D C Wijaytunga Dept of Eectrica Eng University of Moratuwa Sri Lanka B J Cory E D Farmer C
More information