Figure S1. Phylogenetic tree comparing c-type cytochrome proteins from Ferroglobus placidus to c-type cytochromes from other bacterial and archaeal

Size: px
Start display at page:

Download "Figure S1. Phylogenetic tree comparing c-type cytochrome proteins from Ferroglobus placidus to c-type cytochromes from other bacterial and archaeal"

Transcription

1 Fiure S1. Phyloenetic tree comparin c-type cytochrome proteins from Ferrolobus placidus to c-type cytochromes from other bacterial and archaeal species. 1

2 Fiure S2. Alternative complex III operons found in Ferrolobus placidus (locus id: Ferp), Geobacter bemidjiensis (Gbem), G. metallireducens (Gmet), G. daltonii (Geob), G. sulfurreducens (GSU), G. uraniireducnes (Gura), G. bremensis (K419DRAFT), strain M18 (GM18), strain M21 (GM21), Geopsychrobacter electrodiphilus (D888DRAFT), Anaeromyxobacter sp. FW109-5 (Anae109), A. dehaloenans (Adeh), Desulfocapsa sulfexiens (UWK), and Desulfobacula toluolica (TOL2). 2

3 Table S1. Primers used to quantify different mrna transcripts from F. placidus by quantitative RT-PCR. Locus ID Ferp_0660 Ferp_0668 Ferp_0670 Ferp_0672 Ferp_1255 Ferp_1267 Ferp_1336 Ferp_1341 Ferp_1813 Ferp_1814 Ferp_2064 Primer name Ferp_ f/336r Ferp_ f/550r Ferp_ f/2184r Ferp_ f/4410r Ferp_ f/313r Ferp_ f/434r Ferp_ f/613r Ferp_ f/619r Ferp_ f/309r Ferp_ f/256r Ferp_ f/537r Forward primer (5 3 ) Reverse primer (5 3 ) TTACACGGAGTCGACGTTTG CAGCTTGTAGTGGGGATCGT CACAGACCGTGGGTTCTTTCA CGTGGGTGTGACAGCCTATG CATCAGGTTCGGAAGGGACATA GGCATAGTGGGAGACCGTAGAG CGCCGACAATCTTTCAATACTG CCCGTTTACTGCCCTGTTCTC GACGTTGGCAACAACTACGA AGAGGACGTCTTTGGCGTAA ATTCTGCCTGAACTGCCACAA CAAACCGTACAAGGCTTATCCG CAAAATACAAGCCGCCGAAA CGGATGCTTTACACCAGTTGG CGATTACAGTTTTGCGACGA CGAGGAAGACCGTGAAGAAG CGCCAACACCAAAACCTACT GTTACCGCAGAGCTGTCCTC CAACAATCCGAAGAGGCAAT GGCAGGAAATGCAGTAATCG ATGCCATAAACGGATTGAGACA GGCGAAGCACCAGAAGTTG 3

4 Table S2. Evaluation of c-type cytochromes present in the enomes of hyperthermophilic archaea. Hyperthermophilic archaeon Archaeolobus fulidus Geolobus acetivorans Caldivira maquilinensis Ferrolobus placidus Methanopyrus kandleri Pyrobaculum aerophilum Pyrobaculum islandicum Tempera ture rane or optimum ( C) Total putat ive cyt c enes with 1 motif with 2-5 motifs with 6-19 motifs with 20+ motifs Electron acceptors utilized Fe(III), SO 2-4, SO 2-3, S 2 O 2-3 (1-3) Fe(III) (4, 5) SO 2-4, SO 2-3, S 2 O 2-3, NO - 3, Fe(III) (6) Fe(III), S 2 O 2-3, NO - 3 (7, 8) Fe(III), CO 2 (3, 9) O 2, NO - 3, NO - 2, Fe(III) (10, 11) SO 2-4, SO 2-3, S 2 O 2-3, Fe(III), Mn(IV), U(VI), Tc(VII), Cr(VI), Co(III) (12, 13) NO - 3, AsO 3-4, S 2 O 2-3, Fe(III) (14) Pyrobaculum sp Pyrococcus abyssi fermentative, Fe(III) (3, 15) Pyrococcus furiosus fermentative, Fe(III) (3, 16, 17) 4

5 References 1. Beeder J, Nilsen RK, Rosnes JT, Torsvik T, Lien T Archaeolobus fulidus isolated from hot North-Sea-oil field waters. Appl. Environ. Microbiol. 60: Klenk HP, Clayton RA, Tomb JF, White O, Nelson KE, Ketchum KA, Dodson RJ, Gwinn M, Hickey EK, Peterson JD, Richardson DL, Kerlavae AR, Graham DE, Kyrpides NC, Fleischmann RD, Quackenbush J, Lee NH, Sutton GG, Gill S, Kirkness EF, Douherty BA, McKenney K, Adams MD, Loftus B, Peterson S, Reich CI, McNeil LK, Bader JH, Glodek A, Zhou LX, Overbeek R, Gocayne JD, Weidman JF, McDonald L, Utterback T, Cotton MD, Spris T, Artiach P, Kaine BP, Sykes SM, Sadow PW, DAndrea KP, Bowman C, Fujii C, Garland SA, Mason TM, Olsen GJ, Fraser CM, Smith HO, Woese CR, Venter JC The complete enome sequence of the hyperthermophilic, sulphate-reducin archaeon Archaeolobus fulidus. Nature 390:364-&. 3. Varas M, Kashefi K, Blunt-Harris EL, Lovley DR Microbioloical evidence for Fe(III) reduction on early Earth. Nature 395: Mardanov AV, Slododkina GB, Slobodkin AI, Beletsky AV, Gavrilov SN, Kublanov IV, Bonch-Osmolovskaya EA, Skryabin KG, Ravin NV The enome of Geolobus acetivorans: Fe(III) reduction, acetate utilization, autotrophic rowth and deradation of aromatic compounds in a hyperthermophilic archaeon. Appl. Environ. Microb. doi: /AEM Slobodkina GB, Kolanova TV, Querellou J, Bonch-Osmolovskaya EA, Slobodkin AI Geolobus acetivorans sp. nov., an iron(iii)-reducin archaeon from a deepsea hydrothermal vent. Internat. J. Sys. Evol. Microbiol. 59:

6 6. Itoh T, Suzuki K, Sanchez PC, Nakase T Caldivira maquilinensis en. nov., sp nov., a new enus of rod-shaped crenarchaeote isolated from a hot sprin in the Philippines. Int. J. Syst. Bacteriol. 49: Hafenbradl D, Keller M, Dirmeier R, Rachel R, Rossnael P, Burraf S, Huber H, Stetter KO Ferrolobus placidus en nov, sp nov, a novel hyperthermophilic archaeum that oxidizes Fe 2+ at neutral ph under anoxic conditions. Arch. Microbiol. 166: Tor JM, Kashefi K, Lovley DR Acetate oxidation coupled to Fe(III) reduction in hyperthermophilic microoranisms. Appl. Environ. Microb. 67: Kurr M, Huber R, Koni H, Jannasch HW, Fricke H, Trincone A, Kristjansson JK, Stetter KO Methanopyrus kandleri, Gen and Sp-nov represents a novel roup of hyperthermophilic methanoens, rowin at 110-derees-C. Arch. Microbiol. 156: Volkl P, Huber R, Drobner E, Rachel R, Burraf S, Trincone A, Stetter KO Pyrobaculum aerophilum sp-nov, a novel nitrate-reducin hyperthermophilic archaeum. Appl. Environ. Microb. 59: Feinber LF, Holden JF Characterization of dissimilatory Fe(III) versus NO 3 - reduction in the hyperthermophilic archaeon Pyrobaculum aerophilum. J. Bacteriol. 188: Huber R, Kristjansson JK, Stetter KO Pyrobaculum en-nov, a new enus of neutrophilic, rod-shaped Archaebacteria from continental solfataras rowin optimally at 100-Derees-C. Arch. Microbiol. 149:

7 13. Kashefi K, Lovley DR Reduction of Fe(III), Mn(IV), and toxic metals at 100 derees C by Pyrobaculum islandicum. Appl. Environ. Microb. 66: Mardanov AV, Gumerov VM, Slobodkina GB, Beletsky AV, Bonch-Osmolovskaya EA, Ravin NV, Skryabina KG Complete enome sequence of strain 1860, a crenarchaeon of the enus Pyrobaculum able to row with various electron acceptors. J. Bacteriol. 194: Erauso G, Reysenbach AL, Godfroy A, Meunier JR, Crump B, Partensky F, Baross JA, Marteinsson V, Barbier G, Pace NR, Prieur D Pyrococcus abyssi sp-nov, a new hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent. Arch. Microbiol. 160: Fiala G, Stetter KO Pyrococcus furiosus sp-nov represents a novel enus of marine heterotrophic Archaebacteria rowin optimally at 100-Derees C. Arch. Microbiol. 145: Robb FT, Maeder DL, Brown JR, DiRuiero J, Stump MD, Yeh RK, Weiss RB, Dunn DM Genomic sequence of hyperthermophile, Pyrococcus furiosus: implications for physioloy and enzymoloy. Methods Enzymol. 330:

A Novel DNA Polymerase Family Found in Archaea

A Novel DNA Polymerase Family Found in Archaea JOURNAL OF BACTERIOLOGY, Apr. 1998, p. 2232 2236 Vol. 180, No. 8 0021-9193/98/$04.00 0 Copyright 1998, American Society for Microbiology A Novel DNA Polymerase Family Found in Archaea YOSHIZUMI ISHINO,

More information

Pyrobaculum ferrireducens sp. nov., a hyperthermophilic Fe(III)-, selenate- and arsenatereducing crenarchaeon isolated from a hot spring

Pyrobaculum ferrireducens sp. nov., a hyperthermophilic Fe(III)-, selenate- and arsenatereducing crenarchaeon isolated from a hot spring International Journal of Systematic and Evolutionary Microbiology (2015), 65, 851 856 DOI 10.1099/ijs.0.000027 Pyrobaculum ferrireducens sp. nov., a hyperthermophilic Fe(III)-, selenate- and arsenatereducing

More information

Insight into mechanisms involved in Fe(III) respiration by the hyperthermophilic

Insight into mechanisms involved in Fe(III) respiration by the hyperthermophilic AEM Accepted Manuscript Posted Online 6 February 2015 Appl. Environ. Microbiol. doi:10.1128/aem.04038-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Insight into mechanisms

More information

Pyrococcus CH1, an obligate piezophilic hyperthermophile: extending the upper pressure-temperature limits for life

Pyrococcus CH1, an obligate piezophilic hyperthermophile: extending the upper pressure-temperature limits for life July 009; Volume 3 (7) : Pages 873 876 http://dx.doi.org/10.1038/ismej.009.1 Copyright 009 Nature Publishing Group Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original

More information

HYPERTHERMOPHILES - GEOCHEMICAL AND INDUSTRIAL IMPLICATIONS. Harald Huber

HYPERTHERMOPHILES - GEOCHEMICAL AND INDUSTRIAL IMPLICATIONS. Harald Huber HYPERTHERMOPHILES - GEOCHEMICAL AND INDUSTRIAL IMPLICATIONS Harald Huber Department of Microbiology, University of Regensburg Universitätsstrasse 31 8400 Regensburg, FRG Abstract Hyperthermophiles, growing

More information

Thermophilic microorganisms capable of degrading biopolymers

Thermophilic microorganisms capable of degrading biopolymers Thermophilic microorganisms capable of degrading biopolymers Ilya V. Kublanov Laboratory of hyperthermophilic microbial communities, Winogradsky Institute of Microbiology, Russian Academy of Sciences Summary

More information

Hyperthermophiles: optimum for them is extreme for the rest

Hyperthermophiles: optimum for them is extreme for the rest Hyperthermophiles: optimum for them is extreme for the rest 1,2,3 I. Valentin Petrescu-Mag, 1 Claudiu Gavriloaie, 1 Miklos Botha 1 Bioflux SRL, Cluj-Napoca, Romania; 2 Department of Environment and Plant

More information

Mechanisms for Accessing Insoluble Fe(III) Oxide During Dissimilatory Fe(III) Reduction by Geothrix Fermentans

Mechanisms for Accessing Insoluble Fe(III) Oxide During Dissimilatory Fe(III) Reduction by Geothrix Fermentans University of Massachusetts Amherst From the SelectedWorks of Kelly Nevin May 1, 2002 Mechanisms for Accessing Insoluble Fe(III) Oxide During Dissimilatory Fe(III) Reduction by Geothrix Fermentans Kelly

More information

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control Genes We Targeted

More information

Received 17 December 1996/Accepted 15 April 1997

Received 17 December 1996/Accepted 15 April 1997 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 1997, p. 2876 2883 Vol. 63, No. 7 0099-2240/97/$04.00 0 Copyright 1997, American Society for Microbiology Distribution of Microorganisms in Deep-Sea Hydrothermal

More information

Characterization of a Noncanonical Purine dntp Pyrophosphatase from Archaeoglobus fulgidus

Characterization of a Noncanonical Purine dntp Pyrophosphatase from Archaeoglobus fulgidus J. Microbiol. Biotechnol. (2006),G16(7), 1144 1148 Characterization of a Noncanonical Purine dntp Pyrophosphatase from Archaeoglobus fulgidus IM, EUN KYOUNG 1,2, CHANG HYUNG HONG 1, JUNG HO BACK 3, YE

More information

(1) Université Bretagne Occidentale (UBO), IUEM (Institut Universitaire Européen de la

(1) Université Bretagne Occidentale (UBO), IUEM (Institut Universitaire Européen de la JB Accepts, published online ahead of print on January 0 J. Bacteriol. doi:.1/jb.00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 Genome

More information

International Journal of Systematic and Evolutionary Microbiology (2002), 52,

International Journal of Systematic and Evolutionary Microbiology (2002), 52, International Journal of Systematic and Evolutionary Microbiology (2002), 52, 1097 1104 DOI: 10.1099/ijs.0.02152-0 Vulcanisaeta distributa gen. nov., sp. nov., and Vulcanisaeta souniana sp. nov., novel

More information

International Journal of Systematic and Evolutionary Microbiology (2002), 52,

International Journal of Systematic and Evolutionary Microbiology (2002), 52, International Journal of Systematic and Evolutionary Microbiology (2002), 52, 719 728 DOI:.99/ijs.0.01953-0 Geoglobus ahangari gen. nov., sp. nov., a novel hyperthermophilic archaeon capable of oxidizing

More information

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control

More information

Pyrolobus fumarii, gen. and sp. nov., represents a novel group of archaea, extending the upper temperature limit for life to 113 C

Pyrolobus fumarii, gen. and sp. nov., represents a novel group of archaea, extending the upper temperature limit for life to 113 C Extremophiles 14 (1997) 1:14 21 N. Matsuda et al.: EGF receptor and osteoblastic Springer-Verlag differentiation 1997 ORIGINAL PAPER Elisabeth Blöchl Reinhard Rachel Siegfried Burggraf Doris Hafenbradl

More information

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology. Tour the Bay Paul Center Keck Sequencing Facility

Day 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology. Tour the Bay Paul Center Keck Sequencing Facility Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Tour the Bay Paul Center Keck Sequencing Facility 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5:

More information

Approaches to Vaccine Development Using Bioinformatics. Vaccine development has traditionally been a lengthy process. Animal studies with specific

Approaches to Vaccine Development Using Bioinformatics. Vaccine development has traditionally been a lengthy process. Animal studies with specific Approaches to Vaccine Development Using Bioinformatics 12 December 2002 Vaccine development has traditionally been a lengthy process. Animal studies with specific pathogens are used to find proteins that

More information

Final Exam. MB 451 : Microbial Diversity Spring Honor pledge: I have neither given nor received unauthorized aid on this test.

Final Exam. MB 451 : Microbial Diversity Spring Honor pledge: I have neither given nor received unauthorized aid on this test. Final Exam MB 451 : Microbial Diversity Spring 2010 Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Date : Name : 1. What are the 3 primary evolutionary branches

More information

using their genomic DNA sequences

using their genomic DNA sequences No. 8] Proc. Japan Acad., 75, Ser. B (1999) 241 Comparison of p athways for amino acid biosynthesis in archaebacteria using their genomic DNA sequences By Sadaharu HIGucHI,*) Tsuyoshi KAWASHIMA,*) and

More information

Archaeoglobus sulfaticallidus sp. nov., a novel thermophilic and facultatively

Archaeoglobus sulfaticallidus sp. nov., a novel thermophilic and facultatively IJSEM Papers in Press. Published January 8, 2010 as doi:10.1099/ijs.0.016105-0 1 2 3 4 5 Archaeoglobus sulfaticallidus sp. nov., a novel thermophilic and facultatively lithoautotrophic sulfate-reducer

More information

ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA ABSTRACT

ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA ABSTRACT ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA Ambika Verma 1*, & Poonam Shirkot 2 1*Ph.D Scholar, Department of Biotechnology,

More information

Thermococcus onnurineus sp. nov., a Hyperthermophilic Archaeon Isolated from a Deep-Sea Hydrothermal Vent Area at the PACMANUS Field

Thermococcus onnurineus sp. nov., a Hyperthermophilic Archaeon Isolated from a Deep-Sea Hydrothermal Vent Area at the PACMANUS Field J. Microbiol. Biotechnol. (2006),G16(11), 1826 1831 hermococcus onnurineus sp. nov., a Hyperthermophilic Archaeon Isolated from a Deep-Sea Hydrothermal Vent Area at the PACMANUS Field BAE, SEUNG SEOB,

More information

Metabolism Lectures. Outline:! Part I: Fermentations! Part II: Respiration! Part III: Metabolic Diversity

Metabolism Lectures. Outline:! Part I: Fermentations! Part II: Respiration! Part III: Metabolic Diversity Outline:! Part I: Fermentations! Part II: Respiration! Part III: Metabolic Diversity Metabolism Lectures Learning objectives are:! Learn about anaerobic respiratory metabolisms.! How can an inorganic compound

More information

I give permission for public access to my thesis and for copying to be done at the discretion of the archives librarian and/or the College library.

I give permission for public access to my thesis and for copying to be done at the discretion of the archives librarian and/or the College library. I give permission for public access to my thesis and for copying to be done at the discretion of the archives librarian and/or the College library. Signature Date EXPLORING BIOTIC IRON TRANSFORMATION BY

More information

The distribution, diversity, and importance of 16S rrna gene introns in the order Thermoproteales

The distribution, diversity, and importance of 16S rrna gene introns in the order Thermoproteales Jay and Inskeep Biology Direct (2015) 10:35 DOI 10.1186/s13062-015-0065-6 RESEARCH The distribution, diversity, and importance of 16S rrna gene introns in the order Thermoproteales Zackary J. Jay and William

More information

1 Keywords: archaea, barophile, Thermococcus, hyperthermophile, deep-sea vent I

1 Keywords: archaea, barophile, Thermococcus, hyperthermophile, deep-sea vent I lnternational Journal of Systematic Bacterio/ogy (1 999),49, 3 5 1-359 Printed in Great Britain Thermococcus barophilus sp. nov., a new barophilic and hyperthermophilic archaeon isolated under high hydrostatic

More information

Anne Postec, Patricia Pignet, Valérie Cueff-Gauchard, Anne Schmitt, Joël Querellou and Anne Godfroy *

Anne Postec, Patricia Pignet, Valérie Cueff-Gauchard, Anne Schmitt, Joël Querellou and Anne Godfroy * Research in Microbiology JAN-FEB 2005; 156 (1) : 82-87 http://dx.doi.org/10.1016/j.resmic.2004.08.001 @ 2004 Elsevier SAS All rights reserved Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle

More information

Author for correspondence: Karl O. Stetter. Tel: Fax: Karl.Stetter biologie.uni-regensburg.

Author for correspondence: Karl O. Stetter. Tel: Fax: Karl.Stetter biologie.uni-regensburg. International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2093 2100 Printed in Great Britain Ignicoccus gen. nov., a novel genus of hyperthermophilic, chemolithoautotrophic Archaea,

More information

JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb

JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05345-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Background. Biogeochemical Role. Archaeal Nitrification in the Ocean by Cornelia Wutcher et al Presenters: Brian Drupieski and Megan McCurdy

Background. Biogeochemical Role. Archaeal Nitrification in the Ocean by Cornelia Wutcher et al Presenters: Brian Drupieski and Megan McCurdy Archaeal Nitrification in the Ocean by Cornelia Wutcher et al. 2006. Presenters: Brian Drupieski and Megan McCurdy Background Crenarchaeota From the kingdom Archaea Most abundant oceanic prokaryote Limited

More information

Biofilm and Nanowire Production Leads to Increased Current

Biofilm and Nanowire Production Leads to Increased Current AEM Accepts, published online ahead of print on August 00 Appl. Environ. Microbiol. doi:./aem.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.

More information

Author for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de

Author for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2101 2108 Printed in Great Britain Thermococcus aegaeicus sp. nov. and Staphylothermus hellenicus sp. nov., two novel hyperthermophilic

More information

Author for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de

Author for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2101 2108 Printed in Great Britain Thermococcus aegaeicus sp. nov. and Staphylothermus hellenicus sp. nov., two novel hyperthermophilic

More information

Final Exam : Take-home questions MB 451 Microbial Diversity

Final Exam : Take-home questions MB 451 Microbial Diversity Final Exam : Take-home questions MB 451 Microbial Diversity Honor pledge: I have neither given nor received unauthorized aid on this test. The Rules : You are allowed to use any book or online resources

More information

Phylogenetic Diversity Analysis of Subterranean Hot Springs in Iceland

Phylogenetic Diversity Analysis of Subterranean Hot Springs in Iceland APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2001, p. 4242 4248 Vol. 67, No. 9 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.9.4242 4248.2001 Copyright 2001, American Society for Microbiology. All Rights

More information

A functional gene approach to studying nitrogen cycling in the sea. Matthew Church (MSB 612 / March 20, 2007

A functional gene approach to studying nitrogen cycling in the sea. Matthew Church (MSB 612 / March 20, 2007 A functional gene approach to studying nitrogen cycling in the sea Matthew Church (MSB 612 / 6-8779 mjchurch@hawaii.edu) March 20, 2007 Overview Climate change, carbon cycling, and ocean biology Distributions

More information

Microbiology Journal Club

Microbiology Journal Club Microbiology Journal Club Sept 13, 2005 - Jim Brown The papers for today are: A monogram: Huber H, Hohn MJ, Rachel R, Fuchs T, Wimmer VC, Stetter KO. 2002. A new phylum of Archaea represented by a nanosized

More information

Genomic adaptations to life limit conditions: Comparative and functional genomics of extremophilic Archaea and Bacteria

Genomic adaptations to life limit conditions: Comparative and functional genomics of extremophilic Archaea and Bacteria PhD Project (2014-2017) Genomic adaptations to life limit conditions: Comparative and functional genomics of extremophilic Archaea and Bacteria Summary This project proposes to explore the genomic diversity

More information

Minimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus

Minimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus Archaea 1, 191 197 2003 Heron Publishing Victoria, Canada Minimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus XIAOLEI HAO 1 and

More information

Mechanisms for Extracellular Electron Exchange by Geobacter Species

Mechanisms for Extracellular Electron Exchange by Geobacter Species University of Massachusetts Amherst ScholarWorks@UMass Amherst Doctoral Dissertations Dissertations and Theses Spring 2015 Mechanisms for Extracellular Electron Exchange by Geobacter Species Jessica A.

More information

Climate change, food safety and human health: marine pathogenic bacteria

Climate change, food safety and human health: marine pathogenic bacteria Climate change, food safety and human health: diversity and epidemics of climate-related marine pathogenic bacteria Lanming Chen Shanghai Ocean University Global climate change CO 2 reservoir atmosphere

More information

ACCEPTED. Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA

ACCEPTED. Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA JB Accepts, published online ahead of print on 8 December 2006 J. Bacteriol. doi:10.1128/jb.01284-06 Copyright 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights

More information

Methanococcus infernus sp. nov., a novel hyperthermophilic lithotrophic methanogen isolated f rom a deep-sea hydrothermal vent

Methanococcus infernus sp. nov., a novel hyperthermophilic lithotrophic methanogen isolated f rom a deep-sea hydrothermal vent International Journal of Systematic Bacteriology (1 998), 48, 9 1 3-9 1 9 Printed in Great Britain Methanococcus infernus sp. nov., a novel hyperthermophilic lithotrophic methanogen isolated f rom a deep-sea

More information

Contaminant Bioremediation

Contaminant Bioremediation Contaminant Bioremediation Petroleum hydrocarbons, chlorinated solvents, metals and radionuclides Dr. Al Cunningham Center for Biofilm Engineering Montana State University Bozeman MT USA Natural Attenuation

More information

1 6 S rdna primers and the unbiased assessment of thermophile diversity

1 6 S rdna primers and the unbiased assessment of thermophile diversity Baker, G.C. & Cowan, D.A. (2004). 16S rdna primers and the unbiased assessment of thermophile diversity. BIOCHEMICAL SOCIETY TRANSACTIONS, 32:218-221. 1 6 S rdna primers and the unbiased assessment of

More information

Pyrobaculum aerophilum sp. nov., a Novel Nitrate-Reducing Hyperthermophilic Archaeum

Pyrobaculum aerophilum sp. nov., a Novel Nitrate-Reducing Hyperthermophilic Archaeum APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1993, p. 2918-2926 Vol. 59, No. 9 99-224/93/92918-9$2./ Copyright 1993, American Society for Microbiology Pyrobaculum aerophilum sp. nov., a Novel Nitrate-Reducing

More information

Dissimilatory Metal Reduction by the Facultative Anaerobe Pantoea agglomerans SP1

Dissimilatory Metal Reduction by the Facultative Anaerobe Pantoea agglomerans SP1 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2000, p. 543 548 Vol. 66, No. 2 0099-2240/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Dissimilatory Metal Reduction

More information

AcO O OH 4''' 3''' 1''' 5''' 2'''

AcO O OH 4''' 3''' 1''' 5''' 2''' a b 6' 7' 6'' 7'' O 5' 8' 5'' 4' 9' NH 3' 4'' 3'' 2'' 1'' 2' OH O 1' 5''' O AcO O OH 19 10 9 18 11 16 12 8 7 6 15 17 3 5 4 13 14 4''' 6''' 1 2 20 O H HO O OAc 3''' 7''' 2''' 1''' O c Supplementary Figure

More information

Microbe Power. What can bacteria teach us about Energy, the Environment, and Nanotechnology?

Microbe Power. What can bacteria teach us about Energy, the Environment, and Nanotechnology? Microbe Power What can bacteria teach us about Energy, the Environment, and Nanotechnology? Moh El-Naggar Physics and Astronomy, University of Southern California Physics Instant Update: Workshop for High

More information

Thermogladius calderae gen. nov., sp. nov., an anaerobic, hyperthermophilic crenarchaeote from a Kamchatka hot spring

Thermogladius calderae gen. nov., sp. nov., an anaerobic, hyperthermophilic crenarchaeote from a Kamchatka hot spring International Journal of Systematic and Evolutionary Microbiology (2016), 66, 1407 1412 DOI 10.1099/ijsem.0.000916 Thermogladius calderae gen. nov., sp. nov., an anaerobic, hyperthermophilic crenarchaeote

More information

Hyperthermophilic microorganisms

Hyperthermophilic microorganisms FEMS Microbiology Reviews 75 (1990) 117124 Published by Elsevier FEMSRE 00133 Hyperthermophilic microorganisms K.O. Steuer, G. Fiala, G. Huber, R. Huber and A. Segerer Lehrstuhl für Mikrobiologie, Universität

More information

Evaluation of electron-shuttling compounds in microbial ferric iron reduction

Evaluation of electron-shuttling compounds in microbial ferric iron reduction FEMS Microbiology Letters 220 (2003) 229^233 www.fems-microbiology.org Evaluation of electron-shuttling compounds in microbial ferric iron reduction Abstract Kristina L. Straub, Bernhard Schink Fakulta«t

More information

Multiple Chromosomal Loci for the baba Gene in Helicobacter pylori

Multiple Chromosomal Loci for the baba Gene in Helicobacter pylori INFECTION AND IMMUNITY, May 2006, p. 3046 3051 Vol. 74, No. 5 0019-9567/06/$08.00 0 doi:10.1128/iai.74.5.3046 3051.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Multiple

More information

Molecular Methods in Microbial Ecology

Molecular Methods in Microbial Ecology Molecular Methods in Microbial Ecology Contact Info: Julie Huber, jhuber@whoi.edu Schedule: Tuesday 10/24/17 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday 10/26/17

More information

Pyrococcus kukulkanii sp. nov., a hyperthermophilic, piezophilic archaeon isolated from a deep-sea hydrothermal vent

Pyrococcus kukulkanii sp. nov., a hyperthermophilic, piezophilic archaeon isolated from a deep-sea hydrothermal vent International Journal of Systematic and Evolutionary Microbiology (2016), 66, 3142 3149 DOI 10.1099/ijsem.0.001160 Pyrococcus kukulkanii sp. nov., a hyperthermophilic, piezophilic archaeon isolated from

More information

In Situ Remediation (ISR MT3DMS TM ) Features: Reactions

In Situ Remediation (ISR MT3DMS TM ) Features: Reactions In Situ Remediation (ISR MT3DMS TM ) Features: Reactions October 5, 2015 ISR MT3DMS TM Reactions 1 Introduction The core reaction framework in ISR MT3DMS TM was developed using the public domain reaction

More information

PCR KIT/REAGENTS/BUFFERS/PRIMERS

PCR KIT/REAGENTS/BUFFERS/PRIMERS PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all

More information

Expressing the β-glucosidase Gene as a Reporter in the Hyperthermophilic Archaeon Pyrococcus furiosus

Expressing the β-glucosidase Gene as a Reporter in the Hyperthermophilic Archaeon Pyrococcus furiosus Portland State University PDXScholar University Honors Theses University Honors College 5-26-2018 Expressing the β-glucosidase Gene as a Reporter in the Hyperthermophilic Archaeon Pyrococcus furiosus Arman

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels

More information

FedEx Express. Effective Jan. 1, Rates

FedEx Express. Effective Jan. 1, Rates FedEx Express Effective Jan. 1, 2007 Rates Table of Contents FedEx Express Intra-Canada Rates 2 Postal Code Index 3 FedEx First Overnight 4 FedEx Intra-Canada Index 12 FedEx Priority Overnight 14 FedEx

More information

A genome probe survey of the microbial community in oil fields

A genome probe survey of the microbial community in oil fields A genome probe survey of the microbial community in oil fields Gerrit Voordouw, Anita J. Telang Department of Biological Sciences, University of Calgary, Calgary, Alberta, Canada, T2N 1N4 ABSTRACT Oil

More information

Isolation and Characterization of Antibiotic-producing Actinomycetes from hot spring sediment of Thailand

Isolation and Characterization of Antibiotic-producing Actinomycetes from hot spring sediment of Thailand Isolation and Characterization of Antibiotic-producing Actinomycetes from hot spring sediment of Thailand Chitti Thawai Department of Biology and Microbial Resource Management Unit, Scientific Instrument

More information

Supplementary Figure 2. TEM images of the sludge inoculum.

Supplementary Figure 2. TEM images of the sludge inoculum. Supplementary Figures Supplementary Figure 1. MFC with methane as the mainn carbon source. (a) Schematic showing air- and adapted M. acetivorans containing pes1-matmcr3 (AA/pES1-MATmcr3), G. sulfurreducens,

More information

Thermococcus fumicolans sp. nov., a New Hyperthermophilic

Thermococcus fumicolans sp. nov., a New Hyperthermophilic INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, 00207713/96/$04.00 + 0 Copyright 0 1996, International Union of Microbiological Societies OCt. 1996, p. 11 1311 19 Vol. 46. No. 4 Thermococcus fumicolans

More information

FedEx Express Rates. Effective Jan. 4, 2010

FedEx Express Rates. Effective Jan. 4, 2010 FedEx Express Rates Effective Jan. 4, 2010 Table of Contents FedEx Express Intra-Canada Rates 2 Postal Code Index 3 Intra-Canada Index 4 FedEx First Overnight 6 FedEx Priority Overnight 12 FedEx 2Day 18

More information

Characterization of Plasmid prt1 from Pyrococcus sp. Strain JT1

Characterization of Plasmid prt1 from Pyrococcus sp. Strain JT1 JOURNAL OF BACTERIOLOGY, May 2002, p. 2561 2566 Vol. 184, No. 9 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.9.2561 2566.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Characterization

More information

Characterization of Plasmid prt1 from Pyrococcus sp. Strain JT1

Characterization of Plasmid prt1 from Pyrococcus sp. Strain JT1 JOURNAL OF BACTERIOLOGY, May 2002, p. 2561 2566 Vol. 184, No. 9 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.9.2561 2566.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Characterization

More information

Received 20 March 2001/Accepted 4 July 2001

Received 20 March 2001/Accepted 4 July 2001 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2001, p. 4566 4572 Vol. 67, No. 10 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.10.4566 4572.2001 Copyright 2001, American Society for Microbiology. All Rights

More information

Received 8 April 2011/Accepted 14 July 2011

Received 8 April 2011/Accepted 14 July 2011 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2011, p. 6343 6349 Vol. 77, No. 18 0099-2240/11/$12.00 doi:10.1128/aem.05057-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Defining

More information

Molecular Methods in Microbial Ecology

Molecular Methods in Microbial Ecology Molecular Methods in Microbial Ecology Contact Info: Julie Huber Lillie 305 x7291 jhuber@mbl.edu Schedule: 26 Oct: Introductory Lecture, DNA extraction 28 Oct: Run DNA products on gel Lecture on PCR Prepare

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during

More information

Thermosipho geolei sp. nov., a thermophilic bacterium isolated from a continental petroleum reservoir in Western Siberia

Thermosipho geolei sp. nov., a thermophilic bacterium isolated from a continental petroleum reservoir in Western Siberia International Journal of Systematic and Evolutionary Microbiology (2001), 51, 1327 1334 Printed in Great Britain Thermosipho geolei sp. nov., a thermophilic bacterium isolated from a continental petroleum

More information

Multip,le influences of nitrate on uranium solubility durin~1 bioremediation of uranium-contaminated subsurface sediments

Multip,le influences of nitrate on uranium solubility durin~1 bioremediation of uranium-contaminated subsurface sediments Environmental Microbiology (22) 4(9), 51-516 Multip,le influences of nitrate on uranium solubility durin1 bioremediation of uranium-contaminated subsurface sediments Kevin T. Finneran,t Meghan E. Housewright

More information

In Vivo Observation of Cell Division of Anaerobic Hyperthermophiles by Using a High-Intensity Dark-Field Microscope

In Vivo Observation of Cell Division of Anaerobic Hyperthermophiles by Using a High-Intensity Dark-Field Microscope JOURNAL OF BACTERIOLOGY, Aug. 1999, p. 5114 5118 Vol. 181, No. 16 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. In Vivo Observation of Cell Division of Anaerobic

More information

FedEx Express Rates. Effective January 4, 2016

FedEx Express Rates. Effective January 4, 2016 FedEx Express ates Effective January 4, 2016 Introduction The FedEx Express portfolio of shipping services has been designed to help address your unique needs whether you are shipping near or far, to clients

More information

A genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide

A genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide emi4_35 1..7 Environmental Microbiology Reports (211) doi:1.1111/j.1758-2229.211.35.x A genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide Pier-Luc

More information

Microbe-Electrode-Interactions

Microbe-Electrode-Interactions Microbe-Electrode-Interactions Johannes Gescher Institut for Applied Biosciences, Applied Biology KIT Universität des Landes Baden-Württemberg und nationales Forschungszentrum in der Helmholtz-Gemeinschaft

More information

ENVE 424 Anaerobic Treatment. Review Lecture Fall Assist. Prof. A. Evren Tugtas

ENVE 424 Anaerobic Treatment. Review Lecture Fall Assist. Prof. A. Evren Tugtas ENVE 424 Anaerobic Treatment Review Lecture 2012-2013 Fall Assist. Prof. A. Evren Tugtas Basics of Microbiology Principles of microbiology is applied to the solution of environmental problems Treatment

More information

isolates with a novel primer by PCR

isolates with a novel primer by PCR JCM Accepts, published online ahead of print on 2 February 2011 J. Clin. Microbiol. doi:10.1128/jcm.00461-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All

More information

Protocol for tissue-specific gene disruption in zebrafish

Protocol for tissue-specific gene disruption in zebrafish Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function

More information

Archaeoglobus fulgidus Isolated from Hot North Sea

Archaeoglobus fulgidus Isolated from Hot North Sea APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1994, p. 1227-1231 Vol. 60, No. 4 0099-2240/94/$04.00+0 Copyright 1994, American Society for Microbiology Archaeoglobus fulgidus Isolated from Hot North Sea

More information

Gene Duplications in Evolution of Archaeal Family B DNA Polymerases

Gene Duplications in Evolution of Archaeal Family B DNA Polymerases JOURNAL OF BACTERIOLOGY, Apr. 1997, p. 2632 2640 Vol. 179, No. 8 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Gene Duplications in Evolution of Archaeal Family B DNA Polymerases

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major

More information

Nitrogen Cycling in the Sea

Nitrogen Cycling in the Sea Nitrogen Cycling in the Sea NH 4 + N0 2 N0 2 NH 4 + Outline Nitrogen species in marine watersdistributions and concentrations New, regenerated, and export production The processes: Assimilation, N 2 fixation,

More information

Determining the f ratio 11/16/2010. Incubate seawater in the presence of trace 15

Determining the f ratio 11/16/2010. Incubate seawater in the presence of trace 15 Plankton production is supported by 2 types of nitrogen: 1) new production supported by external sources of N (e.g. NO 3 and N 2 ), 2) recycled or regenerated production, sustained by recycling of N. Assumptions:

More information

S5-3 Yu-Guang ZHOU (Institution of Microbiology, Chinese Academy of Sciences) Recent Activities of the CGMCC

S5-3 Yu-Guang ZHOU (Institution of Microbiology, Chinese Academy of Sciences) Recent Activities of the CGMCC Session 5 Microbe S5-1 Moriya Ohkuma (Japan Collection of Microorganisms (JCM), RIKEN BioResource Center) Activities of RIKEN BRC-JCM to Respond Demands of Scientific Community S5-2 Ken-ichiro Suzuki (NITE

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin

More information

Genomic and Proteomic Analysis of Deep Underground Microbial Communities

Genomic and Proteomic Analysis of Deep Underground Microbial Communities Genomic and Proteomic Analysis of Deep Underground Microbial Communities Kenneth F. Reardon, Chemical & Biological Engineering, Colorado State University Amy Pruden, Civil & Environmental Engineering,

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes

More information

Received 7 November 2002/Accepted 5 February 2003

Received 7 November 2002/Accepted 5 February 2003 APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2003, p. 2985 2993 Vol. 69, No. 5 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.5.2985 2993.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.

More information

FedEx Express Rates. Effective January 6, 2014

FedEx Express Rates. Effective January 6, 2014 FedEx Express ates Effective January 6, 201 Introduction The FedEx Express portfolio of shipping services has been designed to help address your unique needs whether you are shipping near or far, to clients

More information

The Complete Genome Sequence of Thermococcus onnurineus NA1 Reveals a Mixed Heterotrophic and Carboxydotrophic Metabolism

The Complete Genome Sequence of Thermococcus onnurineus NA1 Reveals a Mixed Heterotrophic and Carboxydotrophic Metabolism JOURNAL OF BACTERIOLOGY, Nov. 2008, p. 7491 7499 Vol. 190, No. 22 0021-9193/08/$08.00 0 doi:10.1128/jb.00746-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. The Complete Genome

More information

APPENDIX D. MATERIAL TEST RESULTS

APPENDIX D. MATERIAL TEST RESULTS APPENDIX D. MATERIAL TEST RESULTS Tensile coupon testing was used to characterize the steel plate used to make the five connection members, gusset plates, and splice plates. Testing was performed according

More information

Phytoplankton and bacterial biomass, production and growth in various ocean ecosystems

Phytoplankton and bacterial biomass, production and growth in various ocean ecosystems Phytoplankton and bacterial biomass, production and growth in various ocean ecosystems Location Bact. Biomass (mg C m -2 ) Phyto. Biomass (mg C m -2 ) BactB: PhytoB BactP (mg C m -2 d -1 ) 1 o Pro (mg

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin

More information

Freight containers Coding, identification and marking Amendment 3

Freight containers Coding, identification and marking Amendment 3 Provläsningsexemplar / Preview INTERNATIONAL STANDARD ISO 6346 Third edition 1995-12-01 AMENDMENT 3 2012-12-01 Freight containers Coding, identification and marking Amendment 3 Conteneurs pour le transport

More information

Defining Components of the Chromosomal Origin of Replication. for Construction of a Stable Replicating Shuttle Vector

Defining Components of the Chromosomal Origin of Replication. for Construction of a Stable Replicating Shuttle Vector AEM Accepts, published online ahead of print on 22 July 2011 Appl. Environ. Microbiol. doi:10.1128/aem.05057-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.

More information

Should we focus only on P load when aiming to reduce eutrophication in a P-limited aquatic system?

Should we focus only on P load when aiming to reduce eutrophication in a P-limited aquatic system? Should we focus only on P load when aiming to reduce eutrophication in a P-limited aquatic system? Petri Ekholm & Jouni Lehtoranta Finnish Environment Institute (SYKE) International Phosphorus Workshop

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes

More information