Figure S1. Phylogenetic tree comparing c-type cytochrome proteins from Ferroglobus placidus to c-type cytochromes from other bacterial and archaeal
|
|
- Marianna Wendy Poole
- 6 years ago
- Views:
Transcription
1 Fiure S1. Phyloenetic tree comparin c-type cytochrome proteins from Ferrolobus placidus to c-type cytochromes from other bacterial and archaeal species. 1
2 Fiure S2. Alternative complex III operons found in Ferrolobus placidus (locus id: Ferp), Geobacter bemidjiensis (Gbem), G. metallireducens (Gmet), G. daltonii (Geob), G. sulfurreducens (GSU), G. uraniireducnes (Gura), G. bremensis (K419DRAFT), strain M18 (GM18), strain M21 (GM21), Geopsychrobacter electrodiphilus (D888DRAFT), Anaeromyxobacter sp. FW109-5 (Anae109), A. dehaloenans (Adeh), Desulfocapsa sulfexiens (UWK), and Desulfobacula toluolica (TOL2). 2
3 Table S1. Primers used to quantify different mrna transcripts from F. placidus by quantitative RT-PCR. Locus ID Ferp_0660 Ferp_0668 Ferp_0670 Ferp_0672 Ferp_1255 Ferp_1267 Ferp_1336 Ferp_1341 Ferp_1813 Ferp_1814 Ferp_2064 Primer name Ferp_ f/336r Ferp_ f/550r Ferp_ f/2184r Ferp_ f/4410r Ferp_ f/313r Ferp_ f/434r Ferp_ f/613r Ferp_ f/619r Ferp_ f/309r Ferp_ f/256r Ferp_ f/537r Forward primer (5 3 ) Reverse primer (5 3 ) TTACACGGAGTCGACGTTTG CAGCTTGTAGTGGGGATCGT CACAGACCGTGGGTTCTTTCA CGTGGGTGTGACAGCCTATG CATCAGGTTCGGAAGGGACATA GGCATAGTGGGAGACCGTAGAG CGCCGACAATCTTTCAATACTG CCCGTTTACTGCCCTGTTCTC GACGTTGGCAACAACTACGA AGAGGACGTCTTTGGCGTAA ATTCTGCCTGAACTGCCACAA CAAACCGTACAAGGCTTATCCG CAAAATACAAGCCGCCGAAA CGGATGCTTTACACCAGTTGG CGATTACAGTTTTGCGACGA CGAGGAAGACCGTGAAGAAG CGCCAACACCAAAACCTACT GTTACCGCAGAGCTGTCCTC CAACAATCCGAAGAGGCAAT GGCAGGAAATGCAGTAATCG ATGCCATAAACGGATTGAGACA GGCGAAGCACCAGAAGTTG 3
4 Table S2. Evaluation of c-type cytochromes present in the enomes of hyperthermophilic archaea. Hyperthermophilic archaeon Archaeolobus fulidus Geolobus acetivorans Caldivira maquilinensis Ferrolobus placidus Methanopyrus kandleri Pyrobaculum aerophilum Pyrobaculum islandicum Tempera ture rane or optimum ( C) Total putat ive cyt c enes with 1 motif with 2-5 motifs with 6-19 motifs with 20+ motifs Electron acceptors utilized Fe(III), SO 2-4, SO 2-3, S 2 O 2-3 (1-3) Fe(III) (4, 5) SO 2-4, SO 2-3, S 2 O 2-3, NO - 3, Fe(III) (6) Fe(III), S 2 O 2-3, NO - 3 (7, 8) Fe(III), CO 2 (3, 9) O 2, NO - 3, NO - 2, Fe(III) (10, 11) SO 2-4, SO 2-3, S 2 O 2-3, Fe(III), Mn(IV), U(VI), Tc(VII), Cr(VI), Co(III) (12, 13) NO - 3, AsO 3-4, S 2 O 2-3, Fe(III) (14) Pyrobaculum sp Pyrococcus abyssi fermentative, Fe(III) (3, 15) Pyrococcus furiosus fermentative, Fe(III) (3, 16, 17) 4
5 References 1. Beeder J, Nilsen RK, Rosnes JT, Torsvik T, Lien T Archaeolobus fulidus isolated from hot North-Sea-oil field waters. Appl. Environ. Microbiol. 60: Klenk HP, Clayton RA, Tomb JF, White O, Nelson KE, Ketchum KA, Dodson RJ, Gwinn M, Hickey EK, Peterson JD, Richardson DL, Kerlavae AR, Graham DE, Kyrpides NC, Fleischmann RD, Quackenbush J, Lee NH, Sutton GG, Gill S, Kirkness EF, Douherty BA, McKenney K, Adams MD, Loftus B, Peterson S, Reich CI, McNeil LK, Bader JH, Glodek A, Zhou LX, Overbeek R, Gocayne JD, Weidman JF, McDonald L, Utterback T, Cotton MD, Spris T, Artiach P, Kaine BP, Sykes SM, Sadow PW, DAndrea KP, Bowman C, Fujii C, Garland SA, Mason TM, Olsen GJ, Fraser CM, Smith HO, Woese CR, Venter JC The complete enome sequence of the hyperthermophilic, sulphate-reducin archaeon Archaeolobus fulidus. Nature 390:364-&. 3. Varas M, Kashefi K, Blunt-Harris EL, Lovley DR Microbioloical evidence for Fe(III) reduction on early Earth. Nature 395: Mardanov AV, Slododkina GB, Slobodkin AI, Beletsky AV, Gavrilov SN, Kublanov IV, Bonch-Osmolovskaya EA, Skryabin KG, Ravin NV The enome of Geolobus acetivorans: Fe(III) reduction, acetate utilization, autotrophic rowth and deradation of aromatic compounds in a hyperthermophilic archaeon. Appl. Environ. Microb. doi: /AEM Slobodkina GB, Kolanova TV, Querellou J, Bonch-Osmolovskaya EA, Slobodkin AI Geolobus acetivorans sp. nov., an iron(iii)-reducin archaeon from a deepsea hydrothermal vent. Internat. J. Sys. Evol. Microbiol. 59:
6 6. Itoh T, Suzuki K, Sanchez PC, Nakase T Caldivira maquilinensis en. nov., sp nov., a new enus of rod-shaped crenarchaeote isolated from a hot sprin in the Philippines. Int. J. Syst. Bacteriol. 49: Hafenbradl D, Keller M, Dirmeier R, Rachel R, Rossnael P, Burraf S, Huber H, Stetter KO Ferrolobus placidus en nov, sp nov, a novel hyperthermophilic archaeum that oxidizes Fe 2+ at neutral ph under anoxic conditions. Arch. Microbiol. 166: Tor JM, Kashefi K, Lovley DR Acetate oxidation coupled to Fe(III) reduction in hyperthermophilic microoranisms. Appl. Environ. Microb. 67: Kurr M, Huber R, Koni H, Jannasch HW, Fricke H, Trincone A, Kristjansson JK, Stetter KO Methanopyrus kandleri, Gen and Sp-nov represents a novel roup of hyperthermophilic methanoens, rowin at 110-derees-C. Arch. Microbiol. 156: Volkl P, Huber R, Drobner E, Rachel R, Burraf S, Trincone A, Stetter KO Pyrobaculum aerophilum sp-nov, a novel nitrate-reducin hyperthermophilic archaeum. Appl. Environ. Microb. 59: Feinber LF, Holden JF Characterization of dissimilatory Fe(III) versus NO 3 - reduction in the hyperthermophilic archaeon Pyrobaculum aerophilum. J. Bacteriol. 188: Huber R, Kristjansson JK, Stetter KO Pyrobaculum en-nov, a new enus of neutrophilic, rod-shaped Archaebacteria from continental solfataras rowin optimally at 100-Derees-C. Arch. Microbiol. 149:
7 13. Kashefi K, Lovley DR Reduction of Fe(III), Mn(IV), and toxic metals at 100 derees C by Pyrobaculum islandicum. Appl. Environ. Microb. 66: Mardanov AV, Gumerov VM, Slobodkina GB, Beletsky AV, Bonch-Osmolovskaya EA, Ravin NV, Skryabina KG Complete enome sequence of strain 1860, a crenarchaeon of the enus Pyrobaculum able to row with various electron acceptors. J. Bacteriol. 194: Erauso G, Reysenbach AL, Godfroy A, Meunier JR, Crump B, Partensky F, Baross JA, Marteinsson V, Barbier G, Pace NR, Prieur D Pyrococcus abyssi sp-nov, a new hyperthermophilic archaeon isolated from a deep-sea hydrothermal vent. Arch. Microbiol. 160: Fiala G, Stetter KO Pyrococcus furiosus sp-nov represents a novel enus of marine heterotrophic Archaebacteria rowin optimally at 100-Derees C. Arch. Microbiol. 145: Robb FT, Maeder DL, Brown JR, DiRuiero J, Stump MD, Yeh RK, Weiss RB, Dunn DM Genomic sequence of hyperthermophile, Pyrococcus furiosus: implications for physioloy and enzymoloy. Methods Enzymol. 330:
A Novel DNA Polymerase Family Found in Archaea
JOURNAL OF BACTERIOLOGY, Apr. 1998, p. 2232 2236 Vol. 180, No. 8 0021-9193/98/$04.00 0 Copyright 1998, American Society for Microbiology A Novel DNA Polymerase Family Found in Archaea YOSHIZUMI ISHINO,
More informationPyrobaculum ferrireducens sp. nov., a hyperthermophilic Fe(III)-, selenate- and arsenatereducing crenarchaeon isolated from a hot spring
International Journal of Systematic and Evolutionary Microbiology (2015), 65, 851 856 DOI 10.1099/ijs.0.000027 Pyrobaculum ferrireducens sp. nov., a hyperthermophilic Fe(III)-, selenate- and arsenatereducing
More informationInsight into mechanisms involved in Fe(III) respiration by the hyperthermophilic
AEM Accepted Manuscript Posted Online 6 February 2015 Appl. Environ. Microbiol. doi:10.1128/aem.04038-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 2 Insight into mechanisms
More informationPyrococcus CH1, an obligate piezophilic hyperthermophile: extending the upper pressure-temperature limits for life
July 009; Volume 3 (7) : Pages 873 876 http://dx.doi.org/10.1038/ismej.009.1 Copyright 009 Nature Publishing Group Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original
More informationHYPERTHERMOPHILES - GEOCHEMICAL AND INDUSTRIAL IMPLICATIONS. Harald Huber
HYPERTHERMOPHILES - GEOCHEMICAL AND INDUSTRIAL IMPLICATIONS Harald Huber Department of Microbiology, University of Regensburg Universitätsstrasse 31 8400 Regensburg, FRG Abstract Hyperthermophiles, growing
More informationThermophilic microorganisms capable of degrading biopolymers
Thermophilic microorganisms capable of degrading biopolymers Ilya V. Kublanov Laboratory of hyperthermophilic microbial communities, Winogradsky Institute of Microbiology, Russian Academy of Sciences Summary
More informationHyperthermophiles: optimum for them is extreme for the rest
Hyperthermophiles: optimum for them is extreme for the rest 1,2,3 I. Valentin Petrescu-Mag, 1 Claudiu Gavriloaie, 1 Miklos Botha 1 Bioflux SRL, Cluj-Napoca, Romania; 2 Department of Environment and Plant
More informationMechanisms for Accessing Insoluble Fe(III) Oxide During Dissimilatory Fe(III) Reduction by Geothrix Fermentans
University of Massachusetts Amherst From the SelectedWorks of Kelly Nevin May 1, 2002 Mechanisms for Accessing Insoluble Fe(III) Oxide During Dissimilatory Fe(III) Reduction by Geothrix Fermentans Kelly
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control Genes We Targeted
More informationReceived 17 December 1996/Accepted 15 April 1997
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 1997, p. 2876 2883 Vol. 63, No. 7 0099-2240/97/$04.00 0 Copyright 1997, American Society for Microbiology Distribution of Microorganisms in Deep-Sea Hydrothermal
More informationCharacterization of a Noncanonical Purine dntp Pyrophosphatase from Archaeoglobus fulgidus
J. Microbiol. Biotechnol. (2006),G16(7), 1144 1148 Characterization of a Noncanonical Purine dntp Pyrophosphatase from Archaeoglobus fulgidus IM, EUN KYOUNG 1,2, CHANG HYUNG HONG 1, JUNG HO BACK 3, YE
More information(1) Université Bretagne Occidentale (UBO), IUEM (Institut Universitaire Européen de la
JB Accepts, published online ahead of print on January 0 J. Bacteriol. doi:.1/jb.00- Copyright 0, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 Genome
More informationInternational Journal of Systematic and Evolutionary Microbiology (2002), 52,
International Journal of Systematic and Evolutionary Microbiology (2002), 52, 1097 1104 DOI: 10.1099/ijs.0.02152-0 Vulcanisaeta distributa gen. nov., sp. nov., and Vulcanisaeta souniana sp. nov., novel
More informationInternational Journal of Systematic and Evolutionary Microbiology (2002), 52,
International Journal of Systematic and Evolutionary Microbiology (2002), 52, 719 728 DOI:.99/ijs.0.01953-0 Geoglobus ahangari gen. nov., sp. nov., a novel hyperthermophilic archaeon capable of oxidizing
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Genes We Targeted 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5: Archaea + 950bp 6: Negative control
More informationPyrolobus fumarii, gen. and sp. nov., represents a novel group of archaea, extending the upper temperature limit for life to 113 C
Extremophiles 14 (1997) 1:14 21 N. Matsuda et al.: EGF receptor and osteoblastic Springer-Verlag differentiation 1997 ORIGINAL PAPER Elisabeth Blöchl Reinhard Rachel Siegfried Burggraf Doris Hafenbradl
More informationDay 3. Examine gels from PCR. Learn about more molecular methods in microbial ecology. Tour the Bay Paul Center Keck Sequencing Facility
Day 3 Examine gels from PCR Learn about more molecular methods in microbial ecology Tour the Bay Paul Center Keck Sequencing Facility 1: dsrab 1800bp 2: mcra 750bp 3: Bacteria 1450bp 4: Archaea 950bp 5:
More informationApproaches to Vaccine Development Using Bioinformatics. Vaccine development has traditionally been a lengthy process. Animal studies with specific
Approaches to Vaccine Development Using Bioinformatics 12 December 2002 Vaccine development has traditionally been a lengthy process. Animal studies with specific pathogens are used to find proteins that
More informationFinal Exam. MB 451 : Microbial Diversity Spring Honor pledge: I have neither given nor received unauthorized aid on this test.
Final Exam MB 451 : Microbial Diversity Spring 2010 Honor pledge: I have neither given nor received unauthorized aid on this test. Signed : Date : Name : 1. What are the 3 primary evolutionary branches
More informationusing their genomic DNA sequences
No. 8] Proc. Japan Acad., 75, Ser. B (1999) 241 Comparison of p athways for amino acid biosynthesis in archaebacteria using their genomic DNA sequences By Sadaharu HIGucHI,*) Tsuyoshi KAWASHIMA,*) and
More informationArchaeoglobus sulfaticallidus sp. nov., a novel thermophilic and facultatively
IJSEM Papers in Press. Published January 8, 2010 as doi:10.1099/ijs.0.016105-0 1 2 3 4 5 Archaeoglobus sulfaticallidus sp. nov., a novel thermophilic and facultatively lithoautotrophic sulfate-reducer
More informationISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA ABSTRACT
ISOLATION AND MOLECULAR CHARACTERIZATION OF THERMOTOLERANT BACTERIA FROM MANIKARAN THERMAL SPRING OF HIMACHAL PRADESH, INDIA Ambika Verma 1*, & Poonam Shirkot 2 1*Ph.D Scholar, Department of Biotechnology,
More informationThermococcus onnurineus sp. nov., a Hyperthermophilic Archaeon Isolated from a Deep-Sea Hydrothermal Vent Area at the PACMANUS Field
J. Microbiol. Biotechnol. (2006),G16(11), 1826 1831 hermococcus onnurineus sp. nov., a Hyperthermophilic Archaeon Isolated from a Deep-Sea Hydrothermal Vent Area at the PACMANUS Field BAE, SEUNG SEOB,
More informationMetabolism Lectures. Outline:! Part I: Fermentations! Part II: Respiration! Part III: Metabolic Diversity
Outline:! Part I: Fermentations! Part II: Respiration! Part III: Metabolic Diversity Metabolism Lectures Learning objectives are:! Learn about anaerobic respiratory metabolisms.! How can an inorganic compound
More informationI give permission for public access to my thesis and for copying to be done at the discretion of the archives librarian and/or the College library.
I give permission for public access to my thesis and for copying to be done at the discretion of the archives librarian and/or the College library. Signature Date EXPLORING BIOTIC IRON TRANSFORMATION BY
More informationThe distribution, diversity, and importance of 16S rrna gene introns in the order Thermoproteales
Jay and Inskeep Biology Direct (2015) 10:35 DOI 10.1186/s13062-015-0065-6 RESEARCH The distribution, diversity, and importance of 16S rrna gene introns in the order Thermoproteales Zackary J. Jay and William
More information1 Keywords: archaea, barophile, Thermococcus, hyperthermophile, deep-sea vent I
lnternational Journal of Systematic Bacterio/ogy (1 999),49, 3 5 1-359 Printed in Great Britain Thermococcus barophilus sp. nov., a new barophilic and hyperthermophilic archaeon isolated under high hydrostatic
More informationAnne Postec, Patricia Pignet, Valérie Cueff-Gauchard, Anne Schmitt, Joël Querellou and Anne Godfroy *
Research in Microbiology JAN-FEB 2005; 156 (1) : 82-87 http://dx.doi.org/10.1016/j.resmic.2004.08.001 @ 2004 Elsevier SAS All rights reserved Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle
More informationAuthor for correspondence: Karl O. Stetter. Tel: Fax: Karl.Stetter biologie.uni-regensburg.
International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2093 2100 Printed in Great Britain Ignicoccus gen. nov., a novel genus of hyperthermophilic, chemolithoautotrophic Archaea,
More informationJB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi: /jb
JB Accepts, published online ahead of print on 24 June 2011 J. Bacteriol. doi:10.1128/jb.05345-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationBackground. Biogeochemical Role. Archaeal Nitrification in the Ocean by Cornelia Wutcher et al Presenters: Brian Drupieski and Megan McCurdy
Archaeal Nitrification in the Ocean by Cornelia Wutcher et al. 2006. Presenters: Brian Drupieski and Megan McCurdy Background Crenarchaeota From the kingdom Archaea Most abundant oceanic prokaryote Limited
More informationBiofilm and Nanowire Production Leads to Increased Current
AEM Accepts, published online ahead of print on August 00 Appl. Environ. Microbiol. doi:./aem.01-0 Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.
More informationAuthor for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de
International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2101 2108 Printed in Great Britain Thermococcus aegaeicus sp. nov. and Staphylothermus hellenicus sp. nov., two novel hyperthermophilic
More informationAuthor for correspondence: Michael Thomm. Tel: Fax: mthomm ifam.uni-kiel.de
International Journal of Systematic and Evolutionary Microbiology (2000), 50, 2101 2108 Printed in Great Britain Thermococcus aegaeicus sp. nov. and Staphylothermus hellenicus sp. nov., two novel hyperthermophilic
More informationFinal Exam : Take-home questions MB 451 Microbial Diversity
Final Exam : Take-home questions MB 451 Microbial Diversity Honor pledge: I have neither given nor received unauthorized aid on this test. The Rules : You are allowed to use any book or online resources
More informationPhylogenetic Diversity Analysis of Subterranean Hot Springs in Iceland
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2001, p. 4242 4248 Vol. 67, No. 9 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.9.4242 4248.2001 Copyright 2001, American Society for Microbiology. All Rights
More informationA functional gene approach to studying nitrogen cycling in the sea. Matthew Church (MSB 612 / March 20, 2007
A functional gene approach to studying nitrogen cycling in the sea Matthew Church (MSB 612 / 6-8779 mjchurch@hawaii.edu) March 20, 2007 Overview Climate change, carbon cycling, and ocean biology Distributions
More informationMicrobiology Journal Club
Microbiology Journal Club Sept 13, 2005 - Jim Brown The papers for today are: A monogram: Huber H, Hohn MJ, Rachel R, Fuchs T, Wimmer VC, Stetter KO. 2002. A new phylum of Archaea represented by a nanosized
More informationGenomic adaptations to life limit conditions: Comparative and functional genomics of extremophilic Archaea and Bacteria
PhD Project (2014-2017) Genomic adaptations to life limit conditions: Comparative and functional genomics of extremophilic Archaea and Bacteria Summary This project proposes to explore the genomic diversity
More informationMinimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus
Archaea 1, 191 197 2003 Heron Publishing Victoria, Canada Minimal sulfur requirement for growth and sulfur-dependent metabolism of the hyperthermophilic archaeon Staphylothermus marinus XIAOLEI HAO 1 and
More informationMechanisms for Extracellular Electron Exchange by Geobacter Species
University of Massachusetts Amherst ScholarWorks@UMass Amherst Doctoral Dissertations Dissertations and Theses Spring 2015 Mechanisms for Extracellular Electron Exchange by Geobacter Species Jessica A.
More informationClimate change, food safety and human health: marine pathogenic bacteria
Climate change, food safety and human health: diversity and epidemics of climate-related marine pathogenic bacteria Lanming Chen Shanghai Ocean University Global climate change CO 2 reservoir atmosphere
More informationACCEPTED. Department of Microbiology, University of Massachusetts, Amherst, MA 01003, USA
JB Accepts, published online ahead of print on 8 December 2006 J. Bacteriol. doi:10.1128/jb.01284-06 Copyright 2006, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights
More informationMethanococcus infernus sp. nov., a novel hyperthermophilic lithotrophic methanogen isolated f rom a deep-sea hydrothermal vent
International Journal of Systematic Bacteriology (1 998), 48, 9 1 3-9 1 9 Printed in Great Britain Methanococcus infernus sp. nov., a novel hyperthermophilic lithotrophic methanogen isolated f rom a deep-sea
More informationContaminant Bioremediation
Contaminant Bioremediation Petroleum hydrocarbons, chlorinated solvents, metals and radionuclides Dr. Al Cunningham Center for Biofilm Engineering Montana State University Bozeman MT USA Natural Attenuation
More information1 6 S rdna primers and the unbiased assessment of thermophile diversity
Baker, G.C. & Cowan, D.A. (2004). 16S rdna primers and the unbiased assessment of thermophile diversity. BIOCHEMICAL SOCIETY TRANSACTIONS, 32:218-221. 1 6 S rdna primers and the unbiased assessment of
More informationPyrobaculum aerophilum sp. nov., a Novel Nitrate-Reducing Hyperthermophilic Archaeum
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 1993, p. 2918-2926 Vol. 59, No. 9 99-224/93/92918-9$2./ Copyright 1993, American Society for Microbiology Pyrobaculum aerophilum sp. nov., a Novel Nitrate-Reducing
More informationDissimilatory Metal Reduction by the Facultative Anaerobe Pantoea agglomerans SP1
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Feb. 2000, p. 543 548 Vol. 66, No. 2 0099-2240/00/$04.00 0 Copyright 2000, American Society for Microbiology. All Rights Reserved. Dissimilatory Metal Reduction
More informationAcO O OH 4''' 3''' 1''' 5''' 2'''
a b 6' 7' 6'' 7'' O 5' 8' 5'' 4' 9' NH 3' 4'' 3'' 2'' 1'' 2' OH O 1' 5''' O AcO O OH 19 10 9 18 11 16 12 8 7 6 15 17 3 5 4 13 14 4''' 6''' 1 2 20 O H HO O OAc 3''' 7''' 2''' 1''' O c Supplementary Figure
More informationMicrobe Power. What can bacteria teach us about Energy, the Environment, and Nanotechnology?
Microbe Power What can bacteria teach us about Energy, the Environment, and Nanotechnology? Moh El-Naggar Physics and Astronomy, University of Southern California Physics Instant Update: Workshop for High
More informationThermogladius calderae gen. nov., sp. nov., an anaerobic, hyperthermophilic crenarchaeote from a Kamchatka hot spring
International Journal of Systematic and Evolutionary Microbiology (2016), 66, 1407 1412 DOI 10.1099/ijsem.0.000916 Thermogladius calderae gen. nov., sp. nov., an anaerobic, hyperthermophilic crenarchaeote
More informationHyperthermophilic microorganisms
FEMS Microbiology Reviews 75 (1990) 117124 Published by Elsevier FEMSRE 00133 Hyperthermophilic microorganisms K.O. Steuer, G. Fiala, G. Huber, R. Huber and A. Segerer Lehrstuhl für Mikrobiologie, Universität
More informationEvaluation of electron-shuttling compounds in microbial ferric iron reduction
FEMS Microbiology Letters 220 (2003) 229^233 www.fems-microbiology.org Evaluation of electron-shuttling compounds in microbial ferric iron reduction Abstract Kristina L. Straub, Bernhard Schink Fakulta«t
More informationMultiple Chromosomal Loci for the baba Gene in Helicobacter pylori
INFECTION AND IMMUNITY, May 2006, p. 3046 3051 Vol. 74, No. 5 0019-9567/06/$08.00 0 doi:10.1128/iai.74.5.3046 3051.2006 Copyright 2006, American Society for Microbiology. All Rights Reserved. Multiple
More informationMolecular Methods in Microbial Ecology
Molecular Methods in Microbial Ecology Contact Info: Julie Huber, jhuber@whoi.edu Schedule: Tuesday 10/24/17 Introduction, Extraction of DNA from Winogradsky columns Run DNA products on gel Thursday 10/26/17
More informationPyrococcus kukulkanii sp. nov., a hyperthermophilic, piezophilic archaeon isolated from a deep-sea hydrothermal vent
International Journal of Systematic and Evolutionary Microbiology (2016), 66, 3142 3149 DOI 10.1099/ijsem.0.001160 Pyrococcus kukulkanii sp. nov., a hyperthermophilic, piezophilic archaeon isolated from
More informationIn Situ Remediation (ISR MT3DMS TM ) Features: Reactions
In Situ Remediation (ISR MT3DMS TM ) Features: Reactions October 5, 2015 ISR MT3DMS TM Reactions 1 Introduction The core reaction framework in ISR MT3DMS TM was developed using the public domain reaction
More informationPCR KIT/REAGENTS/BUFFERS/PRIMERS
PCR KIT/REAGENTS/BUFFERS/PRIMERS 114330 DNA Amplification Kit DNA amplification kit is suitable for amplification of DNA size about 100bp to 5kb. It can be also used to RAPD PCR. This kit contains all
More informationExpressing the β-glucosidase Gene as a Reporter in the Hyperthermophilic Archaeon Pyrococcus furiosus
Portland State University PDXScholar University Honors Theses University Honors College 5-26-2018 Expressing the β-glucosidase Gene as a Reporter in the Hyperthermophilic Archaeon Pyrococcus furiosus Arman
More informationPrimePCR Assay Validation Report
Gene Information Gene Name bestrophin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID BEST3 Human BEST3 belongs to the bestrophin family of anion channels
More informationFedEx Express. Effective Jan. 1, Rates
FedEx Express Effective Jan. 1, 2007 Rates Table of Contents FedEx Express Intra-Canada Rates 2 Postal Code Index 3 FedEx First Overnight 4 FedEx Intra-Canada Index 12 FedEx Priority Overnight 14 FedEx
More informationA genome probe survey of the microbial community in oil fields
A genome probe survey of the microbial community in oil fields Gerrit Voordouw, Anita J. Telang Department of Biological Sciences, University of Calgary, Calgary, Alberta, Canada, T2N 1N4 ABSTRACT Oil
More informationIsolation and Characterization of Antibiotic-producing Actinomycetes from hot spring sediment of Thailand
Isolation and Characterization of Antibiotic-producing Actinomycetes from hot spring sediment of Thailand Chitti Thawai Department of Biology and Microbial Resource Management Unit, Scientific Instrument
More informationSupplementary Figure 2. TEM images of the sludge inoculum.
Supplementary Figures Supplementary Figure 1. MFC with methane as the mainn carbon source. (a) Schematic showing air- and adapted M. acetivorans containing pes1-matmcr3 (AA/pES1-MATmcr3), G. sulfurreducens,
More informationThermococcus fumicolans sp. nov., a New Hyperthermophilic
INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, 00207713/96/$04.00 + 0 Copyright 0 1996, International Union of Microbiological Societies OCt. 1996, p. 11 1311 19 Vol. 46. No. 4 Thermococcus fumicolans
More informationFedEx Express Rates. Effective Jan. 4, 2010
FedEx Express Rates Effective Jan. 4, 2010 Table of Contents FedEx Express Intra-Canada Rates 2 Postal Code Index 3 Intra-Canada Index 4 FedEx First Overnight 6 FedEx Priority Overnight 12 FedEx 2Day 18
More informationCharacterization of Plasmid prt1 from Pyrococcus sp. Strain JT1
JOURNAL OF BACTERIOLOGY, May 2002, p. 2561 2566 Vol. 184, No. 9 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.9.2561 2566.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Characterization
More informationCharacterization of Plasmid prt1 from Pyrococcus sp. Strain JT1
JOURNAL OF BACTERIOLOGY, May 2002, p. 2561 2566 Vol. 184, No. 9 0021-9193/02/$04.00 0 DOI: 10.1128/JB.184.9.2561 2566.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved. Characterization
More informationReceived 20 March 2001/Accepted 4 July 2001
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2001, p. 4566 4572 Vol. 67, No. 10 0099-2240/01/$04.00 0 DOI: 10.1128/AEM.67.10.4566 4572.2001 Copyright 2001, American Society for Microbiology. All Rights
More informationReceived 8 April 2011/Accepted 14 July 2011
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2011, p. 6343 6349 Vol. 77, No. 18 0099-2240/11/$12.00 doi:10.1128/aem.05057-11 Copyright 2011, American Society for Microbiology. All Rights Reserved. Defining
More informationMolecular Methods in Microbial Ecology
Molecular Methods in Microbial Ecology Contact Info: Julie Huber Lillie 305 x7291 jhuber@mbl.edu Schedule: 26 Oct: Introductory Lecture, DNA extraction 28 Oct: Run DNA products on gel Lecture on PCR Prepare
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID myeloperoxidase MPO Human Myeloperoxidase (MPO) is a heme protein synthesized during
More informationThermosipho geolei sp. nov., a thermophilic bacterium isolated from a continental petroleum reservoir in Western Siberia
International Journal of Systematic and Evolutionary Microbiology (2001), 51, 1327 1334 Printed in Great Britain Thermosipho geolei sp. nov., a thermophilic bacterium isolated from a continental petroleum
More informationMultip,le influences of nitrate on uranium solubility durin~1 bioremediation of uranium-contaminated subsurface sediments
Environmental Microbiology (22) 4(9), 51-516 Multip,le influences of nitrate on uranium solubility durin1 bioremediation of uranium-contaminated subsurface sediments Kevin T. Finneran,t Meghan E. Housewright
More informationIn Vivo Observation of Cell Division of Anaerobic Hyperthermophiles by Using a High-Intensity Dark-Field Microscope
JOURNAL OF BACTERIOLOGY, Aug. 1999, p. 5114 5118 Vol. 181, No. 16 0021-9193/99/$04.00 0 Copyright 1999, American Society for Microbiology. All Rights Reserved. In Vivo Observation of Cell Division of Anaerobic
More informationFedEx Express Rates. Effective January 4, 2016
FedEx Express ates Effective January 4, 2016 Introduction The FedEx Express portfolio of shipping services has been designed to help address your unique needs whether you are shipping near or far, to clients
More informationA genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide
emi4_35 1..7 Environmental Microbiology Reports (211) doi:1.1111/j.1758-2229.211.35.x A genetic system for Geobacter metallireducens: role of the flagellin and pilin in the reduction of Fe(III) oxide Pier-Luc
More informationMicrobe-Electrode-Interactions
Microbe-Electrode-Interactions Johannes Gescher Institut for Applied Biosciences, Applied Biology KIT Universität des Landes Baden-Württemberg und nationales Forschungszentrum in der Helmholtz-Gemeinschaft
More informationENVE 424 Anaerobic Treatment. Review Lecture Fall Assist. Prof. A. Evren Tugtas
ENVE 424 Anaerobic Treatment Review Lecture 2012-2013 Fall Assist. Prof. A. Evren Tugtas Basics of Microbiology Principles of microbiology is applied to the solution of environmental problems Treatment
More informationisolates with a novel primer by PCR
JCM Accepts, published online ahead of print on 2 February 2011 J. Clin. Microbiol. doi:10.1128/jcm.00461-10 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All
More informationProtocol for tissue-specific gene disruption in zebrafish
Protocol for tissue-specific gene disruption in zebrafish Overview This protocol describes a method to inactivate genes in zebrafish in a tissue-specific manner. It can be used to analyze mosaic loss-of-function
More informationArchaeoglobus fulgidus Isolated from Hot North Sea
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Apr. 1994, p. 1227-1231 Vol. 60, No. 4 0099-2240/94/$04.00+0 Copyright 1994, American Society for Microbiology Archaeoglobus fulgidus Isolated from Hot North Sea
More informationGene Duplications in Evolution of Archaeal Family B DNA Polymerases
JOURNAL OF BACTERIOLOGY, Apr. 1997, p. 2632 2640 Vol. 179, No. 8 0021-9193/97/$04.00 0 Copyright 1997, American Society for Microbiology Gene Duplications in Evolution of Archaeal Family B DNA Polymerases
More informationPrimePCR Assay Validation Report
Gene Information Gene Name heat shock 10kDa protein 1 (chaperonin 10) Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID HSPE1 Human This gene encodes a major
More informationNitrogen Cycling in the Sea
Nitrogen Cycling in the Sea NH 4 + N0 2 N0 2 NH 4 + Outline Nitrogen species in marine watersdistributions and concentrations New, regenerated, and export production The processes: Assimilation, N 2 fixation,
More informationDetermining the f ratio 11/16/2010. Incubate seawater in the presence of trace 15
Plankton production is supported by 2 types of nitrogen: 1) new production supported by external sources of N (e.g. NO 3 and N 2 ), 2) recycled or regenerated production, sustained by recycling of N. Assumptions:
More informationS5-3 Yu-Guang ZHOU (Institution of Microbiology, Chinese Academy of Sciences) Recent Activities of the CGMCC
Session 5 Microbe S5-1 Moriya Ohkuma (Japan Collection of Microorganisms (JCM), RIKEN BioResource Center) Activities of RIKEN BRC-JCM to Respond Demands of Scientific Community S5-2 Ken-ichiro Suzuki (NITE
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 3 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT3 Human The protein encoded by this gene is a member of the keratin
More informationGenomic and Proteomic Analysis of Deep Underground Microbial Communities
Genomic and Proteomic Analysis of Deep Underground Microbial Communities Kenneth F. Reardon, Chemical & Biological Engineering, Colorado State University Amy Pruden, Civil & Environmental Engineering,
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID glyceraldehyde-3-phosphate dehydrogenase GAPDH Human The product of this gene catalyzes
More informationReceived 7 November 2002/Accepted 5 February 2003
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 2003, p. 2985 2993 Vol. 69, No. 5 0099-2240/03/$08.00 0 DOI: 10.1128/AEM.69.5.2985 2993.2003 Copyright 2003, American Society for Microbiology. All Rights Reserved.
More informationFedEx Express Rates. Effective January 6, 2014
FedEx Express ates Effective January 6, 201 Introduction The FedEx Express portfolio of shipping services has been designed to help address your unique needs whether you are shipping near or far, to clients
More informationThe Complete Genome Sequence of Thermococcus onnurineus NA1 Reveals a Mixed Heterotrophic and Carboxydotrophic Metabolism
JOURNAL OF BACTERIOLOGY, Nov. 2008, p. 7491 7499 Vol. 190, No. 22 0021-9193/08/$08.00 0 doi:10.1128/jb.00746-08 Copyright 2008, American Society for Microbiology. All Rights Reserved. The Complete Genome
More informationAPPENDIX D. MATERIAL TEST RESULTS
APPENDIX D. MATERIAL TEST RESULTS Tensile coupon testing was used to characterize the steel plate used to make the five connection members, gusset plates, and splice plates. Testing was performed according
More informationPhytoplankton and bacterial biomass, production and growth in various ocean ecosystems
Phytoplankton and bacterial biomass, production and growth in various ocean ecosystems Location Bact. Biomass (mg C m -2 ) Phyto. Biomass (mg C m -2 ) BactB: PhytoB BactP (mg C m -2 d -1 ) 1 o Pro (mg
More informationPrimePCR Assay Validation Report
Gene Information Gene Name keratin 5 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID KRT5 Human The protein encoded by this gene is a member of the keratin
More informationFreight containers Coding, identification and marking Amendment 3
Provläsningsexemplar / Preview INTERNATIONAL STANDARD ISO 6346 Third edition 1995-12-01 AMENDMENT 3 2012-12-01 Freight containers Coding, identification and marking Amendment 3 Conteneurs pour le transport
More informationDefining Components of the Chromosomal Origin of Replication. for Construction of a Stable Replicating Shuttle Vector
AEM Accepts, published online ahead of print on 22 July 2011 Appl. Environ. Microbiol. doi:10.1128/aem.05057-11 Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions.
More informationShould we focus only on P load when aiming to reduce eutrophication in a P-limited aquatic system?
Should we focus only on P load when aiming to reduce eutrophication in a P-limited aquatic system? Petri Ekholm & Jouni Lehtoranta Finnish Environment Institute (SYKE) International Phosphorus Workshop
More informationPrimePCR Assay Validation Report
Gene Information Gene Name cytochrome P450, family 2, subfamily C, polypeptide 9 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID CYP2C9 Human This gene encodes
More information