Taq DNA Polymerase. high yield, robust and reliable PCR reactions. Value Industry standard for routine PCR at a low price

Transcription

1 July vol. 1.2 NEBexpessions a scientific update fom New England Biolabs Welcome to the summe edition of NEB Expessions. In addition to new poduct announcements and technical tips, we highlight data detailing how NEB estiction enzymes can delive moe flexibility to you expeimental design. Extensive testing shows that ove 120 of ou estiction enzymes ae Time-Save qualified and will digest to completion in only 5 minutes. Please efe to page 3 fo a complete list of ou Time-Save qualified enzymes. As always, we invite you feedback on ou poducts, sevices and copoate philosophy. inside: New Poducts 5 Restiction Endonucleases Fou new enzymes available 7 Gaussia Lucifease Tansciptional Repote An extemely sensitive and natually seceted lucifease Technical Tips 2 Enhancing Tansfomation Efficiencies 6 Optimizing Restiction Endonuclease Reactions Highlighted Poducts 3 Time-Save Qualified Restiction Enzymes fom NEB Featue Aticle 4 Nicking Endonucleases The discovey and engineeing of estiction enzyme vaiants Web Tool Focus 8 NEBcutte An innovative tool fo expeimental design the leade in enzyme technology Taq DNA Polymease high yield, obust and eliable PCR eactions Fo high yield PCR eactions, choose ecombinant Taq DNA Polymease fom NEB. Known fo obust and eliable eactions, this enzyme is the industy standad fo outine PCR. NEB povides high quality, ecombinant Taq at exceptional value in tems of cost pe unit. Fo you convenience, this vesatile enzyme is now available in a vaiety of fomats. Value Industy standad fo outine PCR at a low pice Vesatility Toleates a wide ange of templates with minimal optimization Flexibility Able to incopoate dutp, ditp and fluoescently-labeled nucleotides Choice Reaction buffes accommodate a vaiety of PCR applications with no sacifice in amplification pefomance M Quick-Load Taq 2X Maste Mix Taq 2X Maste Mix Vesatility and yield with the Taq 2X Maste Mixes. 40 ng human genomic DNA (hdna) o 0.01 ng lambda DNA (λ DNA) was amplified in the pesence of 200 nm pimes in a 25 µl volume. Make (M) shown is 2-Log DNA Ladde (NEB #N3200). The 0.5, 1.1, and 2.0 kb fagments ae amplified fom hdna, while the 5.5 kb fagment is fom λ DNA yield of deams. Taq PCR Kit Eveything you need to pefom 200 PCR eactions #E5000S Taq PCR Kit with Contols Also includes 30 contol eactions #E5100S Taq 2X Maste Mix Just add template and pimes #M0270S 100 eactions #M0270L 500 eactions Quick-Load Taq 2X Maste Mix Also includes dyes fo tacking #M0271S 100 eactions #M0271L 500 eactions Taq DNA Polymease with ThemoPol Buffe Buffe is uniquely fomulated to pomote high poduct yields #M0267S 400 units #M0267L 2,000 units Taq DNA Polymease with Standad Taq Buffe Detegent fee buffe fo high thoughput applications #M0273S 400 units #M0273L 2,000 units = Recombinant Some applications in which these poducts can be used may be coveed by patents issued and applicable in the United States and cetain othe counties. Because puchase of these poducts does not include a license to pefom any patented application, uses of these poducts may be equied to obtain a patent license depending upon the paticula application in which the poduct is used. The PCR pocess is the subject of Euopean Patent Nos. 201,184 and 200,262 owned by Hoffman-LaRoche, which expied on Mach 28, The coesponding PCR pocess patents in the United States expied on Mach 29, 2005.

2 Page 2 Enhancing Tansfomation Efficiencies Tansfomation efficiency is defined as the numbe of colony foming units (cfu) which would be poduced by tansfoming 1 µg of plasmid into a given volume of competent cells. The tem is somewhat misleading in that 1 µg of plasmid is aely actually tansfomed. Instead, efficiency is outinely calculated by tansfoming 100 pg 1 ng of highly puified supecoiled plasmid unde ideal conditions. The equation fo calculating Tansfomation Efficiency (TE) is: TE = Colonies/µg/Dilution. Efficiency calculations can be used to compae cells o ligations. We have listed ou ecommended potocols and tips to help you achieve maximum esults. Technical Tips Recommended Potocols High Efficiency Tansfomation Potocol 1. Thaw cells on ice fo 10 minutes. 2. Add 1 pg 100 ng of plasmid DNA (1 5 µl) to cells and mix without votexing. 3. Place on ice fo 30 minutes. 4. Heat shock at 42 C fo 30 seconds. 5. Place on ice fo 5 minutes. 6. Add 250 µl of oom tempeatue SOC. 7. Place at 37 C fo 60 minutes. Shake vigoously (250 pm) o otate. 8. Mix cells without votexing and pefom seveal 10-fold seial dilutions in SOC. 9. Spead µl of each dilution onto pe-wamed selection plates and incubate at 37 C o accoding to ecommendations. 5 Minute Tansfomation Potocol Results in only 10% efficiency compaed to above potocol. 1. Thaw cells in you hand. 2. Add 1 pg 100 ng of plasmid DNA (1 5 µl) to cells and mix without votexing. 3. Place on ice fo 2 minutes. 4. Heat shock at 42 C fo 30 seconds. 5. Place on ice fo 2 minutes. 6. Add 250 µl of oom tempeatue SOC. Immediately spead µl onto a selection plate and incubate ovenight at C. NOTE: Selection using antibiotics othe than ampicillin may equie some outgowth pio to plating. Tansfomation Tips Thawing Cells ae best thawed on ice. DNA should be added as soon as the last tace of ice in the tube disappeas. Cells can be thawed by hand, but waming above 0 C deceases efficiency. Incubation of DNA with Cells on Ice Incubate on ice fo 30 minutes. Expect a 2-fold loss in TE fo evey 10 minutes you shoten this step. Heat Shock Both tempeatue and time ae specific to the tansfomation volume and vessel. Typically, 30 seconds at 42 C is ecommended. Outgowth Outgowth at 37 C fo 1 hou is best fo cell ecovey and fo expession of antibiotic esistance. Expect a 2-fold loss in TE fo evey 15 minutes you shoten this step. SOC gives 2-fold highe TE than LB medium. Incubation with shaking o otating the tube gives 2-fold highe TE. Plating Selection plates can be used wam o cold, wet o dy with no significant effects on TE. Wam, dy plates ae easie to spead and allow fo the most apid colony fomation. DNA DNA fo tansfomation should be puified and esuspended in wate o TE Buffe. Up to 10 µl of DNA fom a ligation mix can be used with only a 2-fold loss of efficiency. To maximize tansfomants, puification by eithe a spin column o phenol/chloofom extaction and ethanol pecipitation should be pefomed. The optimal amount of DNA is lowe than commonly ecognized. Using clean, supecoiled puc19, the efficiency of tansfomation is highest in the 100 pg 1 ng ange. Howeve, the total colonies which can be obtained fom a single tansfomation eaction incease up to about 100 ng. DNA Contaminants to Avoid Contaminant Removal Method Detegents Ethanol pecipitate Phenol Extact with chloofom and ethanol pecipitate Ethanol o Isopopanol PEG DNA binding poteins (e.g., Ligase) Dy pellet befoe esuspending Column puify o phenol/ chloofom extact and ethanol pecipitate Column puify o phenol/ chloofom extact and ethanol pecipitate Competent Cells Available fom NEB Though Septembe 30th, take advantage of ou intoductoy offe* Chaacteistics Stain NEB # Rapid Colony Gowth NEB Tubo Competent E. coli C2984H Vesatile Cloning Stain NEB 5-alpha Competent E. coli C2991H Potein Expession Stain T7 Expess Competent E. coli C2566H Tight Contol of Potein Expession T7 Expess l q Competent E. coli C2883H dam/dcm Methyltansfease Fee Plasmid Gowth dam /dcm Competent E. coli C2925H * No othe discounts apply. Notice to Buye/Use: The Buye and Use have a non exclusive license to use this system o any component theeof fo RESEARCH PURPOSES ONLY. See Assuance Lette and Statement on fo details on tems of the license ganted heeunde.

3 Page 3 Time-Save Qualified Restiction Enzymes fom NEB Poweful enough fo a 5 minute digest, pue enough fo ovenight incubation Ove 120 of ou enzymes ae Time-Save qualified and will digest 1 µg of DNA in 5 minutes. Look fo the Time-Save icon on ou website. C At NEB, enzyme poduction is linked to basic eseach in the cloning and oveexpession of estiction-modification systems. This focus allows us to povide extemely pue enzymes at concentations that delive moe flexibility fo you expeimental design. Whethe you ae quickly sceening lage numbes of clones, o setting up ovenight digests, you will benefit fom the high quality of ou enzymes. Typically, a estiction digest involves the incubation of 1 µl of enzyme with 1 µg of puified DNA in a final volume of 50 µl fo 1 hou. Howeve, to speed up the sceening pocess, choose one of NEB s enzymes that ae Time-Save qualified. These enzymes will digest 1 µg of DNA in 5 minutes using 1 µl of enzyme unde ecommended eaction conditions. Unlike othe supplies, thee is no special fomulation, change in concentation o need to buy moe expensive new lines of enzymes to achieve digestion in 5 minutes. In fact, 59% of ou enzymes will digest 1 µg of DNA in 5 minutes, while 83% will fully digest in 15 minutes (see table). That means >180 of ou estiction enzymes have the powe to get the job done fast. Also, since all of ou enzymes ae igoously tested fo nuclease contamination, you can safely set up digests fo long peiods of time without any degadation of you sample. Only NEB can offe you enzymes with powe and puity the powe to digest in 5 minutes and the puity to withstand ovenight digestions with no loss of sample O/N M Minutes Powe and puity of Time-Save qualified enzymes: 1 µl of SalI digests 1 µg of DNA in 5 minutes with no indication of nuclease contamination in longe digests o ovenight (O/N) samples. Make (M) is the 1 kb DNA Ladde (NEB #N3232) Enzyme Minutes Minutes Enzyme Minutes Minutes Enzyme Minutes Minutes AatII BspHI MnlI Acc65I BsBI MseI AccI BsDI MslI AciI BsFI MspI AclI BsGI MspA1I AcuI BssHII MwoI AflII BsI NciI AgeI BssKI NcoI AhdI BstBI NdeI AluI BstEII NgoMIV AlwI BstNI NheI AlwNI BstUI NlaIII ApaI BstXI NotI ApaLI BstYI NuI ApeKI BstZ17I NsiI ApoI Bsu36I NspI AscI BtgI PacI AseI BtsCI PaeR7I AsiSI Cac8I PflfI AvaI ClaI PflMI AvaII CspCI PmeI AvII CviAII PmlI BaeI CviKI-1 PpuMI BamHI DdeI PshAI BanII DpnI PstI BbsI DpnII PvuI BbvI DaI PvuII BbvCI DaIII RsaI BccI DdI SacI BceAI EagI SacII BciVI EaI SalI BclI EcoNI SapI BfaI EcoO109I SbfI BfuAI EcoP15I ScaI BfuCI EcoRI ScFI BglI EcoRV SfiI BglII Fnu4HI SfoI BlpI FokI SmaI Bme1580I FseI SnaBI BmgBI FspI SpeI BmI HaeII SphI BpmI HaeIII SspI BsaAI HgaI StuI BsaBI HhaI StyI BsaHI HincII StyD4I BsaWI HindIII SwaI BsaXI HinfI TaqI BseRI HinP1I TfiI BsgI HpaI TseI BsiEI HpaII Tsp509I BsiHKAI HphI TspMI BsiWI Hpy188I TspRI BslI HpyCH4IV Tth111I BsmAI HpyCH4V XbaI BsmBI KpnI XcmI BsmFI MboI XhoI BsmI MboII XmaI BsoBI MfeI XmnI Bsp1286I MluI BspCNI MlyI = Recombinant BspEI MmeI Geen indicates fequently used enzymes.

4 Page Nicking Endonucleases: The Discovey and Engineeing of Restiction Enzyme Vaiants Siu-hong Chan, Ph.D. and Shuang-yong Xu, Ph.D., New England Biolabs, Inc. Featue Aticle Restiction endonucleases (REases) ecognize specific nucleotide sequences in double-standed DNA and geneally cleave both stands. Some sequence-specific endonucleases, howeve, cleave only one of the stands. These endonucleases ae known as nicking endonucleases (NEases). At NEB, we have been developing nicking endonucleases though the discovey of natually occuing enzymes, as well as genetic engineeing of existing estiction enzymes. Double-standed cleavage usually esults fom binding of the two half sites of a palindomic sequence by a homodimeic REase (e.g. Type IIP REases). Within the homodime, each monome makes a cut on one of the stands such that both stands of the DNA ae cleaved. Stand-specific nicking, howeve, is achievable only when the ecognition sequences ae asymmetic. In addition, some of the REases that ecognize asymmetic sequences ae heteodimeic. Thus, one can envision that manipulating the catalytic activity of individual monomes o the dimeization state of estiction endonucleases that ecognize asymmetic sequences can esult in nicking endonucleases. That is how NEB scientists developed the stand-specific NEases Nb.BbvCI and Nt.AlwI. BbvCI is a heteodimeic Type IIS REase. It ecognizes the 7 base-pai asymmetic sequence CCTCAGC and cleaves the DNA at (CC TCAGC and CCTCA GC) [CCTCAGC (-5/-2)]. It was discoveed that each of the two subunits (R1 and R2) contains its own catalytic site. Each of these subunits cleaves the bottom and the top stands of the taget sequence, espectively (1). To utilize this popety, cleavage-deficient mutants of each subunit wee engineeed. Heteodimes of functional R1 and cleavage-deficient R2 econstitute a nicking endonuclease that cleaves only the bottom stand (Nb.BbvCI), wheeas functional R2 and cleavage-deficient R1 econstitute Nt.BbvCI, which cleaves the top stand only (2). The nicking enzyme Nt.AlwI (GGATCNNNN ) was also successfully engineeed to cleave only the top stand of the AlwI taget sequence [GGATC(4/5)] (3). This NEase was ceated by swapping the dimeization domain of AlwI with a non-functional dimeization domain of the natual NEase, Nt.BstNBI, such that the esulting chimeic enzyme, Nt.AlwI, is endeed monomeic. Othe nicking enzyme engineeing pojects ae less staightfowad. Sceening libaies of andom mutants has enabled us to isolate vaiants of estiction endonucleases that nick one of the stands specifically (4,5). The engineeed enzymes obtained ae the bottomstand specific Nb.BsmI (GAATG C) fom BsmI [GAATGC(1/-1)] and top-stand specific Nt.SapI (GCTCTTCN ) fom SapI [GCTCTTC(1/4)] (4). Nicking vaiants have also been geneated fom BsaI [GGTCTC(1/5)], BsmBI [CGTCTC(1/5)], and BsmAI [GTCTC(1/5)] (5). In addition to potein engineeing, we ae also developing poducts fom natual nicking endonucleases. Nt.BstNBI (GAGTCNNNN ) is a natually occuing themostable NEase cloned fom Bacillus steeothemophilus (6). Nt.CviPII ( CCD), oiginally identified in a Chloella vius isolate as a fequent DNA nickase that ecognizes 3-base taget sequences (7), is also unde development at NEB. Some nicking endonucleases wee discoveed quite unexpectedly. Nb.BsDI (GCAATG ) is the lage subunit of BsDI [GCAATG(2/0)], a themostable heteodimeic enzyme identified in Bacillus steaothemophilus. The lage subunit was found to be a bottom-stand specific NEase when cloned sepaately in E. coli (Xu, unpublished obsevations). A simila obsevation has been made in BtsI whee the Nicking Endonucleases Available at NEB lage subunit makes a stand-specific nick at the taget sequence (Zhu and Xu, unpublished esults). The top-stand cleavage activity of BfiI [ACTGGG(5/4)] has also been epoted to be inhibited at low ph, esulting in a bottom-stand specific nicking enzyme (8). The uses of nicking endonucleases ae still being exploed. NEases can geneate nicked o gapped duplex DNA fo studies of DNA mismatch epai and fo diagnostic applications. The long ovehangs that nicking enzymes make can be used in DNA fagment assembly. Nt.BbvCI has been used to geneate long and non-complementay ovehangs when used with XbaI in the USER Fiendly Cloning Kit* (NEB #E5500S). Nicking endonucleases ae also useful fo isothemal DNA amplifications, which ely on the poduction of site-specific nicks. Isothemal DNA amplification using Nt.BstNBI in concet with Vent (exo ) DNA Polymease (NEB #M0257) (EXPAR) has been epoted fo detection of a specific DNA sequence in a sample (9). Anothe isothemal DNA amplification technique has also been descibed using the 3-base cutte Nt.CviPII and Bst DNA Polymease I [Nicking Endonuclease Mediated- DNA Amplification (NEMDA)] (7). Fequentcutting NEases can geneate shot patial duplex DNA fagments fom genomic DNA. These fagments can be used fo cloning o used as pobes fo hybidization-based applications. NEB Recommended eaction Enzyme Catalog # Cleavage site tempeatue (uppe limit) 7-base cuttes Nb.BbvCI R0631 C C T C A G C 37 C (47 C) G G A G T C G Nt.BbvCI R0632 C C T C A G C 37 C (47 C) G G A G T C G 6-base cuttes Nb.BsmI R0706 G A A T G C N 65 C C T T A C G N Nb.BsDI R0648 G C A A T G N N 65 C C G T T A C N N 5-base cuttes Nt.BstNBI R0607 G A G T C N N N N N 55 C C T C A G N N N N N Nt.AlwI R0627 G G A T C N N N N N 37 C (55 C) C C T A G N N N N N

5 Page 5 Fo moe infomation about NEases and REases, you can visit Altenatively, REBASE (ebase.neb.com) offes a compehensive database of enzyme popeties and useful esouces of estiction-modification systems. REBASE also includes citations of all elevant liteatue as well as links to esouces such as stuctual data and genomic sequences when they ae available. Down-aows ( ) indicate cleavage at the top stand; up-aows ( ) indicate cleavage at the bottom stand. * The USER (Uacil-Specific Excision Reagent) Fiendly Cloning Kit offes an extemely fast, simple and efficient method fo the cloning of PCR poducts. Refeences: 1. Bellamy, S.R.W. et al. (2005) J. Mol. Biol. 345, Heite, D.F., Lunnen, K.D. and Wilson, G.G. (2005) J. Mol. Biol. 348, Xu, Y. et al. (2001) Poc. Natl. Acad. Sci. USA 98, Samuelson, J.C., Zhu, Z. and Xu, S.Y. (2004) Nucl. Acids Res. 32, Zhu, Z. et al. (2004) J. Mol. Biol. 337, Mogan, R.D. et al. (2000) Biol. Chem. 381, Chan, S.H. et al. (2004) Nucl. Acids Res. 32, Sasnauskas, G. et al. (2003) Poc. Natl. Acad. Sci. USA 100, Van Ness, J. et al. (2003) Poc. Natl. Acad. Sci. USA 100, Assaying Nicking Endonucleases Nicking endonucleases ae simple to use. Since the nicks geneated by 6- o 7- base NEases do not fagment DNA, thei activities ae monitoed by convesion of supecoiled plasmids to open cicles. Altenatively, substates with nicking sites close enough on opposite stands to ceate a doublestanded cut can be used instead. New Restiction Endonucleases fom NEB NEB maintains an aggessive eseach pogam in the discovey, cloning and oveexpession of estiction endonucleases. This allows us to offe the lagest selection of these essential eagents. Fou of ou newest enzymes ae listed below. Fo a moe up to date list of estiction endonucleases, please see ou website, BtsCI BtsCI is a ecombinant isoschizome of BstF5I with a lowe optimum incubation tempeatue and a 2-fold unit incease. #R0647S #R0647L 2,000 units 10,000 units 5... G G A T G N N C C T A C N N... 5 Nb.BsDI Nb.BsDI is a nicking endonuclease that cleaves only one stand of DNA on a double-standed DNA substate. #R0648S #R0648L 1,000 units 5,000 units 5... G C A A T G N N C G T T A C N N... 5 Available fom NEB Cloned at NEB Ou aggessive estiction endonuclease sceening and cloning pogams enable us to maintain a position at the foefont of this field. NEB now supplies ove 230 estiction enzymes, of which ove 150 ae ecombinant. CviKI-1 CviKI-1 is a estiction endonuclease with fou expected ecognition sites as well as up to eleven elaxed non-cognate sites (sta sites). #R0710S #R0710L 5... R G C Y Y C G R units 1,250 units TspMI TspMI is a themophilic XmaI isoschizome that cuts plasmids efficiently. #R0709S #R0709L 200 units 1,000 units 5... C C C G G G G G G C C C... 5 = Recombinant

6 Page 6 Optimizing Restiction Endonuclease Reactions Technical Tips Thee ae seveal key factos to conside when setting up a estiction endonuclease digest. Using the pope amounts of DNA, enzyme and buffe components in the coect eaction volume will allow you to achieve optimal digestion without any sta activity. By definition, 1 unit of estiction enzyme will completely digest 1 µg of substate DNA in a 50 µl eaction in 60 minutes. This enzyme : DNA : eaction volume atio can be used as a guide when designing eactions. Howeve, most eseaches follow the typical eaction conditions listed, whee a 10-fold ovedigestion is ecommended to ovecome vaiability in DNA souce, quantity and puity. NEB offes the following tips to help you to achieve maximal success in you estiction endonuclease eactions. Enzyme Keep on ice when not in the feeze. Should be the last component added to eaction. Mix components pio to addition of enzyme by pipetting the eaction mixtue up and down, o by flicking the eaction tube. Follow with a quick ( touch ) spin-down in a micocentifuge. Do not votex the eaction. DNA Should be fee of contaminants such as phenol, chloofom, alcohol, EDTA, detegents, o excessive salts. Methylation of DNA can inhibit digestion with cetain enzymes. Fo moe infomation about methylation, see pages of ou catalog o Buffe Use at a 1X concentation. If necessay, add BSA to a final concentation of 100 µg/ml. Restiction enzymes that do not equie BSA fo optimal activity ae not advesely affected if BSA is pesent in the eaction. Reaction Volume A 50 µl eaction volume is ecommended fo digestion of 1 µg of substate. Smalle eaction volumes ae moe susceptible to pipetting eos. Keep glyceol concentation at less than 5% of total eaction volume to pevent sta activity. The estiction enzyme (supplied in 50% glyceol) should not exceed 10% of the total eaction volume. Incubation Time Can often be deceased by using an excess of enzyme, o by using one of ou Time- Save qualified enzymes (see page 3). It is possible, with many enzymes, to use fewe units and digest fo up to 16 hous. Fo moe infomation, see page 257 of ou catalog o Stopping a eaction If no manipulation of DNA is equied: Teminate with a stop solution [50% glyceol, 50 mm EDTA (ph 8.0), and 0.05% bomophenol blue]. Use 10 µl pe 50 µl eaction. When manipulation of DNA is equied: Heat inactivation can be used (efe to page 256 of ou catalog o to detemine if the enzyme can be heat inactivated). Remove enzyme by using a spin column o phenol/chloofom extaction. A Typical Restiction Digest Restiction Enzyme DNA 1 µg 10X NEBuffe BSA 10 units is sufficient Geneally 1 µl is used 5 µl (1X) Total Reaction Volume 50 µl Incubation Time 1 hou Incubation Tempeatue Add to a final concentation of 100 µg/ml (1X) if necessay Enzyme dependent Contol Reactions If you ae having difficulty cleaving you DNA substate, we ecommend the following contol eactions: Expeimental DNA without estiction enzyme to check fo contamination in the DNA pepaation o eaction buffe. Contol DNA (DNA with multiple known sites fo the enzyme, e.g. lambda o adenovius-2 DNA) with estiction enzyme to test enzyme viability. If the contol DNA is cleaved and the expeimental DNA esists cleavage, the two DNAs can be mixed to detemine if an inhibito is pesent in the expeimental sample. If an inhibito (often salt, EDTA o phenol) is pesent, the contol DNA will not cut afte mixing. Nomenclatue of Restiction Endonucleases The nomenclatue of NEB estiction enzymes is being updated to eliminate the space between the oganism name and the Roman numeal. We ae cuently changing ou liteatue to eflect the pope nomenclatue. Please note that this change will be taking place gadually and names will be in eithe fomat fo a limited time. As the leade in enzyme technology, it is impotant fo us to popely pesent the names of these essential eagents. Fo additional infomation on the nomenclatue of estiction enzymes, please see the following efeence: Robets R.J., et al. (2003). Nucl. Acids Res. 31,

7 Page Gaussia Lucifease Tansciptional Repote New poducts that utilize this extemely sensitive and natually seceted lucifease Choose the enhanced pefomance and convenience of Gaussia Lucifease (GLuc) fo you mammalian gene expession expeiments. This ideal tansciptional epote is extemely sensitive, natually seceted and vey stable. New England Biolabs now offes seveal poducts so that you can expeience the consideable advantages of this new epote gene. Exteme Sensitivity of the Gaussia Lucifease Repote 120,000 pgluc-basic Vecto Fo cloning pomote sequences to assess thei tansciptional egulatoy functions #N µg pcmv-gluc Contol Plasmid Fo constitutive expession of GLuc #N µg pnebr-x1 GLuc Contol Plasmid GLuc is placed unde the contol of GAL4 and a minimal pomote. Compatible with Rheoswitch and othe GAL4 activatos. #N µg Gaussia Lucifease Assay Kit Easy-to-use kit to measue lucifease activity #E3300S 100 assays #E3300L 1,000 assays Relative Light Units 100,000 80,000 60,000 40,000 20,000 0 S L S L Gaussia Renilla Top easons to choose Gaussia Lucifease as a tansciptional epote Many unique featues of the GLuc epote gene coupled with the Gaussia Lucifease Assay Kit make it the ideal choice as a tansciptional epote. 1. Speed Seceted GLuc can be detected in the cultue medium only a few hous afte tansciption. Just collect a few µl of the medium and monito tansfection efficiency, cell viability, and gene expession. 2. Natually Seceted Since the cultue medium can be used to monito GLuc expession without the need fo cell lysis, the cells can be used fo additional assays (e.g Westen blots, immunocytochemisty, etc). 3. Exteme Sensitivity Gaussia Lucifease poduces a significantly highe bioluminescent intensity that supasses Fiefly and Renilla lucifeases. Fo most applications, such as tansient tansfection assays, highe sensitivity offes the advantage of using less mateial, which is moe pactical when woking with had to tansfect cells, fo example. 4. Stability Gaussia Lucifease can be stoed fo seveal days at 4 C without loss of activity. This allows multiple assays fom the same expeiment ove a long peiod of time. 5. Compatibility with othe fomats Seceted Gaussia Lucifease is most conveniently measued in the cultue medium. Since it is so sensitive, a significant amount of activity can also be measued fom cell lysates, which ae commonly used in othe assays. It is also compatible with othe seceted epotes (e.g. SEAP) as well as standad assays used fo tansfection nomalization (e.g. beta-galactosidase o fiefly lucifease). Tannous et al. (2005) Mol. The. 11, Bgl I 4111 Bsa I 4059 Afl III - Pci I 3104 Aat II - Za I 4915 Ssp I 4799 Bcg I 4513 Sca I 4475 oi BstZ17 I 2723 Bsm I 2674 HeLa cells wee tansfected with 1 µg of pcmv-gluc o pcmv- Renilla, and light emission was measued fo the supenatant (S) o cell lysate (L). Note that Gaussia Lucifease is a natually seceted epote, while Renilla is not. Ap R pgluc-basic 4920 bp BstB I 2434 Bgl II 12 EcoR I 20 EcoR V 30 Hind III 45 Acc65 I - Kpn I 51 Sac I 57 BamH I 63 MCS GLuc Bbs I 145 Nu I 179 Sac II 204 Not I 634 Xba I 653 BssH II 2150 Rs II 2268 Da III 1014 SexA I 1310 BseR I 1524 Stu I 1540 Av II 1543 Sma I - Xma I 1564 Bcl I 1594 Kas I - Na I - Sfo I 1752 PflF I - Tth111 I 1868 BglII EcoRI EcoRV HindIII 1 GACGGATCGGGAGATCTTGGAATTCTGCAGATATCCTCGAGCCCAAGCTT 50 KpnI SacI BamHI 51 GGTACCGAGCTCGGATCCAGCCACCATGGGAGTCAAAGTTCTGTTTGCCC 100 M G V K V L F A... GLuc The pgluc-basic Vecto allows tansciptional egulatoy functions of a specific pomote sequence to be measued. Neo R PSV40

8 Page NEBcutte V2.0 innovative web tool fo expeimental design The technical efeence section of ou website povides seveal web based pogams to aid in expeimental design. NEBcutte allows you to input sequence data and find lage ORFs, identify estiction sites and geneate custom digests. The vitual digests display fagment length, and allow you to choose appopiate makes, gel types, and methylation sensitivity. Featues in Vesion 2.0 Web Tool Focus Input up to 20,000 bp fom local sequence file, GenBank o by cutting and pasting. GCG, DNASta and EMBL fomats accepted. Up to 40 custom oligonucleotides can be specified. Options include Type I and III enzymes, homing endonucleases and nicking enzymes, as well as all commecial o all known specificities. Up to 5 ambiguous nucleotides ae allowed in any 20 nt window of input sequence. All NEB isoschizomes ae displayed on the maps. Enzymes listed by numbe of sites poduced, alphabetically o by cut fequency. Sequences submitted ae maintained locally fo 2 days and then discaded fo you pivacy. Silent mutation sites can be intoduced into ORF sequence by a single mouse click. Enzymes may be selected by thei site length o cut fequency. Map of unique estiction sites in pbr322 geneated by NEBcutte. Acquie sequence infomation by expanding a egion of inteest on the plasmid map. NEBcutte: tools.neb.com/nebcutte2/index Use Guide: tools.neb.com/nebcutte2/help/guide the leade in enzyme technology New England Biolabs, Inc. 240 County Road Ipswich, MA NEB-LABS Tel. (978)