Nanotechnology for point of care diagnostics. Shana O. Kelley University of Toronto
|
|
- Teresa Sparks
- 6 years ago
- Views:
Transcription
1 Nanotechnology for point of care diagnostics Shana O. Kelley University of Toronto
2 Nanotechnology what is it and why is it relevant to medicine? Existing molecular diagnostic technologies strengths and weaknesses Development of a nanotechnology-enabledenabled platform for biomarker detection Application of platform in infectious disease
3 Working at the nanoscale Head of a pin: 1,000,000 nm Human hair: 60,000 nm DNA: 2 nm
4 Nanotechnology for biology and medicine Semiconductor quantum dots (2-20 nm) Medical imaging Nanowires (2-20 nm x nm) Biosensing Metallic nanoparticles (2-20 nm) Biosensing Therapeutics Carbon nanotubes (2-20 nm x nm) Biosensing Drug delivery Polymer nanoparticles ( nm) Drug delivery
5 Nanotechnology for biology and medicine nanomaterials Biomolecules/disease biomarkers Biomolecules are nanoscale Nanomaterials have dimensions on right size scale for sensitive detection of their presence From Weiss et al, Science (2005) 307, 539.
6 Development of new nanobiosensors and bioelectronics Kelley research group: University of Toronto Detection of DNA, RNA, protein analytes Identification of diseased cells
7 Diagnostics used for infectious disease diagnosis PCR Faster, but expensive Culture cheap & accurate but slow heat cool X M Becton Dickinson/Cepheid Leaders in MDx for infectious disease
8 Chip-based diagnostics for infectious disease diagnosis The goal: create a highly accurate, highly sensitive chip-based platform for inexpensive testing Low-cost Highly sensitive Multiplexed Standardized Small footprint/handheld Low power requirements Automated sample processing
9 SK1 Electronic/electrochemical sensors Glucose + glucose oxidase electrical current Compactness and simplicity of electrochemical sensors = low cost Free sensing units distributed to patient, pay for consumables
10 Slide 9 SK1 My resaerch group at U. Toronto Shana Kelley, 27/10/2008
11 Electronic/electrochemical DNA & RNA sensors reporter group target DNA/RNA sequence Immobilized probe sequence e - Electrical and electrochemical readout
12 Design of a nanomaterialsnanomaterials-based platform for biomolecular detection 500 nm opening in SiO2 Gold lead (5 µ) electroless deposition Collaboration with Prof. Ted Sargent, U. Toronto (ECE) electrodeposition Nanostructured microelectrode (NME)
13 Nanoscale sensing elements Feature size 100 nm 4 µm Feature size 5000 nm Feature size 20 nm L. Soleymani, Z. Fang, E.H. Sargent, S.O. Kelley, Nature Nanotechnology, 2009, in press, DOI: /nnano
14 Nanoscale sensing elements
15 Nanoscale sensing elements + RNA - RNA As few as 100 molecules detected on-chip Proof-of-principle applications Prostate cancer biomarker analysis (Fang et al, ACS Nano, 2009) Micro RNA expression profiling (Yang et al, Angew. Chem., 2009)
16 Sensitivity controlled by nanostructuring of sensing elements 1 um 2 um 200 nm Limit of detection: 100,000,000 molecules Limit of detection: 1,000,000 molecules Limit of detection: 100 molecules L. Soleymani, Z. Fang, E.H. Sargent, S.O. Kelley, Nature Nanotechnology, 2009, in press, DOI: /nnano
17 Next steps: instrument development USB/battery-powered chip reader software interface microfluidic sample handling
18 Design of specific probes for TB detection Several mycobacteriumspecific regions have been identified M: intra-species variable region M ( ) A-E: primarily inter-species variable regions A ( ) B ( ) C ( ) D ( ) E ( ) EarI SmlI XhoI MslI PmlI NsiI Ppu10I Eco47III HaeII NaeI NgoMIV BtsI SspI Ecl136II PshAI SnaBI AccIII BsiHKAI SacI BsiEI Eco52I ScaI PstI SfcI ApoI EcoRI BsmI FspI EcoRV SgrAI AgeI AlwNI BbvCI BseRI EcoO109I ApaI BamHI XhoII BseSI PspOMI M A BC D E EciI VspI MluI XbaI BspMI BstAPI HincII AatII AhdI TfiI XmnI SmaI XmaI BsrGI BtrI BspHI Tth111I Also: devr, IS6110
19 Detection of antibiotic-resistant bacteria
20 Summary: Chip-based diagnostics for infectious disease A microchip platform with very high sensitivity has been developed low cost of fabrication makes technology suitable for patient screening A handheld chip reader is under development for testing in resource-limited settings A fully automated, rapid screening test for TB testing is one of the applications under development
21 Acknowledgments Kelley group Chip-based diagnostics Zhichao Fang Leyla Soleymani Van Tram Lisa Vasilveya Hooman Zamani Dr. Hong Yang Dr. George Pampalakis Dr. Heather Lord Collaborators Dr. Jeremy Squire (Queen s) Dr. Ted Sargent (U of T) Dr. Fei-Fei Liu (PMH) Financial Support OICR CIHR NSERC Prostate Cancer Foundation of Canada Genome Canada Ontario Centres of Excellence
psp72 Vector INSTRUCTIONS FOR USE OF PRODUCT P2191.
Technical Bulletin psp72 Vector INSTRUCTIONS FOR USE OF PRODUCT P2191. PRINTED IN USA. Revised 9/06 AF9TB040 0906TB040 psp72 Vector All technical literature is available on the Internet at: www.promega.com/tbs/
More informationpsp73 Vector INSTRUCTIONS FOR USE OF PRODUCT P2221.
Technical Bulletin psp73 Vector INSTRUCTIONS FOR USE OF PRODUCT P2221. PRINTED IN USA. Revised 9/06 AF9TB041 0906TB041 psp73 Vector All technical literature is available on the Internet at: www.promega.com/tbs/
More informationTECHNICAL BULLETIN. pgem -9Zf( ) Vector. Instructions for Use of Product P2391. Revised 4/17 TB070
TECHNICAL BULLETIN pgem -9Zf( ) Vector Instructions for Use of Product P2391 Revised 4/17 TB070 pgem -9Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
More informationTECHNICAL BULLETIN. pgem -3Zf( ) Vector. Instructions for Use of Product P2261. Revised 4/17 TB045
TECHNICAL BULLETIN pgem -3Zf( ) Vector Instructions for Use of Product P2261 Revised 4/17 TB045 pgem -3Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
More informationTECHNICAL BULLETIN. pgem -7Zf( ) Vector. Instructions for Use of Products P2371. Revised 4/17 TB069
TECHNICAL BULLETIN pgem -7Zf( ) Vector Instructions for Use of Products P2371 Revised 4/17 TB069 pgem -7Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
More informationpgem -11Zf(+) Vector
TECHNICAL BULLETIN pgem -11Zf(+) Vector Instructions for Use of Products P2411 Revised 4/17 TB075 pgem -11Zf(+) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web
More informationpgem -3Zf(+) Vector INSTRUCTIONS FOR USE OF PRODUCT P2271.
Technical Bulletin pgem -3Zf(+) Vector INSTRUCTIONS FOR USE OF PRODUCT P2271. PRINTED IN USA. Revised 11/07 AF9TB086 1107TB086 pgem -3Zf(+) Vector All technical literature is available on the Internet
More informationTECHNICAL BULLETIN. pgem -5Zf(+) Vector. Instructions for Use of Product P2241. Revised 4/17 TB047
TECHNICAL BULLETIN pgem -5Zf(+) Vector Instructions for Use of Product P2241 Revised 4/17 TB047 pgem -5Zf(+) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
More information2.3 Quantum Dots (QDs)
2.3 Quantum Dots (QDs) QDs are inorganic nanocrystals, approximately 1 10 nm in size, with unique optical properties of broad excitation, narrow size-tunable emission spectra, high photochemical stability,
More informationTArget Clone/ TArget Clone -Plus-
Instruction manual TArget Clone 0811 A4164K TArget Clone/ TArget Clone -Plus- TAK-101 10 reactions TAK-201 10 reactions Store at -20 C Contents [1] Introduction [2]
More informationpgl2 Luciferase Reporter Vectors INSTRUCTIONS FOR USE OF PRODUCTS E1611, E1621, E1631 AND E1641.
Technical Manual pgl2 Luciferase Reporter Vectors INSTRUCTIONS FOR USE OF PRODUCTS E1611, E1621, E1631 AND E1641. PRINTED IN USA. Revised 3/07 AF9TM003 0307TM003 pgl2 Luciferase Reporter Vectors All technical
More informationMGS Mutation Generation System F-701
MGS Mutation Generation System F-701 Transposon-mediated system for insertion scanning mutagenesis: A tool for functional analyses of proteins and regulatory DNA regions Table of Contents: page Description
More informationpci and psi Mammalian Expression Vectors
Technical Bulletin pci and psi Mammalian Expression Vectors INSTRUCTIONS FOR USE OF PRODUCTS E1721 AND E1731. PRINTED IN USA. Revised 7/09 pci and psi Mammalian Expression Vectors All technical literature
More informationList of genes and regulatory parts used to construct plasmids Plasmid pbest-luc (Promega) was the original plasmid used in this work for cloning.
List of genes and regulatory parts used to construct plasmids Plasmid pbest-luc (Promega) was the original plasmid used in this work for cloning. PtacI: TTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT
More informationEE 45X Biomedical Nanotechnology. Course Proposal
EE 45X Biomedical Nanotechnology 1 Introduction Jie Chen ECERF W6-019 492-9820 jchen@ece.ualberta.ca Oct. 15, 2008 The purpose of this document is to propose a new course in the area of Biomedical Nanotechnology
More informationQuantum Dots and Carbon Nanotubes in Cancer diagnose EE453 Project Report submitted by Makram Abd El Qader
Quantum Dots and Carbon Nanotubes in Cancer diagnose EE453 Project Report submitted by Makram Abd El Qader abdelqad@unlv.nevada.edu, Fall 2008 Abstract On the basis of research and cancer medical treatment,
More informationpcat 3 Reporter Vectors INSTRUCTIONS FOR USE OF PRODUCTS E1851, E1861, E1871 AND E1881.
Technical Manual pcat 3 Reporter Vectors INSTRUCTIONS FOR USE OF PRODUCTS E1851, E1861, E1871 AND E1881. PRINTED IN USA. Revised 7/18 pcat 3 Reporter Vectors All technical literature is available on the
More informationTECHNICAL BULLETIN. sicheck Vectors. Instructions for Use of Products C8011 and C8021. Revised 4/16 TB329
TECHNICAL BULLETIN sicheck Vectors Instructions for Use of Products C8011 and C8021 Revised 4/16 TB329 sicheck Vectors All technical literature is available at: www.promega.com/protocols/ Visit the web
More informationOpenPlex. Multiplex Label-Free Interaction Analysis. Open Research Platform
OpenPlex Multiplex Label-Free Interaction Analysis Open Research Platform OpenPlex Get information about: Kinetics Affinity Specificity Concentration Relative binding OpenPlex is the ideal solution for
More informationBIOSENOSRS BIO 580. Nanobiosensors WEEK-13 Fall Semester. Faculty: Dr. Javed H. Niazi KM Faculty of Engineering & Natural Sciences Sabanci University
BIOSENOSRS BIO 580 Nanobiosensors WEEK-13 Fall Semester Faculty: Dr. Javed H. Niazi KM Faculty of Engineering & Natural Sciences Sabanci University Topics that will be covered in the course History of
More informationNanomaterials for Healthcare. Hans Hofstraat. hilips Research Laboratories, Eindhoven, The Netherlands
Nanomaterials for Healthcare Hans Hofstraat hilips Research Laboratories, Eindhoven, The Netherlands utline Introduction Promises of nanotechnology Nanotechnology at Philips Using nanotechnology for real
More informationsicheck Vectors INSTRUCTIONS FOR USE OF PRODUCTS C8011 AND C8021.
Technical Bulletin sicheck Vectors INSTRUCTIONS FOR USE OF PRODUCTS C8011 AND C8021. PRINTED IN USA. Revised 6/09 sicheck Vectors All technical literature is available on the Internet at: www.promega.com/tbs
More informationTECHNICAL BULLETIN. Instruc ons for Use of Product L5620. Revised 9/14 TB305
TECHNICAL BULLETIN pcmvtnt Vector Instruc ons for Use of Product L5620 Revised 9/14 TB305 pcmvtnt Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site to verify
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationThe Electronics Biological Matter Interface.
The Electronics Biological Matter Interface. Introduction. The interface of inorganic materials and biological matter is a subject of significant current interest. The fundamental science of this area
More informationLab-on-a-Chip (LOC) Miniaturization on micro- and nanoscale.
Lab-on-a-Chip (LOC) Miniaturization on micro- and nanoscale http://nanob2a.cin2.es/publication/articles/integrated-optical-devices-for-lab-on-a-chip-biosensing-applications, downloaded 14.04.16 www.kit.edu
More informationNanoFabrication Systems DPN. Nanofabrication Systems. A complete line of instruments and tools for micro and nanopatterning applications
DPN Nanofabrication Systems A complete line of instruments and tools for micro and nanopatterning applications DPN Nanofabrication Systems A complete line of instruments and tools for micro and nanopatterning
More informationDirected Assembly of Nanoparticles for Biosensing Applications
NSF Nanoscale Science and Engineering Center for High-rate Nanomanufacturing (CHN) www.nano.neu.edu Directed Assembly of Nanoparticles for Biosensing Applications Ahmed Busnaina, Director, NSF Nanoscale
More informationTechnical Manual. CheckMate /Flexi Vector Mammalian Two-Hybrid System INSTRUCTIONS FOR USE OF PRODUCT C9360.
Technical Manual CheckMate /Flexi Vector Mammalian Two-Hybrid System INSTRUCTIONS FOR USE OF PRODUCT C9360. CheckMate /Flexi Vector Mammalian Two-Hybrid System All technical literature is available on
More informationMicrofluidics as an enabler for Medical Diagnostics
Microfluidics as an enabler for Medical Diagnostics Henne van Heeren, enablingmnt Microfluidics: The ability to create complex channel manifolds on a single substrate with no dead volume between connecting
More informationDNA Biosensors. Anand Jagota 16 November 2015
DNA Biosensors Anand Jagota 16 November 2015 1 Market, Unmet Needs Worldwide In-vitro diagnostics ~$ 50 Billion and growing Nucleic Acid diagnostics ~$9 Billion Health, Security, Pathogen Detection, etc.
More informationIncreasingly, advances in medicine rely on understanding the multimolecular
PUBLIHED ONLINE: 3 DECEMBER 2014 DOI: 10.1038/NNANO.2014.261 Advancing the speed, sensitivity and accuracy of biomolecular detection using multi-length-scale engineering hana O. Kelley 1 *, Chad A. Mirkin
More informationMaterial Technologies for Mini- and Nanosensing
Material Technologies for Mini- and Nanosensing Thierry Ferrus, Hitachi Cambridge Laboratory, UK Vladimir Privman, Clarkson University, USA Victor Ovchinnikov, Aalto University, Finland Material concept
More informationCancer Nanotechnology and Nanotoxicology: Response to NIH RFAs
Cancer Nanotechnology and Nanotoxicology: Response to NIH RFAs Oct 13, 2015 nanoutah 2015 M.M. Janát-Amsbury, MD, PhD and H. Ghandehari, PhD Obstetrics and Gynecology/Gynecologic Oncology Pharmaceutics
More informationAIT - Austrian Institute of Technology
BIOMARKER DISCOVERY, BIOINFORMATICS, AND BIOSENSOR DEVELOPMENT Technology Experience AIT Austrian Institute of Technology Low-Emission Transport AIT - Austrian Institute of Technology Energy Health & Bioresources
More informationNanotechnology at NC State: Thinking Small to Look into the Future.
Nanotechnology at NC State: Thinking Small to Look into the Future. Gregory N. Parsons Professor, Department of Chemical and Biomolecular Engineering, Director, NC State Nanotechnology Initiative North
More informationOrganic Thin Films Laboratory (OTFL), Hanyang University
Organic Thin Films Laboratory (OTFL), Hanyang University Prof. Haiwon Lee (haiwon@hanyang.ac.kr) Department of Chemistry Hanyang University Distinguished Professor Director of Asian Research Network Program
More informationUNIVERSITI TEKNOLOGI MARA GLUCOSE AND BREAST CANCER 1 (BRCA1) BIOSENSOR BASED ON ZINC OXIDE NANOSTRUCTURES
UNIVERSITI TEKNOLOGI MARA GLUCOSE AND BREAST CANCER 1 (BRCA1) BIOSENSOR BASED ON ZINC OXIDE NANOSTRUCTURES NUR AZIMAH BT MANSOR Thesis submitted in fulfillment of the requirements for the degree of Master
More informationUNIVERSITY OF ROME LA SAPIENZA NANOTECHNOLOGIES ENGINEERING NANOPARTICLES IN BIOMEDICINE
UNIVERSITY OF ROME LA SAPIENZA NANOTECHNOLOGIES ENGINEERING NANOPARTICLES IN BIOMEDICINE Challenges The challenges are: in-situ analysis and in vivo at micro level recognize biomolecules functionality
More informationUltrasensitive Electrochemical Biomolecular Detection Using Nanostructured Microelectrodes
pubs.acs.org/accounts Ultrasensitive Electrochemical Biomolecular Detection Using Nanostructured Microelectrodes Andrew T. Sage, Justin D. Besant, Brian Lam, Edward H. Sargent, and Shana O. Kelley*,,,
More informationPinPoint Xa Protein Purification System
TECHNICAL MANUAL PinPoint Xa Protein Purification System Instructions for Use of Product V2020 Revised 6/17 TM028 PinPoint Xa Protein Purification System All technical literature is available at: www.promega.com/protocols/
More informationPYTHIA: Monolithically integrated interferometric biochips for label-free early detection of Human diseases
PYTHIA: Monolithically integrated interferometric biochips for label-free early detection of Human diseases Ioannis Raptis, IMEL NCSR Demokritos raptis@imel.demokritos.gr www.pythia-project.eu The Problem
More informationnano.tul.cz Innovation and Development of Study Field Nanomaterials at the Technical University of Liberec
Innovation and Development of Study Field Nanomaterials at the Technical University of Liberec nano.tul.cz These materials have been developed within the ESF project: Innovation and development of study
More informationSupporting Information
Supporting Information Cascade Signal Amplification Based on Copper Nanoparticle-Reported Rolling Circle Amplification for Ultrasensitive Electrochemical Detection of the Prostate Cancer Biomarker Ye Zhu
More informationNanostructured Plasmonic Interferometers for Ultrasensitive Label-Free Biosensing. Fil Bartoli Lehigh University 4/9/2014
Nanostructured Plasmonic Interferometers for Ultrasensitive Label-Free Biosensing Fil Bartoli Lehigh University 4/9/2014 P.C. Rossin College of Engineering and Applied Science Department of Electrical
More informationpgem -T and pgem -T Easy Vector Systems
TECHNICAL MANUAL pgem -T and pgem -T Easy Vector Systems Instructions for Use of Products A1360, A1380, A3600 and A3610 Revised 12/18 TM042 pgem -T and pgem -T Easy Vector Systems All technical literature
More informationAptamer-based Field-Effect Biosensor for Tenofovir Detection
SUPPLEMENTARY MATERIAL Aptamer-based Field-Effect Biosensor for Tenofovir Detection N. Aliakbarinodehi 1 *, P. Jolly 2, N. Bhalla 2, A. Miodek 2, G. De Micheli 1, P. Estrela 2, S. Carrara 1 1 School of
More information(General principles and applications)
BIOSENSOR (General principles and applications) Jayanti Tokas, PhD 1 ; Rubina Begum PhD 1 ; Shalini Jain, PhD 2 and Hariom Yadav, PhD 2* 1 Department of Biotechnology, JMIT, Radaur, India; 2 NIDDK, National
More informationUnit title: Nanotechnology
Unit title: Nanotechnology Unit code: K/601/0311 QCF level: 4 Credit value: 15 Aim This unit examines the role of nanotechnology at the interface of Chemistry, Biology, Physics and Engineering, especially
More informationUnderstanding Biosensors
Understanding Biosensors Daniele Gazzola daniele.gazzola@unibo.it Course of Biosensors for the course of Molecular and Industrial Biotechnologies Bologna, December 17th 2009 Practical infoes Daniele Gazzola:
More informationEUROSENSORS SCHOOL. School chair: Péter Fürjes, PhD (MFA, Budapest)
1 EUROSENSORS SCHOOL School chair: Péter Fürjes, PhD (MFA, Budapest) Advisors: Prof. Arnaldo D Amico (Uni Roma) and Prof. Pasqualina M. Sarro (TU Delft) September 4, 2016, Budapest Congress Centre 2 TRENDS
More informationNanotechnology Commercialization Success Story Professor Ray T. Chen The University of Texas, Austin
Nanotechnology Commercialization Success Story Professor Ray T. Chen The University of Texas, Austin chen@ece.utexas.edu Description of the nanotechnology-enabled product or service Through the AFOSR MURI
More informationLigase Independent Cloning (LIC) using petm-13/lic
Ligase Independent Cloning (LIC) using petm-13/lic Creating a construct with a C-terminal His 6 -tag Ligase independent cloning (LIC) is a simple, fast and relatively cheap method to produce expression
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationBIOSENSING USING NANOMATERIALS
BIOSENSING USING NANOMATERIALS Edited by Arben Merkogi WILEY A JOHN WILEY & SONS, INC., PUBLICATION CONTENTS CONTRIBUTORS SERIES PREFACE PREFACE xi xv xvii PART I CARBON NANOTUBES 1 1. Carbon Nanotube-Based
More informationNINT Supporting Innovative Ideas through Nanotechnology
NINT Supporting Innovative Ideas through Nanotechnology (Capabilities and Expertise) Dr. Marianna Kulka, PhD Group Leader, NINT National Research Council Marianna.kulka@nrc.ca National Institute for Nanotechnology
More informationpfusess-chig-hg2 Plasmid featuring the constant region of the human IgG2 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg2
pfusess-chig-hg2 Plasmid featuring the constant region of the human IgG2 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg2 For research use only Version # 12I25-MM PRoDUCT InFoRMATIon Content:
More informationcancer NANOTECHNOLOGY
cancer NANOTECHNOLOGY Going Small for Big Advances Using Nanotechnology to Advance Cancer Diagnosis, Prevention and Treatment U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health
More informationProduct Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months
www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl
More informationImproving the Limit of Detection of Lateral Flow Assays using 3DNA Technology
Improving the Limit of Detection of Lateral Flow Assays using 3DNA Technology Introduction Lateral Flow (LF) and similar assays represent a unique growing class of Point of Care (POC) tests designed to
More informationcancer NANOTECHNOLOGY
cancer NANOTECHNOLOGY Going Small for Big Advances Using Nanotechnology to Advance Cancer Diagnosis, Prevention and Treatment U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health
More informationNano-Scale Engineering III Bio-Molecular Motors for Engineering
Nano-Scale Engineering III Bio-Molecular Motors for Engineering Y. C. Lee Department of Mechanical Engineering University of Colorado Boulder, CO 80309-0427 leeyc@colorado.edu March 4, 2014 1 MLD of Hybrid
More informationApplications of Nanotechnology in Medical Device Design James Marti, Ph.D. Minnesota Nano Center
Applications of Nanotechnology in Medical Device Design James Marti, Ph.D. Minnesota Nano Center November 4, 2015 The University of Minnesota Nano Center An open-use nanotechnology lab with tools for fabricating
More informationTrend in diagnostic biochip. Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital
Trend in diagnostic biochip development Eiichiro Ichiishi, M.D., Ph.D. Department of Internal Medicine International University of Health and Welfare Hospital Handling of the early stage is important for
More informationCurbing Carcinoma using Nanotechnology
e t International Journal on Emerging Technologies (Special Issue on NCRIET-2015) 6(2): 266-273(2015) ISSN No. (Print) : 0975-8364 ISSN No. (Online) : 2249-3255 Curbing Carcinoma using Nanotechnology Rahul
More informationNanomaterials as Transducers in Biosensors. Nanotechnology. Nanotechnology Areas for Development. The Nanotechnology Development Stages
University of Crete Department of Chemistry Laboratory of Analytical Chemistry Iraklion, Crete, GREECE URL: www.analytical_chemistry.uoc.gr Nanomaterials as Transducers in Biosensors.. Chaired by: Dr Renzo
More informationNanotechnology Principles, Applications, Careers, and Education. Copyright 2011 The Pennsylvania State University
Nanotechnology Principles, Applications, Careers, and Education Copyright 2011 The Pennsylvania State University Outline What are the principles of nanotechnology? What are some applications? What kind
More informationNanostructured Electrochemical Biosensors: Towards Point of Care Diagnostics
Nanostructured Electrochemical Biosensors: Towards Point of Care Diagnostics by Brian Lam A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Chemistry
More informationAC : INTRODUCING BIONANOTECHNOLOGY INTO UNDERGRADUATE BIOMEDICAL ENGINEERING
AC 2009-504: INTRODUCING BIONANOTECHNOLOGY INTO UNDERGRADUATE BIOMEDICAL ENGINEERING Aura Gimm, Duke University J. Aura Gimm is Assistant Professor of the Practice and Associated Director of Undergraduate
More informationSingapore nanotechnology combats fatal brain infections
P ublic release date: 28-Jun-2009 Contact: Cathy Yarbrough sciencematter@yahoo.com 858-243-1814 Agency for Science, Technology and Research (A*STAR), Singapore Singapore nanotechnology combats fatal brain
More informationThe strategy. using Atomic Force Microscope; Biomolecules and Neutraceuticals examples
The strategy for Bionanomolecules Characterizations using Atomic Force Microscope; Biomolecules and Neutraceuticals examples Dr. NagibAli Elmarzugi, PhD Head of Nanotechnology Research gp., Biotechnology
More informationWhat is Nano-Bio? Non-Covalent Interactions
- - What is Nano-Bio? Physicist: Biotech: Biologists: -study of molecular interactions -application of nano-tools to study biological systems. -application of nano-tools to detect, treat, and prevent disease
More information"Nanotechnology is based on the premise "smaller is better". Is this a correct premise?
SCHOOLS DEBATES 2011 PROVINCIAL TOPIC "Nanotechnology is based on the premise "smaller is better". Is this a correct premise? Nanotechnology (or nanotech ) is the engineering of functional systems at the
More informationIJSER. Nanotechnology is the creation of functional 1. INTRODUCTION TO NANOTECHNOLOGY 2. INTERDISCIPLANRY APPROACH TO NANOTECHNOLOGY
International Journal of Scientific & Engineering Research, Volume 4, Issue 12, December-2013 1314 Integrative Approach of Nanotechnology Akash Pardeshi 1, Nilanshu Ramteke 2 1 B.E, Medi-caps Institute
More informationIK4 BIOTECHNOLOGY & BIOMATERIALS. Research Alliance.
IK4 Research Alliance BIOTECHNOLOGY & BIOMATERIALS www.ik4.es BIOTECHNOLOGY AND BIOMATERIALS, CROSS-CUTTING TECHNOLOGIES The biotechnology and biomaterials fields are characterised by the fact that they
More informationCentre for NanoHealth
Steve Conlan PhD An integrated collaborative base for businesses in Wales Director - Reproductive Biology & Cancer Research Institute of Life Science School of Medicine Unique interdisciplinary R&D environment,
More informationFuture Areas of Technology Convergence
Future Areas of Technology Convergence Dr J Malcolm Wilkinson Managing Director Technology For Industry Ltd Cambridgeshire, UK Medilink Yorkshire & Humberside, 8 December 2005 1 Technology For Industry
More informationNanotechnological Applications of Biomolecular Motor Systems. Stefan Diez Max-Planck-Institute of Molecular Cell Biology and Genetics Dresden
Nanotechnological Applications of Biomolecular Motor Systems Stefan Diez Max-Planck-Institute of Molecular Cell Biology and Genetics Dresden Max-Planck-Institute of Molecular Cell Biology and Genetics
More informationRegenerative and Immune Engineering Focus Area - Upper-Level Engineering Courses updated June, 2018 For BME Class of 2021 and beyond
Regenerative and Immune Engineering Focus Area - Upper-Level Engineering Courses updated June, 2018 For BME Class of 2021 and beyond EN.510.311 Structure of Materials 3 EN.510.312 Thermodynamics/Materials
More informationRegenerative and Immune Engineering Focus Area Upper-Level Engineering Courses updated October, 2018 For BME Class of 2021 and beyond
Regenerative and Immune Engineering Focus Area Upper-Level Engineering Courses updated October, 2018 For BME Class of 2021 and beyond EN.510.311 Structure of Materials 3 EN.510.312 Thermodynamics/Materials
More informationCenter for Integrated Nanotechnologies & Semiconducting Nanowires
Center for Integrated Nanotechnologies & Semiconducting Nanowires S. Tom Picraux Chief Scientist Center for Integrated Nanotechnologies picraux@lanl.gov Arizona Nanotechnology: Small is Big April 10, 2008
More informationNanodiamond-Based Therapeutic Delivery Films For the Treatment of Cancer and Inflammation
Nanodiamond-Based Therapeutic Delivery Films For the Treatment of Cancer and Inflammation Dean Ho, Ph.D. Assistant Professor Departments of Biomedical and Mechanical Engineering Lurie Comprehensive Cancer
More informationInstitute of Chemical Engineering Sciences FORTH/ICE-HT, Patras
Institute of Chemical Engineering Sciences FORTH/ICE-HT, Patras PERSONNEL Researchers 12 Collaborating Faculty Members 21 Research Associates (with PhD) 30 Graduate Students 45 Visiting Faculty Members
More informationNanosciences, Nanotechnology and Nanosystems. ICT department
Nanosciences, Nanotechnology and Nanosystems ICT department Content ANR overview Nanotechnology development 2 Organisation of the ANR 7 scientific departments : 1 department in charge of the non thematic
More informationVarioustypes of transducing elements and their applications in Bio-Nanotechnology
Varioustypes of transducing elements and their applications in Bio-Nanotechnology Abstract Nanotechnology plays an important role in the development of biosensors. The sensitivity and performance of biosensors
More informationThe National Institutes of Health ICs: mission and funding strategies
The National Institutes of Health ICs: mission and funding strategies Perry Kirkham, Ph.D. Office of the Vice President for Research E-mail: pkirkham@purdue.edu Phone: 63645 NIH Workshop topics and dates
More informationJSPS Core-to-Core Program FY2010 Implementation Plan (Project No. : 20002)
JSPS Core-to-Core Program FY21 Implementation Plan () Research Theme International Core Research Center for Micro/Nano Chemistry Duration of Project 21/4/1 213/3/31 ( 36 months) in Japan () School of Engineering,
More informationNanobiosensor. Chennai, Tamil Nadu, India. Mumbai, Maharashtra, India. Abstract
Advance in Electronic and Electric Engineering ISSN 2231-1297, Volume 3, Number 3 (2013), pp. 321-326 Research India Publications http://www.ripublication.com/aeee.htm Nanobiosensor M. Naveen Kumar Reddy
More informationBio MEMS Class -1 st week
Bio MEMS Class -1 st week Jang, Jaesung Ref: Bashir ADDR Review paper, 2004. 1 Introduction Bio-MEMS: devices or systems, constructed using techniques inspired from micro/nano-scale fabrication, that are
More informationFood Safety Interventions: Adhesin-Specific Nanoparticles for Removal of Foodborne Pathogens
Food Safety Interventions: Adhesin-Specific Nanoparticles for Removal of Foodborne Pathogens Jeremy Tzeng Biological Sciences Clemson University IFT International Nanotechnology Conference, August 1, 2007
More informationBiodetection: Why is it important?
Biodetection: Why is it important? Genetic and Proteomic Analysis Genomics and Proteomics Forensics Molecular Biology Disease Identification Protein Targets Nucleic Acid Targets *Early Disease Diagnosis
More informationTip-enhanced Raman spectroscopic detection of aptamers
Tip-enhanced Raman spectroscopic detection of aptamers Siyu He 1,2, Hongyuan Li 1,2, Zhe He 1, and Dmitri V. Voronine 1,3 1 Texas A&M University, College Station, TX 77843, USA 2 Xi an Jiaotong University,
More informationLETI-HEALTH. Adrienne Pervès Deputy Director LETI Technologies for Biology and healthcare Department
Adrienne Pervès adrienne.perves@cea.fr Deputy Director LETI Technologies for Biology and healthcare Department LETI-HEALTH Micro- NanoTechnologies for Healthcare and Biology MISSION AND EXPERTISE Focused
More informationChapter 2 Capacitive Sensing Electrodes
Chapter 2 Capacitive Sensing Electrodes The capacitive sensing electrodes on the top of a CMOS chip serve as an interface between the microelectronic readout system and the biological/chemical analyte.
More informationPlasmid featuring the constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1
pfusess-chig-hg1 Plasmid featuring the constant region of the human IgG1 heavy chain and the IL2 signal sequence Catalog # pfusess-hchg1 For research use only Version # 12I25-MM PRoDUCT InFoRMATIon Content:
More informationWhat s the big deal about nanotechnology?
What s the big deal about nanotechnology? Featuring Research from the Vanderbilt Institute of Nanoscale Science and Engineering Presentation by Professor Sharon Weiss Department of Electrical Engineering
More informationGold Np s in Diagnosis Invitro Diagnosis. Name : Veera CSR, Chittepu
Gold Np s in Diagnosis Invitro Diagnosis Name : Veera CSR, Chittepu Out line Nanodiagnosis is defined as application of nanotechnology to research in Diagnosis. Gold particles usage in Diagnosis, which
More informationWEARABLE BIOSENSOR Submitted in partial fulfillment of the requirement for the award of degree Of Electronics
A Seminar report On WEARABLE BIOSENSOR Submitted in partial fulfillment of the requirement for the award of degree Of Electronics SUBMITTEDTO: SUBMITTED BY: www.studymafia.org www.studymafia.org Preface
More informationImproved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix
DNA CLONING DNA AMPLIFICATION & PCR Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING
More informationNanophotonics: principle and application. Khai Q. Le Lecture 11 Optical biosensors
Nanophotonics: principle and application Khai Q. Le Lecture 11 Optical biosensors Outline Biosensors: Introduction Optical Biosensors Label-Free Biosensor: Ringresonator Theory Measurements: Bulk sensing
More information