4 Plasmids FIND CHAP TOC. Table 4.1
|
|
|
- Kathleen Lawson
- 6 years ago
- Views:
Transcription
1 FIND CHP TOC Table 4.1
2 FIND CHP TOC Box 4.2 T T T T T T T T T T G T T T T T T T C T T C T T T T T T T T G T T T T T T T T T B Borrelia sp. T T T T T T T T T T G T T T T T T T C T frican swine fever virus T T T T T T T T T T T T T T T T T T G T T T Vaccinia virus T T T T T T T T T T
3 FIND CHP TOC Nick Figure 4.1 Relaxed, no supercoiling Supercoiled, covalently closed circular DN
4 FIND CHP TOC Figure 4.2 H 2 N NH 2 N + Br Chemical structure of ethidium bromide C 2 H 5 Covalently closed circular Negatively supercoiled Relaxed Positively supercoiled No more can bind concentration 0 Low, ~ 2 µg/ml Higher Higher yet Linear DN Up to 1 / 2 bases
5 FIND CHP TOC Figure 4.3 Protein and membrane Linear and nicked circular DN Covalently closed circular DN Before centrifugation RN fter centrifugation
6 FIND CHP TOC Figure 4.4 oriv oriv oriv oriv B oriv oriv oriv oriv C SSO DSO Tyr Rep Nick 3 OH is primer for Pol III Covalent attachment to 5 phosphate Nicking and rejoining by Rep Tyr Pol III + SSB SSO DN ligase RN primer RN Pol SSO DSO + CCC DN Pol III SS DN CCC DN
7 FIND CHP TOC Table 4.2
8 FIND CHP TOC cea p RNII Figure 4.5 imm kil inc oriv nic bom rop mob
9 FIND CHP TOC Rop dimer Figure RN I p RNI Origin p rop 3 5 p RNII RN II 5 RN II 3 5 RN I 5 Kissing complex RN II RNase H RN-DN hybrid allows RN II processing 5 RN II RN I-RN II duplex 3 No RN II-DN hybrid Pol I 3 OH of RN II primes DN synthesis No RN II processing Replication No replication
10 FIND CHP TOC Figure 4.7 Plasmid genetic organization p copb p rep copb rep R1 p cop oriv Promoter p copb p rep p cop Gene products expressed Rep and CopB Rep Cop antisense RN B Replication occurs after plasmid enters cells Rep p copb copb p rep rep oriv + Rep activates oriv C Replication shutdown CopB CopB represses p rep Cop RN C RNase III cleavage Cop RN rep mrn p copb copb p rep rep p cop oriv No replication occurs rep codons Translational coupling Leader peptide
11 FIND CHP TOC Figure 4.8 ori bp par inc rep Dna R1 R2 R3 IR1 IR2 rep mrn
12 FIND CHP TOC Figure 4.9 Low concentration of plasmid Replication No replication High concentration of plasmid; Plasmids coupled
13 FIND CHP TOC R1 R2R3 R1 rep R1 R2 Figure 4.10 R3 B R2 R3
14 FIND CHP TOC Figure 4.11 Monomer cer cer Dimer cer cer cer XerCD cer Monomers cer
15 FIND CHP TOC Figure 4.12
16 FIND CHP TOC Figure 4.13 B
17 FIND CHP TOC Figure 4.14 Unequal distribution of two plasmids Each plasmid type regulates its own copy number B B Unequal distribution of two plasmid types Plasmids regulate each other s replication Unequal distribution of and B Unequal distribution of and B Cured of type Cured of type B
18 FIND CHP TOC Figure 4.15 Inoculate Dilute Incubate Medium without chloramphenicol Four colonies Replicate and incubate on plate with chloramphenicol Several hundred colonies Incubate Spread onto plate without chloramphenicol
19 FIND CHP TOC Table 4.3
20 FIND CHP TOC Figure 4.16 ori + mp r Ligate mp r mp r mp r mp r ori Transform and select mp r colonies This mp r colony contains the ori clone Medium with ampicillin
21 FIND CHP TOC EcoRI Figure 4.17 PstI mp r Tet r pbr kb ori
22 FIND CHP TOC Figure 4.18 EcoRI PstI mp r Tet r mp r Tet r Digest plasmid and foreign DN with Mix and ligate Tet mp r Tet r mp r
23 FIND CHP TOC Figure 4.19 BsmI 2531 SspI 2501 DraII 2674 atii Esp3I 51 NdeI 183 NarI 235 XmnI 2294 BcgI 2215 DrdI 91 BglI 245 FspI 256 PvuI 276 PvuII 306 HindIII 399 EcoRI 450 Multiple cloning site ScaI 2177 laci ' OPZ ' p lac mp r 2000 PvuI 2066 vaii 2059 puc18 2,686 bp PvuII 628 TfiI 641 FspI 1919 TfiI 781 vaii 1837 BglI 1813 DrdI 908 fiiii 806 Cfr10I lwni 1217 puc18 multiple cloning site and primer binding regions: M13/pUC forward sequencing primer Sse 8387 I T7/T3α sequencing primer 5 GT CGCGG CCGT 3 3 GTCCGTT CGC 5 5 CCCGTC CGCGT TGT CGCGG CCGTGCC GCT TGCTGC CTGCGGTCG CTCTGGG TCCCCGGGT CCGGCTCG T TCGTT CTGGTCT GCTGT T TCCT 3 5 CCCGTC CGCGT TGT CG 3 M13/pUC forward 23-base sequencing primer HindIII SphI PstI SalI XbaI KpnI SstI EcoRI α-peptide start cci XmaI BanII HincII SmaI BspMI
24 FIND CHP TOC Figure 4.20 LEU2 2µm origin YEp kb Tet r mp r ori
Product Information GetClone PCR Cloning Vector II. Storage -20 C for 24 months
www.smobio.com Product Information GetClone PCR Cloning Vector II CV1100 20 RXN pget II Vector (25 ng/μl) pget-for Primer (10 μm) pget-rev Primer (10 μm) Storage -20 C for 24 months 23 μl 100 μl 100 μl
pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl
www.smobio.com Product Information GetClone PCR Cloning Vector CV1000 20 RXN pget1.1 Vector (50 ng/μl) 23 μl pget-for Primer (10 μm) 100 μl pget-rev Primer (10 μm) 100 μl Storage -20 C for 24 months Features
Cat. # Product Size DS130 DynaExpress TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1
Product Name: Kit Component TA PCR Cloning Kit (ptakn-2) Cat. # Product Size DS130 TA PCR Cloning Kit (ptakn-2) 20 reactions Box 1 (-20 ) ptakn-2 Vector, linearized 20 µl (50 ng/µl) 1 2 Ligation Buffer
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Chapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
BIO 202 Midterm Exam Winter 2007
BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive
Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
WSSP-04 Chapter 4 Mapping
Chapter 4 Restriction Mapping a Clone Restriction enzymes are often used to move a fragment of DNA from one vector to another. This is commonly referred to as cloning a DNA fragment. Restriction enzymes
Evaluating the Role of G,C-nucleotides and Length of Overhangs in T4 DNA Ligase Efficiency
Evaluating the Role of G,C-nucleotides and Length of Overhangs in T4 DNA Ligase Efficiency GURNEET BOLA Department of Microbiology and Immunology, UBC Ligation of fragments generated by different restriction
7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 Spring 2005 RDM Exam Study Questions 7.02 Recombinant DNA Methods Spring 2005 Exam Study Questions Answer Key
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability
Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu
Answer sheet. Student number:
Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid
Lecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
Ligase Independent Cloning (LIC) using petm-13/lic
Ligase Independent Cloning (LIC) using petm-13/lic Creating a construct with a C-terminal His 6 -tag Ligase independent cloning (LIC) is a simple, fast and relatively cheap method to produce expression
Characteristics of bacterial Plasmid : Size : Conformation : Replication origin of replication : Replication Protein :
Characteristics of bacterial Plasmid : Size : Conformation : Replication origin of replication : Replication Protein : Definition of Plasmid Plasmids are extrachromosomal circular, double stranded DNA
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Requirements for the Genetic Material
Requirements for the Genetic Material 1. Replication Reproduced and transmitted faithfully from cell to cell-generation to generation. 2. Information Storage Biologically useful information in a stable
Biol/Chem 475 Spring 2007
Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and
SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name:
SBI4U Culminating Activity Part 1: Genetic Engineering of a Recombinant Plasmid Name: Background Read through The Major Steps of Cloning of DNA on page 290 and examine the figure on page 291. This is the
List of genes and regulatory parts used to construct plasmids Plasmid pbest-luc (Promega) was the original plasmid used in this work for cloning.
List of genes and regulatory parts used to construct plasmids Plasmid pbest-luc (Promega) was the original plasmid used in this work for cloning. PtacI: TTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATT
DNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
NAME TA SEC Problem Set 3 FRIDAY March 5, Problem sets will NOT be accepted late.
MIT Department of Biology 7.013: Introductory Biology - Spring 2004 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. laudette ardel NME T SE 7.013 Problem Set 3 FRIDY March 5, 2004 Problem
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
Classic cloning with pask-iba and pexpr-iba vectors
Classic cloning with pask-iba and pexpr-iba vectors General protocol Last date of revision March 2017 Version PR08-0008 For research use only Important licensing information Products featuring CMV promoter,
CHE.167 Genetics. Bacterial Plasmids
1 Bacterial Plasmids Open circular form Covalently closed circles (ccc-form) 2 Bacterial plasmids Replication, Maintenance Genes for specific functions Replication - Origin of replication (oriv) - Regulatory
Determination of Exclusion Effect in Wild Type and Rop Deficient Mutated pbr322 Co-transformations
Determination of Exclusion Effect in Wild Type and Rop Deficient Mutated pbr322 Co-transformations Suzana Sabaiduc and Andy Lo Microbiology and Immunology University of British Columbia pbr322 is an expression
Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19
Construction of a Mutant pbr322 Using Site-Directed Mutagenesis to Investigate the Exclusion Effects of pbr322 During Co-transformation with puc19 IVANA KOMLJENOVIC Department of Microbiology and Immunology,
IPLE OF RECOMBINANT DNA TECHNOLOGY
PRINCIP IPLE OF RECOMBINANT DNA TECHNOLOGY DEBBIE S. RETNONINGRUM SCHOOL OF PHARMACY INSTITUT TEKNOLOGI BANDUNG Recombinant DNA Technology 1 REFERENCES 1. Glick, BR and JJ Pasternak, 2003, Molecular Biotechnology:
Goal: Move the Gene for Miraculin into an Expression Vector
LEARNING OBJECTIVES Proper use of restriction endonucleases Tying restriction fragmentation to electrophoresis Critical Thinking Use of internet resources Students will need to develop strategies using
Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE
Uppsala 2001-04-01 REPORT FROM EXPERIMENTS IN BACTERIAL GENETICS AND GENE TECHNIQUE Laboratory assistants: Maria Jönsson Amera Gibreel Students: Contents ASSIGNMENT:... 3 INTRODUCTION:... 3 MATERIAL AND
MGS Mutation Generation System F-701
MGS Mutation Generation System F-701 Transposon-mediated system for insertion scanning mutagenesis: A tool for functional analyses of proteins and regulatory DNA regions Table of Contents: page Description
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
Recombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
B. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
G0463 pscaavmcsbghpa MCS. Plasmid Features:
3200 G0463 pscaavmcsbghpa Plasmid Features: Coordinates Feature 980-1085 AAV2 ITR 106bp (mutated ITR) 1110-1226 MCS 1227-1440 BgHpA 1453-1595 AAV2 ITR (143bp) 2496-3356 B-lactamase (Ampicillin) Antibiotic
Molecular Biology: General Theory
Molecular Biology: General Theory Author: Dr Darshana Morar Licensed under a Creative Commons Attribution license. DNA REPLICATION DNA replication is the process of duplicating the DNA sequence in the
Molecular Biology: General Theory
Molecular Biology: General Theory Author: Dr Darshana Morar Licensed under a Creative Commons Attribution license. DNA REPLICATION DNA replication is the process of duplicating the DNA sequence in the
https://de.wikipedia.org/wiki/operon Procaryotic Operon
2 Basics of Cloning https://de.wikipedia.org/wiki/operon Procaryotic Operon Promotor Operator ATG..TAA CDS Expression plasmid Required factors for protein expression Promoters Constitutive promoters Always
DNA replication: Enzymes link the aligned nucleotides by phosphodiester bonds to form a continuous strand.
DNA replication: Copying genetic information for transmission to the next generation Occurs in S phase of cell cycle Process of DNA duplicating itself Begins with the unwinding of the double helix to expose
1 Macromolecular Synthesis
FID Figure 1.1 1 helical turn = 3.4 nm ydrogen bond Sugar-phosphate backbone Base FID Figure 1.2 Bases 1 2 6 7 5 8 4 9 3 urine 2 denine 2 uanine 4 2 3 5 3 2 1 6 yrimidine ytosine Uracil hymine Sugars 2
Chapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
Cloning and Expression of Recombinant Proteins
Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D-85748 Garching Germany guenther.woehlke@mytum.de 1 Created
Page 1 of 10 MIDTERM EXAM OF BIO
Page 1 of 10 MIDTERM EXAM OF BIO3151 2018 Name: Student number: Day of your section: Monday Tuesday Thursday Friday Part I: Calculations 1 2 3 4 5 6 7 NaCl: Water: 8 LiCl: MgCl 2: Part II: Bioinformatics
psp72 Vector INSTRUCTIONS FOR USE OF PRODUCT P2191.
Technical Bulletin psp72 Vector INSTRUCTIONS FOR USE OF PRODUCT P2191. PRINTED IN USA. Revised 9/06 AF9TB040 0906TB040 psp72 Vector All technical literature is available on the Internet at: www.promega.com/tbs/
b) Is it possible for females to get hemophilia? If yes, explain how. If no, explain why not.
Question 3, continued a) What is the mode of inheritance of hemophilia? b) Is it possible for females to get hemophilia? If yes, explain how. If no, explain why not. All four of Alexei s sisters are depicted
psp73 Vector INSTRUCTIONS FOR USE OF PRODUCT P2221.
Technical Bulletin psp73 Vector INSTRUCTIONS FOR USE OF PRODUCT P2221. PRINTED IN USA. Revised 9/06 AF9TB041 0906TB041 psp73 Vector All technical literature is available on the Internet at: www.promega.com/tbs/
Chapter 10 (Part II) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the
Expression of Recombinant Proteins
Expression of Recombinant Proteins Uses of Cloned Genes sequencing reagents (eg, probes) protein production insufficient natural quantities modify/mutagenesis library screening Expression Vector Features
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11988 Supplementary Figure 1. Digestion of model DNA substrates. a, Linearized plasmid DNA (pik31- PstI, lanes 1 and 2), supercoiled plasmid (pik31, lanes 3 and 4), singly nicked plasmid
Ch 8. Microbial Genetics
Ch 8 Microbial Genetics SLOs Define the terms genome and gene, and differentiate between genotype and phenotype. Draw a detailed segment of DNA. Summarize the steps of bacterial DNA replication, and identify
DNA. Chapter 1. Molecular Diagnostics Fundamentals, Methods and Clinical Applications Second Edition 1/29/2013. Copyright 2012 F.A.
DNA Chapter 1 1 Deoxyribonucleic acid (DNA) is a genetic information storage system. A T G C T A C G DNA is a polymer of nucleotides. Nucleotides are phosphorylated nucleosides. DNA Nucleosides comprise
PLNT2530 (2018) Unit 6b Sequence Libraries
PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the
Cloning in bacteria. Presenter: Vito Baraka (BSc,MSc Cand.)
Cloning in bacteria Presenter: Vito Baraka (BSc,MSc Cand.) Introduction DNA cloning involves separating a specific gene or DNA segment from a larger chromosome, attaching it to a small molecule of carrier
YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2
9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI
2.5. Equipment and materials supplied by user Template preparation by cloning into plexsy_invitro-2 vector 4. 6.
Manual 15 Reactions LEXSY in vitro Translation Cell-free protein expression kit based on Leishmania tarentolae contains the vector plexsy_invitro-2 Cat. No. EGE-2002-15 FOR RESEARCH USE ONLY. NOT INTENDED
Attempt to Construct a Rop + puc19 from pbr322 Mutant lacking the Tetracycline Resistance Gene
Attempt to Construct a Rop + puc19 from pbr322 Mutant lacking the Tetracycline Resistance Gene DELIA WANG Department of Microbiology and Immunology, UBC The two commonly used plasmid vectors, pbr322 and
Computational Biology 2. Pawan Dhar BII
Computational Biology 2 Pawan Dhar BII Lecture 1 Introduction to terms, techniques and concepts in molecular biology Molecular biology - a primer Human body has 100 trillion cells each containing 3 billion
In vitro mutagenesis
Core course BMS361N Genetic Engineering In vitro mutagenesis Prof. Narkunaraja Shanmugam Dept. Of Biomedical Science School of Basic Medical Sciences Bharathidasan University In vitro mutagenesis Many
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases For research use only Cat. # : GVT202 Size : 20 Reactions
pgm-t Cloning Kit For direct cloning of PCR products generated by Taq DNA polymerases Cat. # : GVT202 Size : 20 Reactions Store at -20 For research use only 1 pgm-t Cloning Kit Cat. No.: GVT202 Kit Contents
Chapter 10 (Part I) Gene Isolation and Manipulation
Biology 234 J. G. Doheny Chapter 10 (Part I) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. From which types of organisms were most restriction
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
4. Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily:
CHEM 4420 Exam I Spring 2012 Page 1 of 5 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation
Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation Table S1 Oligonucleotides used in this study Table
TECHNICAL BULLETIN. pgem -3Zf( ) Vector. Instructions for Use of Product P2261. Revised 4/17 TB045
TECHNICAL BULLETIN pgem -3Zf( ) Vector Instructions for Use of Product P2261 Revised 4/17 TB045 pgem -3Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
BIOTECHNOLOGY : PRINCIPLES AND PROCESSES
CHAPTER 11 BIOTECHNOLOGY : PRINCIPLES AND PROCESSES POINTS TO REMEMBER Bacteriophage : A virus that infects bacteria. Bioreactor : A large vessel in which raw materials are biologically converted into
TECHNICAL BULLETIN. pgem -9Zf( ) Vector. Instructions for Use of Product P2391. Revised 4/17 TB070
TECHNICAL BULLETIN pgem -9Zf( ) Vector Instructions for Use of Product P2391 Revised 4/17 TB070 pgem -9Zf( ) Vector All technical literature is available at: www.promega.com/protocols/ Visit the web site
Biology 4100 Minor Assignment 1 January 19, 2007
Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on
Standard Cloning Vectors Version 7.1, Revision
Standard Cloning Vectors Version 7.1, Revision 2017-09-26 Biomatik has been serving worldwide researchers with quality custom gene synthesis service since 2004. There are several standard vectors can be
Construction of an enlarged puc19 vector with a rop gene designed to study plasmid maintenance in Escherichia coli
Construction of an enlarged puc19 vector with a rop gene designed to study plasmid maintenance in Escherichia coli Benson Chang, Arnab Ray, Thomas Tsuei, Rachel Wan Department of Microbiology and Immunology,
Recombinants and Transformation
Jesse Ruben Partner Roman Verner BMB 442 Recombinants and Transformation Introduction The goal of this experiment was to take two antibiotic resistance genes for ampicillin and kanamycin from plasmids
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
pdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
Enforcement Cloning System pkf3 (Code No. 6086) E. coli TH2 Competent Cells (Code No. 9056) Table of Contents
E. coli TH2 Competent Cells (Code No. 9056) v.041027 Table of Contents 1. Description...2 2. Kit Component...2 3. Storage...2 4. References...2 5. Principle...4 6. Protocol...5 7. Note on Product...5 8.
Microbiology 微生物学 Spring-Summer
Microbiology 微生物学 2017 Spring-Summer Relevant Information and Resources Course slides can be found at http://mypage.zju.edu.cn/haichun 教学工作 Course-related questions will be answered through emails. Textbook:
Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes
Supplemental Material for Different Upstream Activators Stimulate Transcription Through Distinct Coactivator Complexes Dong-ki Lee, Soyoun Kim, and John T. Lis Due to be published as a Research Communication
Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears
Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and
7.012 Exam Two KEY
7.012 Exam wo KEY -- 2006 Exam starts at 10:05 am and ends at 10:55 am. here are 9 pages including this cover page & the genetic code. Please write your name on each page. Only writing on the FRON of every
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20
pgm-t Cloning Kit Cat. # : GVT202 Size : 20 Reactions Store at -20 1 Kit Contents Contents pgm-t Cloning Kit pgm-t Vector (50 ng/μl) 20 μl T4 DNA Ligase (3 U/μl) 20 μl 10X T4 DNA Ligation Buffer 30 μl
The replication forks Summarising what we know:
When does replication occur? MBLG1001 lecture 10 Replication the once in a lifetime event! Full blown replication only occurs once, just before cell division BUT the DNA template is constantly being repaired.
Experimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
Molecular Techniques Third-year Biology
PLANNING Genetics Lab practices Molecular Techniques. Genetics Lab practices protocol. 2015-16 PCR-DIRECTED MUTAGENESIS, MOLECULAR CLONING AND RESTRICTION ANALYSIS Sessions 1 & 2 (2x3 hours): PCR-directed
Enzymes used in DNA Replication
Enzymes used in DNA Replication This document holds the enzymes used in DNA replication, their pictorial representation and functioning. DNA polymerase: DNA polymerase is the chief enzyme of DNA replication.
Mcbio 316: Exam 3. (10) 2. Compare and contrast operon vs gene fusions.
Mcbio 316: Exam 3 Name (15) 1. Transposons provide useful tools for genetic analysis. List 5 different uses of transposon insertions. ANSWER: Many answers are possible, however, if multiple items on the
HiPer Plasmid DNA Cloning Teaching Kit
HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-
SELECTED TECHNIQUES AND APPLICATIONS IN MOLECULAR GENETICS
SELECTED TECHNIQUES APPLICATIONS IN MOLECULAR GENETICS Restriction Enzymes 15.1.1 The Discovery of Restriction Endonucleases p. 420 2 2, 3, 4, 6, 7, 8 Assigned Reading in Snustad 6th ed. 14.1.1 The Discovery
Gateway Vectors for BiFC
Gateway Vectors for BiFC 1. The enhanced YFP (EYFP) are used (Split EYFP). 2. The Fusion fusion gene is expressed by CaMV35S promoter. 3. The N- or C-terminal fragments of EYFP are fused subsequent to
pgem -3Zf(+) Vector INSTRUCTIONS FOR USE OF PRODUCT P2271.
Technical Bulletin pgem -3Zf(+) Vector INSTRUCTIONS FOR USE OF PRODUCT P2271. PRINTED IN USA. Revised 11/07 AF9TB086 1107TB086 pgem -3Zf(+) Vector All technical literature is available on the Internet
PCR Cloning II fusion domains for purification His 6 GST chitin binding protein MBP
PCR cloning : why secondary amplification? May 26, 2009 secondary amplification amplification of the coding sequence alone or of defined fragments ligation into expression vector insertion of fusion domains
Replication of DNA Virus Genomes. Lecture 7 Virology W3310/4310 Spring 2013
Replication of DNA Virus Genomes Lecture 7 Virology W3310/4310 Spring 2013 It s all about Initiation Problems faced by DNA replication machinery Viruses must replicate their genomes to make new progeny
MCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
Certificate of Analysis
Certificate of Analysis pet6xhn Expression Vector Set Contents Product Information... 1 pet6xhn-n, pet6xhn-c, and pet6xhn-gfpuv Vector Information... 2 Location of Features... 4 Additional Information...
In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0.
In other words there are 4.0 x10 5 phosphodiester groups in the basic form to one in the acidic form at ph 7.0. There are a number of shorthand abbreviations a linear polymer of deoxyribonucleotides. One
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
XXII DNA cloning and sequencing. Outline
XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;
4. Analysing genes II Isolate mutants*
.. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual