Characterization of antiproliferative potential and biological targets of a copper

Size: px

Start display at page:

Download "Characterization of antiproliferative potential and biological targets of a copper"

Cordelia Harper
6 years ago
Views:

1 SUPPLEMENTARY MATERIAL Characterization of antiproliferative potential and biological targets of a copper compound containing 4 -phenyl terpyridine Ana Soraia Mendo 1, Sara Figueiredo 1,2, Catarina Roma-Rodrigues 1, Paula A. Videira 3, Zhen Ma 4, Mário Diniz 5, Miguel Larguinho 2,5, Pedro M. Costa 6, João C. Lima 7, Armando J.L. Pombeiro 4, Pedro V. Baptista 1,2, Alexandra R. Fernandes 1,4 1 UCIBIO, Departamento de Ciências da Vida, Faculdade de Ciências e Tecnologia da Universidade Nova de Lisboa, Campus de Caparica, Caparica, Portugal 2 Nanomedicine@FCT, CIGMH, UCIBIO, Departamento de Ciências da Vida, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa. Campus da Caparica, Caparica, Portugal. 3 CEDOC, Faculdade de Ciências Médicas, Universidade Nova de Lisboa, Lisboa, Portugal 4 Centro de Química Estrutural, Complexo 1, Instituto Superior Técnico, Universidade de Lisboa, Avenida Rovisco Pais, Lisboa, Portugal 5 UCIBIO, REQUIMTE, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa. Campus de Caparica, Caparica, Portugal 6 MARE - Marine and Environmental Sciences Centre, Departamento de Ciências e Engenharia do Ambiente. Faculdade de Ciências e Tecnologia. Universidade Nova de Lisboa Campus de Caparica, Caparica, Portugal 7 LAQV, REQUIMTE, Faculdade de Ciências e Tecnologia, Universidade Nova de Lisboa. Campus de Caparica, Caparica, Portugal *Corresponding author: Alexandra R. Fernandes, ma.fernandes@fct.unl.pt

2 S1- Apoptotic and Cell cycle genes expression by real-time PCR For apoptotic gene expression levels HCT116 cells were seeded into 25 cm 2 culture flasks at 2x10 5 cells/flask. Culture medium was removed 24 h after platting and replaced with 3 ml of fresh medium containing either 0.05 µm of ZM5 or DMSO. Cells were incubated for 3, 6, 9 and 12 h, collected, washed with 1x cold phosphate-buffered saline (PBS). Total RNA was extracted from the cell pellet using the SV Total RNA Isolation System Kit (Promega) and cdna was synthesized using cdna Synthesis Kit (Bioline, London, UK), both according to the manufacturers instructions. Real-time PCR amplification was performed in a LightCycler 480 (Roche, Basel, Switzerland) using SensiFAST TM SYBR No-ROX Kit (Bioline) in 10 µl reaction volume containing 5 µl of 2x SensiFAST SYBR No-ROX Mix, 85 ng of cdna and 0.30 pmol/µl of each primer. Forward and reverse primer sequences and specific annealing temperatures are shown in Table 1. Table SI Primers and annealing temperatures used for Real-time PCR. Gene Encoded protein Forward primer (5 3 ) Reverse primer (5 3 ) T annealing ( C) rrna18s5 Ribossomal major subunit GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG BAX Bax TGCTTCAGGGTTTCATCCAGGA ACGGCGGCAATCATCCTCTG BCL-2 Bcl-2 CTTCGCCGAGATGTCCAGCCA CGCTCTCCACACACATGACCC CASP3 Caspase 3 TACCAGTGGAGGCCGACTTC GCACAAAGCGACTGGATGAAC Product size (bp) Ref Amplification conditions: 95 C for 2 min, followed by 40 cycles of (i) denaturation at 95 C for 5 sec, annealing at C for 10 sec and (iii) extension at 72 C for 10 sec. All the results were originated from three independent experiments. Threshold cycle values were analyzed by the 2 -ΔΔCt method 74. The rrna18s5 expression levels were used as reference to

3 normalize the expression of the apoptotic genes. The results were expressed as the ratio of reference gene to target gene by using the following equation (1): (1) The relative expression levels were determined using the equation (2): (2) The expression of apoptotic genes was calculated using the expression of 2 -ΔΔCt. The PCR products were subjected to electrophoresis on a 2 % (w/v) agarose gel (TAE 1x) during 50 min at 5 V/cm, stained with GelRed (Biotarget, Portugal) and photographed using a UVI TEC transilluminator (Cambridge, UK) coupled to a Kodak AlphaDigiDoc camera (Alpha Innotech, California, USA). Image acquisition was performed using AlphaEaseFC software (AlphaDigiDoc 1000, Alpha Innotech). For cell cycle gene expression levels, HCT116 cells were cultured in 25 cm 2 culture flasks with a cell density of 2x10 5 cells/flask and were synchronize in early S-phase by double thymidine block as described above. Culture medium with thymidine was removed and replaced by 3 ml of fresh medium containing either 0.05 µm of ZM5 or 0.1 % (v/v) DMSO and incubated for 8, 12 and 24 h at 37 ºC and 5 % CO 2. Cells were collected and washed with PBS 1x. Total RNA was extracted and converted into cdna as described above. Genes involved in cell cycle regulation were amplified with the HOT FIREPol EvaGreen qpcr Mix Plus KIT (ROX) (Solis BioDyne) according to the manufacturers instructions. Real-Time

4 PCR reactions were performed in a Rotor Gene 6000 (Corbert Life Science) using the following conditions: initial denaturation at 95 C for 15 min (single step), denaturation at 95 C for 15 s, annealing at C for 20 s and extension at 72 C for 20 s, for a total of 40 cycles. Primer sequences and specific annealing temperatures are described in Table 2. Variations in gene expression were determined by the 2 -ΔΔCt method 74. The PCR products were subjected to electrophoresis on a 2 % (w/v) agarose gel (TAE 1x) during 50 min at 5 V/cm, stained with GelRed (Biotarget, Portugal). Table SII - Primers and annealing temperatures used for RT-q PCR. Gene Encoded protein Forward primer (5 3 ) Reverse primer (5 3 ) T annealing ( C) Product size (bp) ACTB β-actin CTACAATGAGCTGCGTGTGGC CAGGTCCAGACGCAGGATGGC CCND1 Cyclin D1 CCCTCGGTGTCCTACTTCAA AGGAAGCGGTCCAGGTAGTT CCND2 Cyclin D2 TGGGGAAGTTGAAGTGGAAC ATCCACGTCTGTGTTGGTGA CCND3 Cyclin D3 CTGCCTCCAGGAACCACA GCTTGACTAGCCACCGAAAT CDK2 Cdk2 ACCAGCTCTTCCGGATCTTT CATCCTGGAAGAAAGGGTGA Ref CDK4 Cdk4 CTGAGAATGGCTACCTCTC AGCCACCTCACGAACTGTGC CDK6 Cdk6 CCGTGGATCTCTGGAGTGTT TCTCCTGGGAGTCCAATCAC CCNE1 Cyclin E1 ATCCTCCAAAGTTGCACCAG AGGGGACTTAAACGCCACTT CDKN1A p21 GCTTCATGCCAGCTACTTCC AGGTGAGGGGACTCCAAAGT S2- Expression of cell cycle genes One of the roles of p21 is the inhibition of the activation of Caspase 3 through the formation of pro-caspase 3/p21 complex that prevents cell death and sustain cell survival 79,80. ZM5 caused down-regulation of CDKN1A, at 8, 12 and 24 h (Figure 1). This is in agreement with what was observed for flow cytometry and Caspase 3 mrna levels.

5 Variation of expression (2 - Ct ) Time of incubation (h) CDKN1A Figure S1 - Expression of gene CDKN1A in HCT116 cells synchronized with 2 mm of thymidine and incubated with 0.05 µm of ZM5 during 8, 12 and 24 h. The variation of gene expression is calculated by 2 -ΔΔCt and the data presented as changes in the gene expression normalized to an internal reference (ACTB) and an untreated control (DMSO). The results are expressed as the mean ± SEM from three independent experiments.

6 Variation of expression (2 - Ct ) Variation of expression (2 - Ct ) Variation of expression (2 - Ct ) A B h h CCND1 CCND2 CCND3 CDK4 CDK6 CCNE1 CDK CCND1 CCND2 CCND3 CDK4 CDK6 CCNE1 CDK2 C CCND1 CCND2 CCND3 CDK4 CDK6 CCNE1 CDK2 24 h Figure S2 - Expression of CCND1, CCND2, CCND3, CCNE1, CDK2, CDK4 and CDK6 in HCT116 cells synchronized with 2 mm of thymidine and incubated with 0.05 µm of ZM5 during 8 h (A), 12 h (B) and 24 h (C). The variation of gene expression is calculated by 2 -ΔΔCt method and the data presented as changes in the gene expression normalized to an internal reference (ACTB) and an untreated control (DMSO). The results are expressed as the mean ± SEM from three independent experiments.

7 The progression of the cell cycle, namely transition from early to late G1 is regulates by cyclins D1, D2 and D3 conjugate with Cdk4 and Cdk6 81,82. These complexes induce phosphorylation of prb losing its interaction with the E2F proteins which are necessary for transcription of genes indispensable for S phase 83. In late G1, Cdk2/cyclin E complexes continue the phosphorylation of prb allowing the progression to S phase 83. Hence, genes that codify these proteins were analyzed and it was detected that after 8 h of incubation with ZM5 (Supplementary Figure S2A) the expression of CCND1, CCND2 and CCND3 genes were not significantly altered. However, CDK4 and CDK6 were both under-expressed as well as CCNE1 and CDK2, data in agreement with the observation at 8h of incubation the majority of cells are in G2/M phase. Relevant genes in early G1 phase, CCND1, CCND2, CCND3, CDK4 and CDK6, and late G1, CCNE1 and CDK2, were under-expressed at 12 h (Supplementary Figure 2B) data that, once again, is in agreement that exposure to ZM5 induces a slight delay in cell cycle progression. Indeed, Martinez and co-workers 84 referred that 12 h after thymidine block, the majority of HCT116 cells are in G0/G1 phase. The observations seen after 24 h of exposure to ZM5 also corroborate the fact that ZM5 delays the cell cycle. Although at this time point the majority of cells are in G0/G1 phase, the amount of cells treated with the compound are less in this cycle phase, but genes CCND1, CCND3 and CDK6 are over-expressed, meaning a higher number of cells are in early G1 phase comparatively to control (Supplementary Figure 2C). Cells treated with ZM5 also show under-expression of CDK2 gene, proving that cell are not late G1. In conclusion, at 24 h control cells are apparently in G1 late whereas treated cells are in early G1 confirming the delay already observed.

Plasmid DNA form (%) Plasmid DNA form (%) Plasmid DNA form (%) S3- ZM5 cleavage of DNA A B 100 80 60 40 20 NC

3 4 5 6 Lanes Figure S3 DNA cleavage by ZM5. A) Agarose gel electrophoresis (0.

concentrations (5-100 μm) and DMSO (control).

Lane 1: pbsk II incubated with DMSO; lane 2-7: pbsk II incubated with increasing concentrations of ZM5 (5,

8 Plasmid DNA form (%) Plasmid DNA form (%) Plasmid DNA form (%) S3- ZM5 cleavage of DNA A B NC L SC C D Lanes NC L SC E F Lanes 100 NC L SC Lanes Figure S3 DNA cleavage by ZM5. A) Agarose gel electrophoresis (0.7 % (w/v)) and B) % of plasmid DNA isoforms showing the cleavage of pbsk II DNA (200 ng) by different ZM5 concentrations (5-100 μm) and DMSO (control). Incubation for 24 h at 37 C in 5mM Tris-HCl and 50 mm NaCl buffer (ph 7.2). Lane 1: pbsk II incubated with DMSO; lane 2-7: pbsk II incubated with increasing concentrations of ZM5 (5, 10, 25, 50, 75 and 100 μm). C) Agarose gel electrophoresis (0.7 % (w/v)) and D) % of plasmid DNA isoforms showing the cleavage of pbsk II DNA (200 ng) incubated with 10 μm ZM5 at different time periods (at 37 C in 5mM Tris-HCl and 50 mm NaCl

9 buffer (ph 7.2)). Lane 1: pbsk II incubated with DMSO; lane 2-6: pbsk II incubated with 10 μm ZM5 at 1, 5, 20, 24 and 48 h. E) Agarose gel electrophoresis (0.7 % (w/v)) and F) % of plasmid DNA isoforms showing the cleavage of pbsk II DNA (200 ng) incubated with 50 μm ZM5 at different time periods (at 37 C in 5mM Tris-HCl and 50 mm NaCl buffer (ph 7.2)). Lane 1: pbsk II incubated with DMSO; lane 2-6: pbsk II incubated with 50 μm ZM5 at 1, 5, 20, 24 and 48 h. SC supercoiled form; NC nicked circular form; L linear form. Bars indicate percentage of pdna in each conformation determined by Gel Analyzer software. After 24 h and 48 h, a decrease of the SC form and an increase of L form were observed for the lowest ZM5 concentration (10 μm). The NC form has no significant variations over time, and one might assume that SC is converted directly in L (Figure S3A, B). Incubation with a higher concentration of ZM5 (50 μm) (Figure S3C, D) shows a time dependent decrease in the SC form. The L form presents a gradual increase over time that appears to include the decay of SC and NC forms, indicating conversion to L conformation. Since the NC form does not increase, one may assume that the SC is converted directly to L, indicating once again the ability of ZM5 to induce double-strand cleavage.

10 S4- ZM5 cleavage of DNA under anaerobic conditions Figure S4 DNA cleavage by ZM5. A) Agarose gel electrophoresis (0.7 % (w/v)) and B) % of plasmid DNA isoforms showing the cleavage of puc18 DNA (200 ng) by different ZM5 concentrations ( μm) and DMSO (control). Assay was performed under anaerobic (lanes 2-7) or aerobic conditions (lanes 8-13). Incubation for 24 h at 37 C in 5mM Tris-HCl and 50 mm NaCl buffer (ph 7.2). Lane 1: puc18 linearized; lane 2 and 8: puc18; lane 3 and 9: puc18 incubated with DMSO; lane 4-7 and 10-13: puc18 incubated with increasing concentrations of ZM5 (10, 50, 75 and 100 μm); SC supercoiled form; NC nicked circular form; L linear form. Bars indicate percentage of pdna in each conformation determined by Gel Analyzer software. Under anaerobic conditions, pdna cleavage displays a similar pattern to that ofaerobic conditions. The SC form shows a decrease (more evident for 100 μm of ZM5), which corresponds to the increase observed in the L form. The NC form also decreases with increasing concentration of DNA and at 50 μm of ZM5 this form is totally converted into L. The direct conversion of SC form to L occurs through double strand breaks. Since the assay

is performed under nitrogen atmosphere, one might state that cleavage occurs through hydrolytic mechanism. These data are in accordance to what is depicted in Figure S3A and B.

11 is performed under nitrogen atmosphere, one might state that cleavage occurs through hydrolytic mechanism. These data are in accordance to what is depicted in Figure S3A and B. S5- Comet Assay Figure S5 Representative images for the obtained comets: A) DMSO (control) ~12% DNA in tail; B) 0.1 µm ZM5 ~55% DNA in tail; C) 0.05 % (v/v) H 2 O 2 ~75% DNA in tail. Table SIII Percentage of cells that present a determined degree of DNA damage for each condition tested: untreated HCT116 tumor cells (control), cells treated with 0.1 % (v/v) DMSO (vehicle control), 0.1 μm ZM5 or 0.05 % (v/v) H 2 O 2. DNA percentage in tail was determined by CometScore software and organized in classes 0-4 according to the degree of damage, corresponding to [0-20%[, [20-40%[, [40-60%[, [60-80%[ and [80-100%]. Values refer to data presented in Figure 6. Percentage of DNA in tail Class 0 [0-20%[ Class 1 [20-40%[ Class 2 [40-60%[ Class 3 [60-80%[ Class 4 [80-100%] Percentage of cells (%) Control H 2 O 2 DMSO ZM

12 GST activity ( mol/min/mg protein) Total Antioxidant Capacity ( mol/mg protein) S6- Total Antioxidant Capacity DMSO Control ZM5 Figure S6 Total antioxidant capacity measured in protein extracts from HCT116 cells treated with 0.1 % (v/v) DMSO (control) and 0.05 µm ZM5 during 24 h. Values are expressed as the mean ± SEM from three independent experiments. S7- GST Activity Negative Control DMSO Control ZM5 H 2 O 2 Figure S7 GST activity of protein extracts from HCT116 cells incubated in culture medium only (negative control), DMSO (DMSO control), 0.05 μm ZM5 during 24 h and also 0.05 % (v/v) H 2 O 2 for 30 min. Values are expressed as the mean ± SEM from three independent experiments.

13 Lipid peroxide (pmol MDA/mg protein) S8- Lipid Peroxidation Negative Control DMSO Control ZM5 H 2 O 2 Figure S8 Levels of lipid peroxide in HCT116 cells incubate in culture medium only (negative control), DMSO (DMSO control), 0.05 μm ZM5 during 24 h and 0.05 % (v/v) H 2 O 2 for 30 min. The values are expressed as the mean ± SEM from three independent experiments.

THUNDERBIRD SYBR qpcr Mix

Instruction manual THUNDERBIRD SYBR qpcr Mix 1304 A4251K THUNDERBIRD SYBR qpcr Mix QPS-201T 1 ml x 1 QPS-201 1.67 ml x 3 Contents [1] Introduction [2] Components [3] Primer design [4] Template DNA [5]