Aromatase Activity and CYP19 Gene Expression in male adult Xenopus laevis Exposed to Atrazine

Size: px

Start display at page:

Download "Aromatase Activity and CYP19 Gene Expression in male adult Xenopus laevis Exposed to Atrazine"

Giles Miller
6 years ago
Views:

1 Aromatase Activity and CYP19 Gene Expression in male adult Xenopus laevis Exposed to Atrazine June-Woo Park*, Markus Hecker*, Margaret Murphy*, Paul Jones*, Glen van der Kraak**, Keith Solomon**, Ron Kendall***, and John Giesy*; *Michigan State University, East Lansing, Michigan, USA; **University of Guelph, Guelph, Ontario, Canada; *** Texas Tech University, Lubbock, Texas, USA

2 Objective Aromatase activity in testes of male X. laevis is low and often not detectable with the traditionally used enzymatic tritium release assay. => Therefore, the objective of this study was to develop and validate a more sensitive technique based on Q RT- PCR methodology to determine CYP19 gene expression

3 Aims 1. To develop Q-RT PCR method for quantifying this weakly expressed gene 2. To compare gene expression with enzyme activity 3. Apply Q-RT PCR method as a tool for studying enzymes with low activity

4 Hypotheses 1. ATZ has the potential to change aromatase gene expression. 2. Aromatase activity will be affected by ATZ in a dosedependent manner. 3. Effects of ATZ on CYP19 gene expression will be correlated to changes in aromatase activity.

5 Adult male Xenopus laboratory exposure Four treatment groups - Untreated control (20 tanks) (< MDL (0.025 µg ATZ/L) as measured by GC/MS) - Atrazine: 1 µg/l, 25 µg/l, and 250 µg/l (15 tanks) (0.8±0.2, 24.6±4.2 and 258.6± 58.2 µg/l by GC/MS) - Static renewal exposure system (50% renewal every 3 days) - Long term exposure: 38 days Endpoints: - CYP19 gene expression - Gonadal aromatase activity Zoology Dept., National Food Safety and Toxicology Center,

Quantitative RT PCR A strong technique to analyze mrna expression Highly sensitive, accurate, and rapid quantification Able to quantify rare transcripts and small

6 Quantitative RT PCR A strong technique to analyze mrna expression Highly sensitive, accurate, and rapid quantification Able to quantify rare transcripts and small changes in gene expression SYBR Green I fluorescence dye - detection of double stranded DNA generated during PCR and specifically binds to the minor groove of DS DNA

7 SYBR Green Acting as an interacting dye, SYBR Green binds double-stranded DNA Primers Taq l SG Taq l l SG SG l Taq l SG SG SG SG (Detection) Denaturation Extension Annealing Taq Primer Zoology Dept., National Food Safety and Toxicology Center,

8 Quantitative RT PCR (continued) - Terminology Base line: No changes in fluorescence intensity occur Threshold: Increments in fluorescence become detectable Overbergh et al, J. Biomol. Tech.,14:33-43 C T : Cycle number when a reaction reaches the threshold The larger the starting quantity of target molecule, the lower the C T value

9 Methods I. Gene expression Total RNA extraction from gonadal tissue RNAse free environment 260:280 nm ratio : RNA quantification 500 ng of total RNA DNAse I treatment 50 U of SuperScript II RT (Invitrogen) for 50 min at 42C cdna synthesis Dilution of cdna for aromatase (1/4) and GAPDH (1/20) Real time PCR amplification and quantification

10 Comparative Ct method Quantification Relative quantification based on the relative expression of target gene vs. a reference gene Differential expression of a specific gene of an exposed sample compared to the control counterpart is expressed as 2 ΔΔCT (n-fold change) X test X control = 2 ΔΔ CT = 2 (C T,X C T,R ) control (C T,X C T,R ) test C T,X : the threshold cycle of the gene of interest C T,R : the threshold cycle of the endogenous reference gene (GAPDH) Test : test cdna of exposed sample Control : the control cdna sample. Zoology Dept., National Food Safety and Toxicology Center,

11 Gene of interest and internal control gene CYP19 (Aromatase) Encodes for enzyme that converts androgen to estrogen Lower mrna expression/enzyme activity in male X. laevis (vs. female) Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) Housekeeping gene A constant basal level of expression Consistent, non-regulated and independent of the cell-cycle Selected as the internal control Similar expression level to aromatase Widely employed

12 Optimization I Primers - Xenopus laevis CYP19 (AB031278) Forward primer: 5 - CGGTTCCATATCGTTACTTCC -3 ( ) Reverse primer: 5 - GCATCTTCCTCTCAATGTCTG -3 ( ) - Xenopus laevis GAPDH (U41753) (Wiechmann & Smith, 2001) Forward primers: 5 GCT CCT CTC GCA AAG GTC AT 3 ( ) Reverse primers: 5 GGG CCA TCC ACT GTC TTC TG 3 ( )

Optimization II-melting curves N=16 Aromatase Denature: 94 4min (50 cycles) Denature : 94 20 sec Anneal : 59 50 sec

13 Optimization II-melting curves N=16 Aromatase Denature: 94 4min (50 cycles) Denature : sec Anneal : sec Elongate : sec N=16 GAPDH Denature: 94 4min (50 cycles) Denature : sec Anneal : sec Elongate : sec

14 Optimization III Confirmation of primer specificity 2% TBE agarose gel electrophoresis CYP19 (140 bp) 100 bp GAPDH (101 bp) Sequence comparison of PCR products Aromatase and GAPDH: over 93% identity

15 Optimization IV Real time PCR amplification efficiencies and linearity At 100% of efficiency, the template doubles after each cycle during exponential amplification. Exponential amplification = 10 (-1/slope) Efficiency (%) = [[10 (-1/slope) ] 1]* CYP19 40 GAPDH 35 R 2 = R 2 = C T C T Exponential amplification = 1.97 Efficiency = 97% log RNA concentration (ng) 20 Exponential amplification = Efficiency = 103% log RNA concentration (ng)

16 Optimization V Intra- and inter-assay variation - to evaluate the precision of the assay Conc. of total RNA (ng) Intra assay Ct mean value CV Inter assay Ct mean value CV CYP ND - ND - GAPDH Zoology Dept., National Food Safety and Toxicology Center,

17 Method II. Aromatase activity Aromatase Activity: Tritium release assay (Lephart & Simpson, 1991) Aromatase Androgen H 2 O Estrogen CV of Tritium Release Assay for adult male and female Xenopus laevis: Within Day = 3.8 % Between Day = 11.2 % Zoology Dept., National Food Safety and Toxicology Center,

18 Results Fold change Change in CYP19 expression relative to internal control (median +/- quartile) P=0.899 CTR 1ppb 25ppb 250ppb fmol/h/mg protein Aromatase activity (median +/- quartile) P=0.408 CTR 1ppb 25ppb 250ppb No significant difference among treatments in either CYP19 gene expression or aromatase activity (ANOVA)

19 Ct value ratio of CYP19/GAPDH 1.5 (mean +/- S.D) CYP19/GAPDH CTR 1ppb 25ppb 250ppb No significant difference in CYP19 gene expression relative to the internal control (GAPDH) Zoology Dept., National Food Safety and Toxicology Center,

20 Conclusions - ATZ had no effect on either CYP19 gene expression or aromatase activity. - Both CYP19 gene-expression and aromatase activity were very low in male X. Laevis. - Future studies will be conducted to improve sensitivity and precision at which CYP19 gene expression can be quantified (e.g. standard curve method). - Q RT-PCR was a highly sensitive method that can detect small amounts of CYP19 in male X. laevis. Zoology Dept., National Food Safety and Toxicology Center,

21 Thank you!! June-Woo Park National Food Safety & Toxicology Center Michigan State University East Lansing, Michigan 48824, USA Tel: (Ext. 171) Fax: Zoology Dept., National Food Safety and Toxicology Center,

22 Questions??????? Zoology Dept., National Food Safety and Toxicology Center,

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously