ViraPort XR Plasmid cdna Library Premade Libraries

Transcription

1 ViraPort XR Plasmid cdna Library Premade Libraries INSTRUCTION MANUAL Revision A.01 BN# For In Vitro Use Only

2 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this product. No other warranties of any kind, express or implied, including without limitation, implied warranties of merchantability or fitness for a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or incidental damages arising out of the use, the results of use, or the inability to use this product. ORDERING INFORMATION AND TECHNICAL SERVICES United States and Canada Agilent Technologies Stratagene Products Division North Torrey Pines Road La Jolla, CA Telephone (858) Order Toll Free (800) Technical Services (800) Internet techservices@agilent.com World Wide Web Europe Location Telephone Fax Technical Services Austria Belgium France Germany Netherlands Switzerland United Kingdom All Other Countries (0) Please contact your local distributor. A complete list of distributors is available at

3 ViraPort XR Plasmid cdna Library CONTENTS Materials Provided... 1 Storage Conditions... 1 Additional Materials Required... 1 Materials Required for Optional Protocols... 1 Notice to Purchaser... 2 Safety Considerations... 2 Undesired Production of Replication-Competent Retrovirus... 3 Introduction... 4 Overview of Replication-Defective Retroviral Gene Transfer Systems... 6 Construction of the ViraPort XR Plasmid cdna Library... 8 Description of the pfb Retroviral Vector Primers pfb-luc Control Vector Description of Host Strain and Genotype Rearrangement of the pfb Vector in XL10-Gold Cells Protocol for Titering the E. coli Glycerol Stock Verifying Insert Percentage Preparation of Plasmid DNA from Glycerol Stocks Protocol for Retrovirus Production Day 1: Preparing for Production of Virus by Transfection Day 2: Transfecting Cells Day 3: Maintenance of Transfected Target Cells Day 4: Harvesting Viral Supernatants Transduction of Target Cells with ViraPort cdna Library Supernatants Day 3: Preparing for Transduction of ViraPort retroviral cdna library Day 4: Transducing the Target Cells Determination of Target Cell Transduction Efficiency Using the pfb-hrgfp, pfb-neo-lacz or pfb-luc Control Vectors... 22

4 Protocol for Titer Determination by Quantitative or Endpoint RT-PCR Choice of Reference Virus RNA Isolation DNase I Treatment Selection of RT-PCR Primers Recovery of cdna Clones from Positive Transductants PCR Reaction PCR Program Troubleshooting Preparation of Media and Reagents References Endnotes MSDS Information... 30

5 ViraPort XR Plasmid cdna Library MATERIALS PROVIDED Material provided Amplified premade library constructed with the pfb retroviral vector and introduced into XL10-Gold ultracompetent cells a Quantity 5 Retro primer (lyophilized) b 2.5 μg 3 Retro primer (lyophilized) b 2.5 μg pfb-luc control vector 1 ml 10 μg a ViraPort XR plasmid cdna library has been amplified and frozen in LB glycerol [15% (v/v)]. Store at 80 C immediately upon arrival. Thaw the library on ice, gently vortex to evenly resuspend the cells, pipet into single-use aliquots, and store at 80 C. Do not pass the library through more than two freeze thaw cycles. b Spin the tube briefly in a microcentrifuge to pellet the lyophilized primer in case it has become dislodged during shipping. For use in PCR, resuspend each primer in 25 μl of TE buffer (see Preparation of Media and Reagents) to a final concentration of 100 ng/μl. For use in sequencing, dilute the 100 ng/μl stock 1:5 to a final concentration of 20 ng/μl. STORAGE CONDITIONS Premade Library: 80 C Store immediately upon arrival! Primers: 20 C pfb-luc Control Vector: 20 C ADDITIONAL MATERIALS REQUIRED 5-ml BD Falcon polystyrene round-bottom tubes (BD Biosciences, Catalog #352054) Growth medium for cell culture TE buffer DEAE-dextran solution TaqPlus Precision PCR System (Stratagene, Catalog #600210) 96-well tissue culture plates 60-mm, 100-mm, and 150-mm tissue culture plates pvpack vectors (Stratagene Catalog # ) Transfection MBS Mammalian Transfection Kit (Stratagene Catalog #200388) HEK293 cells (ATCC, Catalog #CRL-1573) or 293T cells (Stanford University 1 ) MATERIALS REQUIRED FOR OPTIONAL PROTOCOLS Viral RNA isolation kit RNase/DNase-free microcentrifuge tubes DNase I, RNase-free 10 DNaseI buffer Thermocycler See Preparation of Media and Reagents Revision A.01 Agilent Technologies, Inc ViraPort XR Plasmid cdna Library 1

6 NOTICE TO PURCHASER Luciferase Reporter Gene A license (from Promega for research reagent products and from The Regents of the University of California for all other fields) is needed for any commercial sale of nucleic acid contained within or derived from this product. SAFETY CONSIDERATIONS Note The safety guidelines presented in this section are not intended to replace the BSL 2+ safety procedures already in place at your facility. The information set forth below is intended as an additional resource and to supplement existing protocols in your laboratory. The pfb vector harboring the cdna expression library is a replicationdefective MMLV-based vector. Virus produced using the plasmid libraries using polytropic envelope proteins (e.g., VSV-G, amphotropic or 10A1) is capable of infecting human cells. Prior to production of retroviral supernatant, all users should become thoroughly familiar with the safety considerations concerning the production and handling of retrovirus. For a description of laboratory biosafety level criteria, consult the Centers for Disease Control Office of Health and Safety Web site Although for most applications production and use of retroviral vectors fall within NIH Biosafety Level 2 criteria, cdna expression libraries are expected to contain potently oncogenic inserts at some frequency regardless of the state of the tissue from which the cdna was derived, and should thus be handled with BSL 2+ precautions. The University of California, San Diego (UCSD) has an active retrovirus research group, the UCSD Vector Development Lab, with experience in safety practices for use with MMLV-derived vectors. The information they have can be found at For more information regarding BSL 2+ practices, it is strongly recommended that you also consult the UCSD Environmental Health and Safety Web site Most potential hazards can be avoided by applying good tissue culture technique. The use of gloves and disposable lab coats is strongly recommended when working with virus. When pipetting virus-containing supernatants and transferring plates or flasks to and from the laminar flow hood, the production of aerosols should be avoided. All pipets and plasticware should be disinfected for 15 minutes with 70% ethanol, 10% bleach, or other disinfectant recommended by the UCSD Vector Development Lab prior to removal from the laminar flow hood. It is recommended that prior to removal from the laminar flow hood, disposable plasticware should be UV irradiated for 20 minutes, enclosed and taped into a red biohazard bag inside the laminar flow hood, enclosed into a second bag outside the hood and autoclaved. 2 ViraPort XR Plasmid cdna Library

7 Undesired Production of Replication-Competent Retrovirus The virus production protocols in this manual involve transiently transfecting tissue culture cells with the pfb XR plasmid cdna library together with two additional vectors from which the Gag-Pol and Env proteins are expressed (pvpack-gp and one of a choice of four pvpack-env vectors, respectively). The latter two packaging vectors were designed for minimal sequence overlap with each other and with the pfb vector used to make the libraries, in order to greatly reduce the probability of production of replication-competent retrovirus (RCR) by homologous recombination between the three vectors. Despite these precautions, there is nevertheless a low risk of RCR production. The use of producer and target cell lines harboring endogenous retrovirus capable of encapsidating vector proviral RNA (encoding the cdna) can result in the undesirable spread of vectorderived virus. There are a number of published protocols describing assays for detection of RCR based on mobilization of a provirus containing a detectable marker ( marker rescue ) or by direct detection of reverse transcriptase activity in tissue culture supernatants. It is strongly recommended that prior to infection, all potential producer and target cell lines should be first tested for the presence of endogenous retrovirus using one of the assays described. 2 Furthermore, stable cell lines transduced with ViraPort cdnas that are to be extensively used beyond the short term expansion of clones for PCR-retrieval of the integrated cdna should also be tested for RCR. ViraPort XR Plasmid cdna Library 3

8 INTRODUCTION Expression cloning enables the identification and isolation of a gene based on its function or phenotype in the absence of any prior knowledge of the sequence of the nucleic acid or protein. The use of retroviral vectors for expression cloning has several advantages over traditional methods. Recent advances in viral packaging systems ensure that virtually any mitotic cell type can be transduced with efficiencies approaching 100%. The copy number of individual cdna expression cassettes can be easily controlled by varying the multiplicity of infection (MOI). Thus, populations of infected cells may be generated in which greater than 90% of the cells are transduced with 1 5 individual cdnas per cell, greatly reducing the time and labor of isolating the gene of interest. A wide range of gene types have been cloned from complex cdna libraries using functional assays that allow selection or screening for a specific trait (Table I). 3 TABLE I Examples of Genes Cloned by Expression Screening Gene class Selection/Screen Cell surface proteins FACS sorting Extracellular receptors FACS sorting Proliferation or survival Growth factors Factor-dependent growth Oncogenes Loss of contact-inhibition Cell cycle proteins Signaling proteins Transcription factors Apoptosis inhibitors Metastasis-inducing genes Differentiation-inducing genes Ion channels Loss of contact-inhibition Phenotypic complementation Loss of contact-inhibition Phenotypic complementation Reporter activation Survival: resistance to apoptosis inducers In vivo metastasis In vitro invasion Phenotype: differentiation Phenotype: ion-specific indicator or tracer 4 ViraPort XR Plasmid cdna Library

9 The ViraPort E. coli glycerol stock provided harbors a cdna plasmid library of high complexity inserted directionally into the replicationdefective retroviral vector pfb. Following plasmid DNA isolation from E. coli cultures amplified from the glycerol stock, retrovirus is produced by transiently transfecting tissue culture producer cells with the plasmid cdna library. There are some 293-based stable producer cell lines that allow production of viral stocks of sufficient titer to ensure near complete representation of the primary plasmid library. 4 6 Alternatively, virus may be produced by transfection of the plasmid library into 293 cells (or highly transfectable 293 derivatives) together with two additional packaging vectors from which the viral Gag-Pol and Env proteins are expressed, such as the pvpack-gp and pvpack-env vectors described in the protocols herein. Because all of the cis and trans elements required to produce infectious virus are separated onto three plasmids, with minimal or no sequence overlap between the plasmids, there is a relatively low probability of production of replication-competent retrovirus (RCR) due to homologous recombination between the vectors (however, see Safety Considerations). This viral production system is considerably safer than the majority of stable producer cell lines or vector-based systems for which there is a large degree of homology between the packaging vector(s) and the retroviral expression vector. Once the viral supernatants are produced, the target cell line of choice is transduced by addition of the virus directly to the cells. Two or more days following infection an appropriate selection or screen is applied to the cells, and positive transduced cells are clonally expanded. The cdna insert is then recovered from isolated genomic DNA by PCR using the vectorspecific primers provided, and subcloned for sequencing and further functional validation. If desired, the recovered cdna may be used as probe to re-isolate clones directly from the original plasmid library from which the viral stock was derived. ViraPort XR Plasmid cdna Library 5

10 OVERVIEW OF REPLICATION-DEFECTIVE RETROVIRAL GENE TRANSFER SYSTEMS Non-replicating retroviral vectors contain all of the cis elements required for transcription of mrna molecules encoding a gene of interest, and packaging of these transcripts into infectious virus particles (Figure 1). 7,8 The vectors are typically composed of an E. coli plasmid backbone containing a pair of 600 base pair viral long terminal repeats (LTRs) between which the gene of interest is inserted. The LTR is divided into 3 regions. The U3 region contains the retroviral promoter/enhancer. The U3 region is flanked in the 3 direction by the R region, which contains the viral poly-adenylation signal (pa), followed by the U5 region which, along with R, contains sequences that are critical for reverse transcription. Expression of the viral RNA is initiated within the U3 region of the 5 LTR and is terminated in the R region of the 3 LTR. Between the 5 LTR and the coding sequence for the gene of interest resides an extended version of the viral packaging signal (ψ+),which is required in cis for the viral RNA to be packaged into virion particles. In order to generate infectious virus particles that carry the gene of interest, the vector is transfected into tissue culture cells that harbor a source of the viral proteins that are required in trans for virus production. In the past specialized packaging cell lines have been generated. These cell lines contain chromosomally integrated expression cassettes for viral Gag, Pol, and Env proteins, all of which are required in trans to make virus. The gag gene encodes internal structural proteins, pol encodes reverse transcriptase (RT) and integrase, and the env gene encodes the viral envelope protein, which resides on the viral surface and facilitates infection of the target cell by direct interaction with cell type-specific receptors; thus the host range of the virus is dictated not by the vector DNA but by the choice of the env gene used to construct the packaging cell. Recent advances in transfection technology have allowed the production of high-titer viral supernatants following transient cotransfection of the viral vector together with expression vectors encoding the gag, pol, and env genes This obviates the need for the production and maintenance of stable packaging cell lines. Once the viral RNA is encapsidated, virus particles bud off and are released into the cell supernatant. The supernatant of these transiently transfected cells can be collected and used to infect target cells. Upon infection of the target cell, the viral RNA molecule is reverse transcribed and the cdna of interest, flanked by the LTRs, is integrated into the host DNA. Because the vector itself carries none of the viral proteins, once a target cell is infected the LTR expression cassette is incapable of proceeding through another round of virus production. 6 ViraPort XR Plasmid cdna Library

11 FIGURE 1 Production of replication-defective retrovirus and subsequent infection of a target cell. ViraPort XR Plasmid cdna Library 7

12 CONSTRUCTION OF THE VIRAPORT XR PLASMID CDNA LIBRARY cdna libraries represent the information encoded in the mrna of a particular tissue or organism. RNA molecules are exceptionally labile and difficult to amplify in their natural form. For this reason, the information encoded by the RNA is converted into a stable DNA duplex (cdna) and is then inserted into a vector. Once the information is available in the form of a cdna library, individual processed segments of the original genetic information can be isolated and examined. cdna for the ViraPort XR plasmid cdna library was synthesized using the Stratagene cdna Synthesis Kit (see Figure 2) and was then fractionated by a drip column method optimized to increase clonal yield and cdna insert length. The primer used during first-strand cdna synthesis was a 50-base hybrid oligonucleotide (dt) linker primer that contained an Xho I restriction site. The linker primer had the following sequence: 5 -GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3 "GAGA" Sequence Xho I Poly(dT) The linker primer was designed with a GAGA sequence to protect the Xho I restriction enzyme recognition site and an 18-base poly(dt) sequence. This restriction site allowed each finished cdna to be inserted into the pfb vector unidirectionally in the sense orientation (EcoR I Xho I) with respect to the MMLV promoter. The nucleotide mixture used during first-strand synthesis contained normal datp, dgtp, and dttp and the analog 5-methyl dctp. The presence of 5-methyl dctp resulted in hemimethylated cdna, which protected the cdna from digestion by the restriction endonuclease Xho I in a subsequent step. During Xho I digestion of the cdna, only the unmethylated site within the linker primer was cleaved. The adapters were composed of complementary 10- and 14-mer oligonucleotides and had an EcoR I cohesive end. The 5 ends were phosphorylated. The adapters had the following sequences: 5 -OH-AATTCGGCACGAGG-3 3 -GCCGTGCTCCp-5 Each cdna was inserted between the EcoR I and Xho I restriction sites in the pfb retroviral vector, and then the ligated plasmids were introduced into XL10-Gold ultracompetent cells. 8 ViraPort XR Plasmid cdna Library

13 FIGURE 2 cdna synthesis flow chart. ViraPort XR Plasmid cdna Library 9

14 DESCRIPTION OF THE PFB RETROVIRAL VECTOR Note The sequence for the pfb retroviral vector is available from the Stratagene web site at or can be accessed from the GenBank database (Accession #AF132210). The plasmid cdna libraries are inserted into the retroviral vector pfb. 12 The pfb vector contains an extended MMLV packaging signal (ψ+) that includes N-terminal sequences from the gag gene, and a multiple cloning site (MCS) that is located between the MMLV 5 and 3 long terminal repeat sequences (LTRs) (see Figure 3). The cdna libraries are inserted directionally between the EcoR I and Xho I sites of the MCS. Proviral cdna inserts are PCR-amplified from genomic DNA isolated from expanded positive transductants using the 5 Retro primer and 3 Retro primer provided with the kit. In order to ensure insertion of large cdnas, we chose the vector pfb as the backbone in the production of the cdna library. The insert capacity of this MMLV-based replication-defective vector is 8.0 kb, because it does not contain extraneous sequence, e.g., antibiotic-resistance marker, between the LTRs. As a result, there is no direct method for measuring the infectious titer of retroviral supernatants produced using pfb cdna libraries. The titer may be determined by QRT-PCR or RT-PCR of RNA isolated directly from retroviral supernatants, and comparison of the RT-PCR signal with that for the hrgfp- or β-galactosidase-containing reference viruses described below, whose titer may in turn be determined by FACS analysis (or in situ staining, in the case of the β-galactosidase virus) of infected target cells. Alternatively, library titers may be approximated by producing ViraPort supernatants and reporter virus supernatants at the same time, and assuming that the ViraPort titers are similar to those determined for the reporter virus (see Determination of Target Cell Transduction Efficiency Using the pfbhrgfp, pfb-neo-lacz or pfb-luc Control Vectors). 10 ViraPort XR Plasmid cdna Library

15 ampicillin pbr322 ori pfb 5.1 kb 3' LTR 5' LTR transcription initiation (clockwise) MCS splice donor psi+ gag gene (truncated) splice acceptor pfb Multiple Cloning Site Region (sequence shown ) Sal I EcoR I BamH I Xho I Not I GTCGACGAATTCGGATCCTCGAGCGGCCGC Feature 5 -long terminal repeat (LTR) transcription initiation (clockwise) 616 splice donor ψ+ extended viral packaging signal Nucleotide Position gag gene (truncated) splice acceptor Retro primer binding site multiple cloning site Retro primer binding site long terminal repeat (LTR) pbr322 origin of replication ampicillin resistance (bla) ORF FIGURE 3 Circular map, MCS, and features of the pfb retroviral vector. Primers Sequences for oligonucleotide primers that recognize regions flanking the multiple cloning site of the pfb vector are shown in the following table. These primers are suitable for both sequencing and PCR amplifying cdna inserts in the pfb vector. Sequencing primers are generally used at a concentration of 20 ng/μl. PCR primers are generally used at a concentration of 100 ng/μl. Primer Coordinates Sequence 5 Retro primer bp 5 -GGCTGCCGACCCCGGGGGTGG-3 3 Retro primer bp 5 -CGAACCCCAGAGTCCCGCTCA-3 ViraPort XR Plasmid cdna Library 11

16 PFB-LUC CONTROL VECTOR The pfb-luc control vector, which was made by inserting the luciferase gene into the pfb plasmid, is included as an expression control (see Figure 4). A retroviral vector expressing a reporter gene is useful for optimizing transfection efficiency, confirming virus production, as well as ascertaining whether or not a target cell line can be infected by a given viral stock. In addition, the reporter vectors pfb-hrgfp (Stratagene Catalog #240027) and pfb-neo-lacz (Stratagene Catalog #240029) can be used as reference viruses for titer determination of the cdna viral supernatants (see Determination of Target Cell Transduction Efficiency Using the pfb-hrgfp, pfb-neo-lacz or pfb-luc Control Vectors). ampicillin 5' LTR transcription initiation (clockwise) splice donor psi+ pbr322 ori pfb-luc 6.8 kb gag gene (truncated) splice acceptor 3' LTR LUC FIGURE 4 Circular map of the pfb-luc control vector. 12 ViraPort XR Plasmid cdna Library

17 DESCRIPTION OF HOST STRAIN AND GENOTYPE It has been observed that ligated DNA molecules transform cells at a significantly lower efficiency than supercoiled molecules, and large plasmids less efficiently than small plasmids. This size bias impacts the construction of plasmid libraries since the total number and size distribution of primary transformants is instrumental in finding a gene of interest and affects how easily full-length clones can be located and retrieved. In addition, many plasmid library vectors (such as two-hybrid vectors and eukaryotic expression vectors) are inherently large, making this size bias more acute. Plasmid libraries constructed in traditional E. coli hosts have limited numbers of primary isolates and do not accurately reflect the cdnas that are present. Stratagene XL10-Gold ultracompetent cells, a derivative of the Stratagene XL2-Blue MRF competent cell line, contain the Hte allele that increases transformation efficiency of ligated DNA. The greater ability of XL10-Gold cells to accept larger DNA molecules produces plasmid libraries that more faithfully represent a cdna population. The increased efficiency with which the XL10-Gold strain accepts ligated DNA and large plasmids is due to its engineered genotype. 13 XL10-Gold cells are both endonuclease deficient (enda1) and recombination deficient (reca). The mcra, mcrcb and mrr mutations prevent cleavage of cloned DNA that carries cytosine and/or adenine methylation, which is often present in eukaryotic DNA and cdna The McrA and McrCB systems recognize and restrict methylated cytosine DNA sequences. The Mrr system recognizes and restricts methylated adenine DNA sequences. The Mrr system also restricts methylated cytosine DNA sequences with a specificity differing from that of McrA and McrCB. This activity has been named McrF. This McrF activity against methylated cytosines has been shown to be equal to or greater than the restriction activity of the McrA and McrCB systems. 19 All of these systems (McrA, McrCB, McrF, Mrr and HsdR) have been removed from the XL10-Gold strain. The hsdr mutation prevents the cleavage of cloned DNA by the EcoK (hsdr) endonuclease system, and the reca mutation helps ensure insert stability. The enda1 mutation greatly improves the quality of plasmid miniprep DNA. XL10-Gold cells grow faster than XL1 or XL2-Blue cells, and as a result of their faster growth rate, XL10-Gold cells form larger colonies. Host strain XL10-Gold ultracompetent cells Genotype Tet R Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 enda1 supe44 thi-1 reca1 gyra96 rela1 lac Hte [F proab laci q ZΔM15 Tn10 (Tet R ) Amy Cam R ] ViraPort XR Plasmid cdna Library 13

18 Rearrangement of the pfb Vector in XL10-Gold Cells In E. coli host cells, retroviral plasmid vectors are prone to homologous recombination across the LTRs. The resulting rearranged plasmids contain a single LTR, and all intervening viral sequences and the cdna insert are deleted. LTR-rearranged plasmids occur with varying frequency in ViraPort cdna libraries. Although these rearranged plasmids contribute to ampicillin-resistant background colonies in E. coli, they do not contribute to background virus particles because the packaging signal is deleted. In contrast to nonrearranged pfb plasmids that lack cdna inserts, which can contribute to background infectious virus (a rarity in ViraPort plasmid libraries), LTR-rearranged plasmids are functionally inert during the virus production step and should not be of concern to the user. An LTR-rearranged plasmid can be detected as a form I supercoiled plasmid that is resistant to digestion with EcoR I and Xho I. When run adjacent to kb ladder DNA markers on an agarose gel, the rearranged supercoiled plasmid migrates between the 2-kb and 3-kb linear DNA markers. If further confirmation of the rearrangement is desired, digestion of LTR-rearranged plasmids with Xba I will result in a single band with a molecular weight of 3.1 kb, whereas nonrearranged plasmids will have a 3.1-kb band, a 0.4-kb band, and a third band that will vary with the size of the insert. PROTOCOL FOR TITERING THE E. COLI GLYCEROL STOCK 1. Prepare four 1-ml 10-fold serial dilutions ( ) of ViraPort XR plasmid cdna library glycerol stock with LB medium. 2. Plate 10 μl of each serial dilution onto separate LB ampicillin agar plates in duplicate. To facilitate plating, add the 10 μl to a 50-μl pool of LB medium and then spread the diluted glycerol stock across the plate. 3. Incubate the plates overnight at 30 C. 4. Choose the duplicate plates with the most reasonable number of ampicillin-resistant colonies and count the colonies. Divide the number of colonies by 0.01 and then multiply this result by the dilution factor. Example Suppose the plate for the dilution has 200 colonies: (200 colonies/0.01 ml) ( ) = total cfu/ml. VERIFYING INSERT PERCENTAGE Individual colonies can be examined to determine both the percentage of vectors that contain inserts and the average insert size either by PCR amplification of DNA directly from the colony using the 5 Retro primer and the 3 Retro primer or by restriction analysis of individually prepared plasmid DNA (see Rearrangement of the pfb Vector in XL10-Gold Cells under Description of Host Strain and Genotype). 14 ViraPort XR Plasmid cdna Library

19 PREPARATION OF PLASMID DNA FROM GLYCEROL STOCKS High-quality plasmid DNA must be prepared from the ViraPort XR plasmid cdna library prior to transfection into an MMLV-based packaging system. Many protocols specify 5 10 μg of plasmid DNA per transfection. To obtain a good yield of high-quality plasmid DNA from the ViraPort library, use the procedure described in Weis, J. H. (1996) Plating and Transferring Cosmid and Plasmid Libraries, in Current Protocols in Molecular Biology, (Unit 6.2). 20 The Stratagene procedure (a modification of Weis s procedure) entails plating the desired number of cfu (20,000 cfu per 150-mm plate is recommended) from diluted glycerol stock on LB ampicillin agar plates, incubating the plates for 24 hours at 30 C, and then harvesting the colonies by scraping them into a small pool of LB medium (5 ml for 150-mm plates). To use the Stratagene Big Blue assay trays (Catalog # and #400041), fill each tray with ml of LB ampicillin agar, plate cfu/tray, and harvest the colonies by scraping them into a 10-ml pool of LBmedium. A standard alkaline lysis CsCl gradient plasmid prep is then performed on the harvested cells. The pfb vector is a low-copy-number plasmid vector; therefore, to maximize plasmid yield, purification by CsCl gradient is strongly recommended. Many commercially available plasmid purification kits give extremely low yields of plasmid. Further amplification of the ViraPort library is discouraged to minimize rearrangements. When plating the desired number of cfu, the percentage of LTR-rearranged plasmids in the library must be corrected for. The percentage of LTRrearranged plasmids can be found on the Certificate of Analysis. For example, if the desired number of clones is and there are 10% LTRrearranged plasmids in the library, then an additional 10% ( clones) must be plated to insure that plasmids with cdna inserts are represented. ViraPort XR Plasmid cdna Library 15

20 PROTOCOL FOR RETROVIRUS PRODUCTION Note Prior to production of virus, users should be thoroughly familiar with the suggestions and Web sites described in the section Safety Considerations. All virus work should be performed in a designated virus work area. All cell lines to be used for production of or infection by retrovirus should first be tested for the presence of endogenous retrovirus. See Undesired Production of Replication-Competent Retrovirus. Although a variety of protocols and cell lines may be successfully used with these vectors, the following protocol for the production of viral supernatants is recommended. This protocol consistently results in the production of viral titers >10 7 colony forming units (cfu)/ml when transducing NIH3T3 cells with a pfb-derived vector. The protocol employs a calcium phosphate precipitation of the vector DNA and is based on the Transfection MBS Mammalian transfection kit, modified according to Pear and colleagues. 6 Although excellent results may be obtained using 293 cells, we recommend the use of the 293 cell derivative 293T, which has been shown to transfect with a significantly greater efficiency. 1,6 Prior to production of virus, it is prudent to carefully read the entire protocol, with particular attention to Transduction of Target Cells with ViraPort cdna Library Supernatants. Note The steps performed in this section, Protocol for Retrovirus Production, need to be carried out under sterile conditions in a laminar flow hood. Day 1: Preparing for Production of Virus by Transfection 293T Host Cell Preparation Split 293T cells at cells per 60-mm tissue culture plate in growth medium (See Preparation of Media and Reagents) 24 hours before the transfection and incubate at 37 C until needed. Note To achieve optimal titers, it is important that the 293T cells are healthy and growing exponentially. Cells should be passaged at high density, and ideally passaged no more than 20 times (no more than approximately 2 months); it is thus prudent to initially prepare a large number of frozen vials of the cells while they are at a low passage and healthy. Care should be taken to avoid clumping of the cells during passaging and plating for transfection. 16 ViraPort XR Plasmid cdna Library

21 Plasmid DNA Preparation DNA preparations of high purity should be used for the transfections. 1. Pipette the following into a clean 1.5-ml microcentrifuge tube; prepare one tube for each transfection to be carried out. 3 μg ViraPort XR Plasmid cdna library 3 μg pvpack-gp (gag-pol-expressing vector) 3 μg of one of the four env-expressing vectors (pvpack-eco, pvpack-ampho, pvpack-vsv-g, pvpack-10a1) 2. (Optional) Prepare the positive control vector sample by pipetting the following into a clean 1.5-ml microcentrifuge tube. (see Determination of Target Cell Transduction Efficiency Using the pfb-hrgfp, pfb-neo-lacz or pfb-luc Control Vectors). 3 μg pfb-hrgfp, pfb-neo-lacz or pfb-luc control vector 3 μg pvpack-gp (gag-pol-expressing vector) 3 μg of one of the four env-expressing vectors (pvpack-eco, pvpack-ampho, pvpack-vsv-g, pvpack-10a1) Day 2: Transfecting Cells 3. To each of the tubes containing the mixed vector DNA, add 1 ml 100% (v/v) ethanol and 0.1 volume 3 M sodium acetate to the DNA mixture; mix by inverting the tube, incubate at -80 C for 30 minutes. Collect the DNA pellet by centrifugation at 12,000 g for 10 minutes at 4 C. Aspirate and discard the supernatant. Add 1 ml 70% (v/v) ethanol to the tube, vortex briefly, and collect the DNA pellet by centrifugation at 12,000 g for 5 minutes at 4 C. Remove and discard the supernatant; close the cap of the tube. Store wet pellets at 4 C overnight. Note The procedure on Day 2 will take a minimum of 10 hours to complete. Adding the MBS-Containing Medium to the Cells 1. Inspect the host cells that were split the day before; they should be approximately 80% confluent. (If cells are significantly less than 80% confluent, viral supernatants may be harvested 72 hours posttransfection rather than 48 hours.) 2. Prepare the MBS-containing medium. This must be done immediately prior to the transfection. For each 60-mm tissue culture plate, 4 ml of MBS-containing medium must be prepared. See Preparation of Media and Reagents. ViraPort XR Plasmid cdna Library 17

22 3. Add 4 ml of MBS-containing medium to each 60-mm plate and return the plates to the 37 C incubator. This must be done minutes before the addition of the DNA suspension. Adding the DNA Suspension to the Cells 1. Remove the microcentrifuge tubes containing the wet DNA pellets (including the pfb-hrgfp, pfb-neo-lacz or pfb-luc containing pellet if the control transfection is to be carried out) from storage at 4 C and transfer them to the laminar flow hood. 2. Resuspend each DNA pellet in 450 μl sterile H 2 O and transfer the liquid to separate 5-ml BD Falcon polystyrene round-bottom tubes (BD Biosciences Catalog #352054). 3. To each resuspended DNA pellet add 50 μl of Solution I and 500 μl Solution II from the Transfection MBS Mammalian Transfection Kit. 4. Gently resuspend any precipitate in the DNA suspension by pipetting the suspension up and down with a pipettor set at 500 μl. The DNA suspension should appear clear to opaque. Allow the DNA suspension to sit at room temperature for 10 minutes. 5. Remove the 60-mm plates to be transfected from the incubator and add the DNA suspension onto the plates in a dropwise fashion, swirling gently to prevent the cells from being lifted from the plate and to distribute the DNA suspension evenly. Note From this point on, it should be assumed that infectious virus is present in the supernatant of the transfected cells. Gloves and disposable lab coats should be worn while working with the virus. We recommend that gloved hands be sprayed intermittently with ethanol. When pipetting medium supernatant and transferring plates to and from the laminar flow hood, aerosols should be avoided. In case of spills, follow the procedures recommended in the UCSD Vector Development Lab Web site All dirty pipets and plasticware should be disposed of as described in the section Safety Considerations. 6. Return the tissue culture plates to the 37 C incubator. 7. After incubating for 3 hours, remove the medium from the plates and replace it with 4 ml of growth medium supplemented with 25 μm chloroquine (see Preparation of Media and Reagents). Return the plates to the 37 C incubator. 8. After incubating for an additional 6 7 hours, remove the growth medium containing 25 μm chloroquine and replace with 4 ml growth medium no chloroquine. 18 ViraPort XR Plasmid cdna Library

23 Day 3: Maintenance of Transfected Target Cells 1. Remove growth medium from 293T plates and replace with 3.0 ml of fresh growth medium. Return the plates to the 37 C incubator. Note If virus is to be harvested 72 hours post-transfection rather than 48 hours, steps 2 and 3 should be carried out on Day If cells are to be transduced immediately upon harvest of the viral supernatant split the target cells (see Transduction of Target Cells with ViraPort cdna Library Supernatants below, Day 3, Step 1). 3. Return the plates to the 37 C incubator overnight. Day 4: Harvesting Viral Supernatants Note If virus is to be harvested 72 hours post-transfection rather than 48 hours, all steps from the Day 4 section should be performed on Day Remove the virus-producing 293T cells from the incubator. 2. Collect the virus-containing supernatant from the first plate and filter it through a 0.45 μm filter into a sterile 50-ml conical tube. Note If desired, the supernatant can be snap frozen on dry ice or liquid nitrogen and stored at 80 C at this stage. WARNING: Freeze-thawing virus one time typically results in a 2-fold loss in titer. Subsequent freeze-thaw cycles result in less than a 2-fold loss per cycle of the remaining infectious virus. ViraPort XR Plasmid cdna Library 19

24 TRANSDUCTION OF TARGET CELLS WITH VIRAPORT CDNA LIBRARY SUPERNATANTS Prior to transduction of the library, some consideration should be given to the multiplicity of infection (MOI). At high MOIs for which 100% of the cells are transduced, the majority of infected cells will carry multiple integrants, of which only one is likely to be responsible for the selected phenotype. In this case each individual proviral cdna will need to be PCR amplified, subcloned into a mammalian expression vector, and retested to determine which cdna provided the desired phenotype. If the MOI is adjusted so that approximately 20% of the target cells are transduced, > 90% of the transduced cells will harbor a single integrant, with < 10% containing two integrants. 21 While transduction at low MOI greatly simplifies the screening process, the number of target cells required for a single screen may be prohibitively high for very rare cdnas. The MOI consideration is further complicated by the fact that once the supernatant is frozen, thawing of the supernatant results in a 50% loss of titer, with further freeze-thawing of the supernatant resulting in a loss of significantly less than 50% of the remaining infectious virus per freeze-thaw cycle. It is recommended that any viral supernatant that is not used immediately upon harvesting the supernatant be aliquoted and frozen at 80 C.In light of the reduction of viral titer with subsequent freeze-thaw cycles, it is best to design the experimental strategy carefully for the initial screen. For genes for which there is little or no information regarding the abundance of the cdna of interest, we recommend employing both strategies in a single screen. Positive transductants that are obtained with low MOI screens have a high probability of containing a single cdna of interest after one round of screening. If no positive clones are obtained in a low MOI screen, positive transductants recovered from high MOI screens should harbor < 10 cdnas per cell, which can be subcloned and retested with relative ease. Because the relative transduction efficiency between cell types may vary widely, it is generally prudent to carry out screens using as wide a range of supernatant dilutions as is practical. Day 3: Preparing for Transduction of ViraPort retroviral cdna library 1. Based on the desired MOI for the screen, seed the appropriate number of 100-mm plates with approximately target cells per plate. This seeding density may vary with the target cell line; ~20% confluency at the time of infection is desirable. Note that for low MOI screens for which supernatants are diluted 1:100 or greater, only a fraction of the plated target cells will be transduced (e.g., if 10 6 cdnas are to be screened at an MOI for which 20% of the cells are transduced, 10 plates should be seeded; see also Description of the pfb Retroviral Vector for notes on the titer of the ViraPort supernatant). It is recommended that one or two extra plates be included for a negative control mock infection. 2. Return the plates to the 37 C incubator overnight. 20 ViraPort XR Plasmid cdna Library

25 Day 4: Transducing the Target Cells If frozen supernatants are to be used, quickly thaw the supernatant by rapid agitation in a 37 C H 2 O bath. Caps should be opened in the hood only, and any fluid around the outside lip of the tube or the inside surface of the cap should be carefully wiped with a tissue wetted with 70% ethanol, and the tissue should be disposed of in the hood. Thawed virus should be temporarily stored on ice if not used immediately. 1. Based on the titer of the supernatant and the desired MOI, dilute the virus in the appropriate growth medium supplemented with DEAEdextran at a final concentration of 10 µg/ml (1:1000 dilution of the 10 mg/ml DEAE-dextran stock. See Preparation of Media and Reagents). Prepare 3.0 ml diluted virus per 100-mm plate to be infected. A mock cocktail of growth medium plus DEAE-dextran may be prepared for a negative control. The remaining ViraPort supernatant may be refrozen at 80 C, however the titer is expected to drop considerably with subsequent freeze-thaw cycles. 2. Remove the plates containing the target cells from the incubator and discard the medium. For each plate, spread 3.0 ml diluted virus evenly over the cells. Return the plates to the 37 C incubator for 3 hours. 3. After the 3 hour incubation, add an additional 7.0 ml growth medium to each well, and return the plates to the 37 C incubator. For most screens and selections, 48 hours is a sufficient amount of time to allow expression of the desired phenotype, and it is at this time that the selection pressure or screen is applied to the transduced cell population. The expression time may vary depending on the efficiency of gene expression or the nature of the phenotype, however. For certain genes it may be appropriate to apply the selection or screen at various time points following transduction (alternatively an appropriate control gene with an expected similar phenotype may be inserted into the pfb vector and tested prior to screening the library). In certain instances, the inclusion of 5 mm sodium butyrate and 1 μm dexamethosone in the medium has been found to enhance expression from the MMLV promoter in transduced NIH3T3 cells. 22,23 ViraPort XR Plasmid cdna Library 21

26 DETERMINATION OF TARGET CELL TRANSDUCTION EFFICIENCY USING THE PFB-HRGFP, PFB-NEO-LACZ OR PFB-LUC CONTROL VECTORS The vector pfb-hrgfp (Stratagene Catalog #240027) can be used for titer determination by FACS, and can also be used for a consistent qualitative assessment of transfection efficiency of producer cells. The vector contains the coding sequence for the humanized recombinant green fluorescent protein. VSV-G pseudotyped pfb-hrgfp has been tested in NIH3T3, COS-7, CHO, 293, and HeLa cells, and consistently gives titers > 10 7 cfu/ml. As an alternative, the pfb-neo-lacz control vector (Stratagene Catalog #240029) can be used for determining the efficiency with which the chosen target cell is transduced; it also allows a quantitative assessment of viral promoter strength. Titer determination using the β-galactosidase gene may be carried out by fixing and staining cells with X-gal using the In Situ β- galactosidase Staining Kit (Stratagene Catalog #200384), and determining the number of blue cells as a percentage of the total number of visible cells in a field by light microscopy. Alternatively, β-galactosidase titers may be determined by Fluorescence Activated Cell Sorting (FACS) 24 using the fluorescent substrate CMFDG (Molecular Probes, Eugene, OR). Titers may also be determined with this vector by G418-resistant colony formation from populations of cells infected with various dilutions of viral supernatant. For a quantitative determination of promoter strength in the target cell of choice, lysates from transduced cells may be assayed for β-galactosidase enzyme activity using the β-galactosidase Assay Kit (Stratagene Catalog #200710). The pfb-neo-lacz gives titers on the order of 10 6 cfu/ml by visual inspection of in situ stained cells; this titer is generally fold below that for the ViraPort library supernatants. The pfb-luc control vector provided allows a qualitative assessment of the efficiency with which the target cell type is transduced by retrovirus. Direct comparisons between the cell lines based on luciferase activity should be made with caution however, as differences in luciferase activity may be due to cell type-dependent differences in luciferase expression rather than differences in transduction efficiencies. 22 ViraPort XR Plasmid cdna Library

27 PROTOCOL FOR TITER DETERMINATION BY QUANTITATIVE OR ENDPOINT RT-PCR For a more accurate titer determination for the ViraPort cdna library supernatant, RNA copy number may be measured directly in RNA isolated from viral supernatants using QRT-PCR. Follow the reagent manufacturer s guidelines for performing QRT-PCR reactions. Alternatively, if QRT-PCR techniques are not available, endpoint RT-PCR may be used. Using this approach, serially diluted test RNAs are compared with RNA isolated from a reference virus of known titer (e.g., from pfbhrgfp or pfb-neo-lacz supernatants that have been titered as described in Determination of Target Cell Transduction Efficiency Using the pfbhrgfp, pfb-neo-lacz or pfb-luc Control Vectors) and approximate titers are determined by visual comparison of the signal intensities of bands in ethidium bromide-containing agarose gels. Prior to titering the ViraPort viral supernatants using RT-PCR, prepare a dilution series of RNA isolated from the reference viral supernatant and verify that the assay produces a quantitative response in the required range of input amounts. A typical dilution series includes 5-fold or 10-fold dilutions, made over a range of at least 3 orders of magnitude. Depending on the reagent system used, PCR cycling conditions may need to be modified from the manufacturer s recommended conditions (e.g. reduced cycle number), to allow quantitative detection. Choice of Reference Virus Any MMLV-based viral vector with a detectable marker may be used. Viral supernatant from the reference should be produced in sufficient quantity to allow reasonably accurate titer determination by transduction (for example, by antibiotic-resistant colony formation or FACS) and at the same time leaving enough supernatant such that numerous aliquots may be frozen away for RNA isolation. The amount of viral supernatant and viral RNA required depends on how many times the titering experiment will be done. Read through the steps below to gauge the supernatant/rna requirements. Although freeze-thawing of the viral stocks will reduce the infectious titer of the virus, no loss of RT-PCR signal with a single freeze-thaw cycle of virus or up to three freeze-thaw cycles of purified RNA has been observed. Thus, when comparing titers between test and reference virus, the relative freezethaw cycles of the two stocks should be taken into account. ViraPort XR Plasmid cdna Library 23

28 RNA Isolation There are a number of commercially available kits for purification of viral RNA from cell culture supernatants, most of which should yield RNA of sufficient quality and quantity to perform consistently accurate titer determinations. Because the yields may vary from kit to kit, it is recommend that a set of pilot experiments be performed using reference virus RNA to determine the optimal amount of RNA to use in the RT-PCR reaction. Note RNA is very susceptible to degradation by RNases, present on any surface touched with bare hands. Use appropriate precautions to minimize RNA degradation. DNase I Treatment The purified viral RNA will contain a low level of contaminating retroviral plasmid carried over from the 293T cell transfection. 1. Treat the RNA sample (volume determined previously in pilot experiments) with DNase I by adding the appropriate volume of 10 DNase I buffer (see Preparation of Media and Reagents) and 2 U DNase I, RNase-free directly to the sample, and incubating at 37 C for 30 minutes. Note Due to the high sensitivity of the assay, it is prudent from this point on to use sterile, cotton-plugged pipette tips, and to use pipettors that have not been exposed to MMLV-derived plasmids. Wherever possible, carry out the rest of the procedure in a work area where MMLV-based vectors are not used. 2. Following the DNase I treatment, add sufficient EDTA to the reaction to chelate the MgCl 2. Inactivate the DNase I by incubating the tube at 75 C for 10 minutes. Selection of RT-PCR Primers Choose a PCR primer pair that will yield a relatively short amplicon. For the pfb-derived vectors, primers corresponding to positions (sense) and (antisense) on the pfb map are useful for this diagnostic PCR. (The full sequence of the pfb vector is available at This primer pair anneals immediately downstream of the splice donor in the ψ region and amplifies a 259-bp PCR product derived only from the unspliced viral RNA and is therefore suitable for diagnostic PCR for detection of most MMLV-based vectors. Sense Primer ( ) 5 GTCTGTCCGATTGTCTAGTGT 3 Antisense Primer ( ) 5 AGGTTCTCGTCTCCTACCAGA 3 24 ViraPort XR Plasmid cdna Library