Rust Resistance Gene Cloning
|
|
|
- Estella Deirdre Lynch
- 6 years ago
- Views:
Transcription
1 University of Minnesota Rust Resistance Gene Cloning perfect markers and cassette development Peter Dodds BGRI technical workshop March 2014
2 Outlook: R gene pyramids via GM gene cassettes Stacking of multiple R genes in a single location eg. Sr33 Sr35 Sr50 Segregates as one locus Need: Multiple cloned R genes (=> perfect markers) Ability to stack into a transgene cassette
3 Outlook: R gene pyramids via GM gene cassettes Available genes: APR Lr34/Yr18 Krattinger et al 2009 Science 323:1360 = ABC transporter Yr36 Fu et al 2009 Science 323:1357 = START Kinase R Sr33 Periyannan et al 2013 Science 341:786 Sr35 Saintenac et al 2103 Science 341:783 Lr1,Lr10,Lr21 = CC-NB-LRR immune receptors CC LRR NB-ARC
![APR Cloning Targets: Lr67 Lr67 [=Yr46=Sr55=Pm46=Ltn3] (leaf rust, stripe rust, stem rust, powdery mildew, leaf tip necrosis ) chromosome](/docs-images/75/71672629/images/4-2.jpg "4DL R S cosegregation of all five phenotypes at Lr67 locus mutation experiments indicates a single gene affects all five phenotypes")
4 APR Cloning Targets: Lr67 Lr67 [=Yr46=Sr55=Pm46=Ltn3] (leaf rust, stripe rust, stem rust, powdery mildew, leaf tip necrosis ) chromosome 4DL R S cosegregation of all five phenotypes at Lr67 locus mutation experiments indicates a single gene affects all five phenotypes Lagudah
5 APR Cloning Targets: Sr2 and Lr46 Sr2 physical contig across locus fully sequenced, 1.2Mbp 3 candidates testing in transgenic wheat new mutants and recombinants in locus Lr46/Yr29 multi-pathogen resistance with Ltn mapped on 1BL sequencing a physical contig across locus several mutants Mago, Lagudah Tabe, Spielmeyer
6 R Cloning Targets: SrR = Sr50 1DL.1RS (Imperial) Gli-1, Glu-3 SrR Sec-1 1BL.1RS (Petkus) Gli-1, Glu-3 Pm8 Lr26, Sr31, Yr9 Sec-1 NOR NOR 3+ 2= (Shepherd 1973) Rohit Mago
7 R Cloning Targets: SrR = Sr50 Physical contig at Sr50 locus : 1RS chromosome sorted library (Dolezel) F G D E ~100kb C B A Extent of smallest deletion Smallest deletion mutant includes 6 NB-LRR genes 2 EMS mutants carry small deletions in one NB-LRR gene A CC NB LRR Rohit Mago M7 M13
8 R Cloning Targets: SrR = Sr50 Sr50 transgenics express stem rust resistance Stem Rust Leaf Rust Fielder #19 #13 Rohit Mago
9 R Cloning Targets: Sr46 Derived from Aegilops tauschii AUS18913 Confers all stage partial resistance to stem rust (Australian, Ug99 race group, Ethiopian and Yemeni isolates) Located on chromosome 2DS Sr46 susc Lagudah & Bariana
10 R Cloning Targets: Sr46 2DS Sr46 2DL psr249 Genetic map, chr. 2DS Sr barc297 Ae. tauschii BAC contig Brachypodium 5g region Ae. tauschii sequence contigs Sr46 candidate gene altered in three mutants (CC-NB-LRR)
11 R Cloning Targets: Sr22 Effective against worldwide stem rust races (Australia, Canada, India, US and Ug99 etc.) Two sources: T. boeoticum T. monococcum Ø Middle East part of Israel Ø Canada Ø Gerechter- Amitai et al., 1971 Ø Kerber and Dyck, 1973 Schomburgk (Australian wheat cultivar) W3534 (Standard differential for Sr22 -Australia) 2+ 4 Sam Periyannan
12 R Cloning Targets: Sr22 Schomburgk x Westonia (1200 F2) cfa2123 T.monococcum 4044 (Sr22) x 4069 (1200 F2) BE EMS mutants Ø 1300 M2 heads screened at PBI, Cobbitty Ø 6 Mutants BG BE Sr22, cssu22 (IH81) BG262287, BF201318, BG604641, AT7D7092 AT7D7094 BE Sr AT7D7094 7AL cfa2019 With Matt Rouse U. Minnesota Sam Periyannan
13 R gene cis-stacks Resistance gene cis-stacks R1 R2 R3 R4 R5 Genes available Lr34/Yr18, Lr21, Lr67/Yr46 Sr22, Sr33, Sr35, Sr46, Sr50 Durability?? Yr36
14 R gene cis-stacks: wheat transformation Transformation efficiency Fielder = 41% Gladius = 32% Westonia = 45% Mace = 25% Mick Ayliffe
15 R gene cis-stacks: a 2-gene stack 17kb 10kb Yr36 Not in cultivated durum 7kb Lr21 RB (D genome) Transformed into durum wheat cultivar Stewart 2 confirmed transgenics with both genes - show leaf rust resistance Control T1 T2 - to test for stripe rust Mick Ayliffe
16 R gene cis-stacks: a 3-gene stack Co-transformation 16kb LB Lr34/Yr18 hyg RB 10.2 kb 7kb S 5 Yr36 S 3 N 3 Lr21 5 N RB 150 Fielder transgenics produced - screening now for co-transformation Mick Ayliffe
17 Current activities Complete cloning of Sr2, Lr46 Confirm Sr22 and Sr46 by transformation Develop gene stacking approaches insertion site targetting Understanding resistance gene function can we tweak them to improve function? R genes from wider sources: Barley, Brachypodium can t be deployed conventionally
18 CSIRO Plant Industry Mick Ayliffe Maud Bernoux Stella Cesari Sutha Chandramohan Jeff Ellis Evans Lagudah Greg Lawrence Rohit Mago John Moore Adnane Nemri Kim Newell Sam Periyannan Terese Richardson Joanna Risk* Wendelin Schnippenkoetter Wolfgang Spielmeyer Linda Tabe Narayana Upadhyaya Libby Viccars* Xioadi Xia Plant Breeding Institute University of Sydney Harbans Bariana Urmil Bansal Colin Wellings/William Cuddy Robert Park CIMMYT, Mexico Ravi Singh Sybil Herrera-Foessel Julio Huerta-Espino Caixia Lan PLANT PRODUCTION AND PROTECTION
Gene editing in cereals
University of Minnesota Gene editing in cereals Mick Ayliffe The importance of cereals in Australian agriculture VALUE OF AGRICULTURAL COMMODITIES PRODUCED IN Australia (year ended 30 June 2016) Gene editing
Strength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals
Strength in Numbers: Resistance Gene Cassettes for Durable Disease Control in Cereals Brian J. Steffenson Department of Plant Pathology University of Minnesota St. Paul 42 nd Barley Improvement Conference
Non-Host Resistance, Near-Host Resistance, or Just Resistance?
Non-Host Resistance, Near-Host Resistance, or Just Resistance? Australian Cereal Rust Control Program Dr Peter Dracatos Plant Breeding Institute Cobbitty Australia Concepts of Non-Host Resistance and Near
Characterization of pleiotropic adult plant resistance loci to wheat diseases
Characterization of pleiotropic adult plant resistance loci to wheat diseases Caixia Lan, Ravi P Singh, Sybil Herrera-Foessel, Julio Huerta-Espino, Bhoja R Basnet, Evans S Lagudah* * CSIRO Plant Industry,
Sridhar Bhavani. Decade of stem rust research on Ug99 Progress and Challenges. B. Girma Bekele Abeyo A. Badebo G. Woldeab. R.P. Singh J.
Decade of stem rust research on Ug99 Progress and Challenges P. Njau R. Wanyera B. Girma Bekele Abeyo A. Badebo G. Woldeab Sridhar Bhavani R.P. Singh J. Huerta-Espino Gordon Cesar EIAR Why Ug99 is a global
SUPPLEMENTARY INFORMATION
The wheat Sr50 gene reveals rich diversity at a cereal disease resistance locus Rohit Mago, Peng Zhang, Sonia Vautrin, Hana Šimková, Urmil Bansal, Ming-Cheng Luo, Matthew Rouse, Haydar Karaoglu, Sambasivam
Transgenic and genomics-assisted breeding approaches to improve durable fungal disease resistance in wheat
Transgenic and genomics-assisted breeding approaches to improve durable fungal disease resistance in wheat Beat Keller, bkeller@botinst.uzh.ch University of Zurich, Switzerland Conference «Novel approaches
Research Article Genetics of resistance to stem rust against Indian races in wheat varieties, Kundan and UP 2338
Research Article Genetics of resistance to stem rust against Indian races in wheat varieties, Kundan and UP 2338 Nagaraja, N. R. 1 *, Anupam Singh 2, J. K. Pallavi 2, J. B. Sharma, Karnam Venkatesh 3,
Phenotypic response conferred by the Lr22a leaf rust resistance gene against ten Swiss P. triticina isolates.
Supplementary Figure 1 Phenotypic response conferred by the leaf rust resistance gene against ten Swiss P. triticina isolates. The third leaf of Thatcher (left) and RL6044 (right) is shown ten days after
NBS-LRR sequence family is associated with leaf and stripe rust resistance on the end of homoeologous chromosome group 1S of wheat
Theor Appl Genet (2000) 101:1139 1144 Springer-Verlag 2000 ORIGINAL ARTICLE W. Spielmeyer L. Huang H. Bariana A. Laroche B.S. Gill E.S. Lagudah NBS-LRR sequence family is associated with leaf and stripe
Map-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
A. COVER PAGE. Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%), and Marcelo Soria (20%).
A. COVER PAGE PROJECT TITLE Development of wheat varieties for California 2017-2018 PRINCIPAL INVESTIGATOR Jorge Dubcovsky OTHER INVESTIGATORS Oswaldo Chicaiza, Alicia del Blanco (50%), Xiaoqin Zhang (70%),
Utilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
QTL Analysis and Nested Association Mapping for Adult Plant Resistance to Powdery Mildew in Two Bread Wheat Populations
ORIGINAL RESEARCH published: 27 July 2017 doi: 10.3389/fpls.2017.01212 QTL Analysis and Nested Association Mapping for Adult Plant Resistance to Powdery Mildew in Two Bread Wheat Populations YanRen 1,WeixiuHou
Gene duplication and allelic diversity for adaptation to high soil boron
Gene duplication and allelic diversity for adaptation to high soil boron 240 mm Boron Toxicity 67 mm 8 mm Adelaide Boron in South Australian soils SA soils are of marine origin and shallow B generally
Mapping of durable adult plant stem rust resistance in six CIMMYT wheats to Ug99 group of races*
Mapping of durable adult plant stem rust resistance in six CIMMYT wheats to Ug99 group of races* S. Bhavani 1, R. P. Singh 2, O. Argillier 3, J. Huerta-Espino 4, S. Singh 2 and P. Njau 5 and powdery mildew.
Synthetic wheat. an underutilized genetic resource in Nordic wheat breeding. Morten Lillemo, IPM, UMB
an underutilized genetic resource in Nordic wheat breeding Morten Lillemo, IPM, UMB 2111 2005 Wheat evolution There is a huge genetic diversity in Ae. tauschii Genetic diversity of bread wheat is low,
Evaluation of Stem Rust (Puccinia graminis f.sp tritici) Seedling Resistance in Kenyan Bread Wheat (Triticum aestivum L.
World Journal of Agricultural Research, 2017, Vol. 5, No. 5, 279-283 Available online at http://pubs.sciepub.com/wjar/5/5/5 Science and Education Publishing DOI:10.12691/wjar-5-5-5 Evaluation of Stem Rust
The international effort to sequence the 17Gb wheat genome: Yes, Wheat can!
ACTTGTGCATAGCATGCAATGCCAT ATATAGCAGTCTGCTAAGTCTATAG CAGACCCTCAACGTGGATCATCCGT AGCTAGCCATGACATTGATCCTGAT TTACACCATGTACTATCGAGAGCAG TACTACCATGTTACGATCAAAGCCG TTACGATAGCATGAACTTGTGCATA GCATGCAATGCCATATATAGCAGTC
Breeding Stem Rust Resistant Wheat to Combat the Threat from Ug99
Breeding Stem Rust Resistant Wheat to Combat the Threat from Ug99 Ravi P. Singh ICARDA Stem Rust: the Dreaded Disease Caused by Puccinia graminis tritici Linear relationship in grain yield losses and disease
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan
Progress on DNA Sequencing Project of the Wheat Chromosome 6B in Japan Yasunari Ogihara 1, Kanako Kawaura 1, Shuhei Nasuda 2, Takashi R. Endo 2, Katsuyuki Hayakawa 3, Jaroslav Dolezel 4,Hirokazu Handa
Association mapping of North American spring wheat breeding germplasm reveals loci conferring resistance to Ug99 and other African stem rust races
Bajgain et al. BMC Plant Biology (2015) 15:249 DOI 10.1186/s12870-015-0628-9 RESEARCH ARTICLE Association mapping of North American spring wheat breeding germplasm reveals loci conferring resistance to
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries.
A draft sequence of bread wheat chromosome 7B based on individual MTP BAC sequencing using pair end and mate pair libraries. O. A. Olsen, T. Belova, B. Zhan, S. R. Sandve, J. Hu, L. Li, J. Min, J. Chen,
Update on Ug99 (race TTKS) of Wheat Stem Rust. Marty Carson and Yue Jin USDA-ARS Cereal Disease Lab St. Paul, MN
Update on Ug99 (race TTKS) of Wheat Stem Rust Marty Carson and Yue Jin USDA-ARS Cereal Disease Lab St. Paul, MN Stem Rust in North America Stem Rust in North America Last major epidemic was in the 1950
CURRENT STATUS OF THE OCCURRENCE AND DISTRIBUTION OF (PUCCINIA TRITICINA) WHEAT LEAF RUST VIRULENCE IN PAKISTAN
Pak. J. Bot., 40(2): 887-895, 2008. CURRENT STATUS OF THE OCCURRENCE AND DISTRIBUTION OF (PUCCINIA TRITICINA) WHEAT LEAF RUST VIRULENCE IN PAKISTAN M. FAYYAZ 1, A. R. RATTU 1, I. AHMAD 1, M.A. AKHTAR 1,
Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian Pgt Races in Durum Wheat
Borlaug Global Rust Initiative Technical Workshop 2014 Session: Rust Resistance in Tetraploids Ciudad Obregon, March 23, 2014 Advances in Breeding for Resistance to Stem Rust Caused by Ug99 and Ethiopian
Antagonistic Interactions Among Stripe and Stem Rust Resistance QTLs in Wheat
Antagonistic Interactions Among Stripe and Stem Rust Resistance QTLs in Wheat Abdulqader Jighly The International Center for Agricultural Research in the Dry Areas (ICARDA) Borlaug Global Rust Initiative
18. Developing and optimizing markers for stem rust resistance in wheat
18. Developing and optimizing markers for stem rust resistance in wheat Long-Xi Yu 1, Zewdie Abate 2, James A. Anderson 3, U.K. Bansal 4, H.S. Bariana 4, Sridhar Bhavani 5, Jorge Dubcovsky 2, Evans S.
Molecular mechanism of powdery mildew resistance in tobacco
2015 CORESTA Agronomy / Phytopathology Joint Meeting Molecular mechanism of powdery mildew resistance in tobacco Masao ARAI Tomoyuki TAJIMA Seiki SATO Tomoyuki KOMATSU Tomoya FUJIMURA JAPAN TOBACCO INC.
Advanced Breeding Strategies to Mitigate the Threat of Black Stem Rust of Wheat
International Journal of Current Microbiology and Applied Sciences ISSN: 2319-7706 Volume 6 Number 6 (2017) pp. 1-20 Journal homepage: http://www.ijcmas.com Review Article https://doi.org/10.20546/ijcmas.2017.606.001
A rapid phenotyping method for adult plant resistance to leaf rust in wheat
DOI 10.1186/s13007-016-0117-7 Plant Methods METHODOLOGY Open Access A rapid phenotyping method for adult plant resistance to leaf rust in wheat Adnan Riaz 1*, Sambasivam Periyannan 2, Elizabeth Aitken
High yielding CIMMYT spring wheats with resistance to Ug99 and other rusts developed through targeted breeding*
High yielding CIMMYT spring wheats with resistance to Ug99 and other rusts developed through targeted breeding* R. P. Singh 1, J. Huerta-Espino 2, S. Bhavani 3, S. A. Herrera- Foessel 1, Y. Jin 4, P. Njau
Genetic Analysis of Leaf and Stripe Rust Resistance in the Spring Wheat (Triticum aestivum L.) Cross RL4452/AC Domain
Genetic Analysis of Leaf and Stripe Rust Resistance in the Spring Wheat (Triticum aestivum L.) Cross RL4452/AC Domain A Thesis Submitted to the College of Graduate Studies and Research In Partial Fulfillment
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae
High level of structural and sequence divergence between homologous regions of bread wheat and T. militinae within the powdery mildew resistance locus QPm.tut-4A Miroslav Valárik Institute of Experimental
Shazia Mukhtar 1, M A Khan 1 *, B A Paddar 2, Azra Anjum 1, Gul Zaffar 1, S A Mir 3, Sabina Naseer 1, M A Bhat 3 and Kamaluddin 1 *
Indian Journal of Biotechnology Vol 14, April 2015, pp 241-248 Molecular characterization of wheat germplasm for stripe rust resistance genes (Yr5, Yr10, Yr15 & Yr18) and identification of candidate lines
Molecular Detection of the Adult Plant Leaf Rust Resistance Gene Lr34 in Romanian Winter Wheat Germplasm
Cereal Research Communications 43(2), pp. 249 259 (2015) DOI: 10.1556/CRC.2014.0040 First published online 4 February, 2015 Molecular Detection of the Adult Plant Leaf Rust Resistance Gene Lr34 in Romanian
Genetic Study of Ascochyta Blight Resistance in Chickpea and Lentil
Genetic Study of Ascochyta Blight Resistance in Chickpea and Lentil B. Tar an 1, L. Buchwaldt 2, C. Breitkreutz 1, A. Tullu 1, T. Warkentin 1, S. Banniza 1 and A. Vandenberg 1 1 Crop Development Centre,
Relationship between the number of partial resistance genes and the response to leaf rust in wheat genotypes
RESEARCH Relationship between the number of partial resistance genes and the response to leaf rust in wheat genotypes Lourdes Ledesma-Ramírez 1, Ernesto Solis-Moya 1*, Juan G. Ramírez-Pimentel 2, Susanne
ARS Research In Support of the NPDRS
ARS Research In Support of the NPDRS FY06 FY07 FY08 Proposed Base Funding $1,402,040 $1,402,040 $1,402,040 + $4,336,000 increase FY06 Distribution of Funds (African Races) $345,191 Soybean Rust $972,679
Global Occurrence and Economic Consequences of Stripe Rust in Wheat
Global Occurrence and Economic Consequences of Stripe Rust in Wheat Yuan Chai Co-Authors: Philip Pardey, Jason Beddow, Terry Hurley, Darren Kriticos and Hans Joachim-Braun University of Minnesota, CSIRO,
Association analysis of historical bread wheat germplasm using additive genetic. covariance of relatives and population structure
Genetics: Published Articles Ahead of Print, published on October 18, 2007 as 10.1534/genetics.107.078659 1 Association analysis of historical bread wheat germplasm using additive genetic covariance of
Tansley review. Molecular genetics and evolution of disease resistance in cereals. Review. Simon G. Krattinger and Beat Keller. Contents.
Review Molecular genetics and evolution of disease resistance in cereals Author for correspondence: Beat Keller Tel: +41 44 634 82 30 Email: bkeller@botinst.uzh.ch Simon G. Krattinger and Beat Keller Department
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1166453/dc1 Supporting Online Material for A Putative ABC Transporter Confers Durable Resistance to Multiple Fungal Pathogens in Wheat Simon G. Krattinger, Evans S.
Insects and Diseases. Corresponding author
Rust diseases in Canada Tom Fetch 1, Brent McCallum 1, Jim Menzies 1, Khalid Rashid 2, and Albert Tenuta 3 1 Agriculture and Agri-Food Canada, Winnipeg 2 Agriculture and Agri-Food Canada, Morden 3 Ontario
Die Marktplatzpyramide in Karlsruhe. Pyramiding of target alleles PhD students Summer Seminar 2014 Wolfgang Link
Die Marktplatzpyramide in Karlsruhe Pyramiding of target alleles PhD students Summer Seminar 2014 Wolfgang Link 1 Genomic selection is revolutionizing both animal and plant breeding Genomic selection in
BGRI Newsletter / 2015 No
BGRI Newsletter 2015 No. 1 Contents Generations Meet at the World Food Prize Wheat Briefs Events and Opportunities Recent Publications People in the News Online Resources From the Field Generations meet
Characterization of stem rust resistance gene Sr2 in Indian wheat varieties using polymerase chain reaction (PCR) based molecular markers
Vol. 12(18), pp. 2353-2359, 1 May, 2013 DOI: 10.5897/AJB12.1521 ISSN 1684-5315 2013 Academic Journals http://www.academicjournals.org/ajb African Journal of Biotechnology Full Length Research Paper Characterization
Lecture 21: Association Studies and Signatures of Selection. November 6, 2006
Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection
MOLECULAR CHARACTERIZATION OF DURABLE YELLOW AND LEAF RUST RESISTANCE IN TWO WHEAT POPULATIONS. A Dissertation BHOJA R. BASNET
MOLECULAR CHARACTERIZATION OF DURABLE YELLOW AND LEAF RUST RESISTANCE IN TWO WHEAT POPULATIONS A Dissertation by BHOJA R. BASNET Submitted to the Office of Graduate Studies of Texas A&M University in partial
Association Analysis of Historical Bread Wheat Germplasm Using Additive Genetic Covariance of Relatives and Population Structure
Copyright Ó 2007 by the Genetics Society of America DOI: 10.1534/genetics.107.078659 Association Analysis of Historical Bread Wheat Germplasm Using Additive Genetic Covariance of Relatives and Population
Excerpts from a Seminar at Bayer CropScience February 2015
Excerpts from a Seminar at Bayer CropScience February 2015 Kellye Eversole IWGSC Executive Director Seminar Ghent, Belgium 12 February 2015 Update on the International Wheat Genome Sequencing Consortium
Marker-assisted pyramiding of Thinopyrum-derived leaf rust resistance genes Lr19 and Lr24 in bread wheat variety HD2733
Journal of Genetics, Vol. 96, No. 6, December 2017, pp. 951 957 https://doi.org/10.1007/s12041-017-0859-7 Indian Academy of Sciences RESEARCH ARTICLE Marker-assisted pyramiding of Thinopyrum-derived leaf
FHB Resistance in Durum -Progress and Challenge
FHB Resistance in Durum -Progress and Challenge Elias Elias, Shahryar Kianian, Shaobin Zhong, and Xiwen Cai North Dakota State University, Fargo, ND Steven Xu USDA-ARS, Fargo, ND Outline Sources of resistance
Pre-breeding for Diseases Resistance in Cereals. Ahmed Jahoor Breeding Manger
Pre-breeding for Diseases Resistance in Cereals Ahmed Jahoor Breeding Manger Breeding and Representation Breeding: Winter wheat Spring Barley Representation: Wheat Barely Rye Oat Rape seed Maize Triticale
Breeding for resistance to necrotrophic fungal diseases of wheat. Kar-Chun
Breeding for resistance to necrotrophic fungal diseases of wheat Kar-Chun Tan Kar-Chun.Tan@curtin.edu.au @karchuntan The Australian Grain Belt $$$ losses yield due to fungal disease in Australia Murray
Genomic selection for quantitative adult plant stem rust resistance in wheat
Page 1 of 44 Genomic selection for quantitative adult plant stem rust resistance in wheat Jessica E. Rutkoski, Jesse A. Poland, Ravi P. Singh, Julio Huerta-Espino, Sridhar Bhavani, Hugues Barbier, Matthew
RUST RESISTANCE EVALUATION OF ADVANCED WHEAT (TRITICUM AESTIVUM L.) GENOTYPES USING PCR-BASED DNA MARKERS
Pak. J. Bot., 46(1): 251-257, 2014. RUST RESISTANCE EVALUATION OF ADVANCED WHEAT (TRITICUM AESTIVUM L.) GENOTYPES USING PCR-BASED DNA MARKERS ZAHIDA PARVEEN, NAEEM IQBAL *, SAJID-UR-RAHMAN 1, MUHAMMAD
DETERMINATION OF RUST RESISTANCE GENES IN PAKISTANI BREAD WHEATS
Pak. J. Bot., 46(2): 613-617, 2014. DETERMINATION OF RUST RESISTANCE GENES IN PAKISTANI BREAD WHEATS MAQSOOD QAMAR 1,2, S. DILNAWAZ AHMAD 1, M. ASHIQ RABBANI 3, ZABTA KHAN SHINWARI 4 AND MUHAMMAD IQBAL
Stem Rust Resistance in 1BL.1RS and 2RL.2BS Double Wheat-Rye Translocation Lines
Stem Rust Resistance in 1BL.1RS and 2RL.2BS Double Wheat-Rye Translocation Lines Mahbubjon RAHMATOV 1, Larisa GARKAVA-GUSTAVSSON 1, Ruth WANYERA 2, Brian STEFFENSON 3, Matthew ROUSE 4 and Eva JOHANSSON
Backcross Breeding Usually associated with improving cultivar of self- pollinated species or an inbred
Backcross Breeding The hybrid and the progenies in the subsequent generations are repeatedly backcrossed to one of the original parents used in the cross The objective of backcrosses method is to improve
Wheat Rusts Project. Development and use of strategies for the. rusts as a factor for the sustainability of wheat. Márcia Soares Chaves
Wheat Rusts Project Development and use of strategies for the effective deployment of genetic resistance to rusts as a factor for the sustainability of wheat production o in Brazil Márcia Soares Chaves
Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL
Phytopathology 2018 108:246-253 https://doi.org/10.1094/phyto-07-17-0254-r Genetics and Resistance Adult Plant Leaf Rust Resistance Derived from Toropi Wheat is Conditioned by Lr78 and Three Minor QTL
CONFERENCE/WORKSHOP ORGANISER S REPORT
CONFERENCE/WORKSHOP ORGANISER S REPORT 12 th International Wheat Genetic Symposium; OECD-CRP Sponsored Sessions on Wheat Research for Sustainable Food Chain, adaptation and mitigation to the Climate change
Resistance to Rusts in Bangladeshi Wheat (Triticum aestivum L.)
Resistance to Rusts in Bangladeshi Wheat (Triticum aestivum L.) P. K. MALAKER and M.M.A. REZA Wheat Research Centre, Bangladesh Agricultural Research Institute (BARI), Nashipur, 5200 Dinajpur, Bangladesh;
Modeling and simulation of plant breeding with applications in wheat and maize
The China - EU Workshop on Phenotypic Profiling and Technology Transfer on Crop Breeding, Barcelona, Spain, 17-21 September 2012 Modeling and simulation of plant breeding with applications in wheat and
Genome editing as a new powerful tool for wheat breeding
Genome editing as a new powerful tool for wheat breeding Vladimir Nekrasov 15 th WGIN Stakeholders Meeting Applying CRISPR Cas9 technology in model and crop plants Model plant: Crop plants: Nicotiana
Gene Editing in Cereals. Emma Wallington
Gene Editing in Cereals Emma Wallington emma.wallington@niab.com NIAB Group NIAB established in 1919 by charitable donations for the improvement of crops.. with higher.. genetic quality A charitable company
Wheat Chromosome Engineering and Breeding Jianli Chen
Wheat Chromosome Engineering and Breeding Jianli Chen Chromosome Engineering A process to transfer favorable alleles through inter-specific hybridization and interchange of chromatin using aneupolids Aneuploids?
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR
High density genotyping and phenotyping data: challenges of leveraging novel technologies for the valorization of PGR Nils Stein, Joel Kuon, Uwe Scholz, Martin Mascher, Benjamin Kilian, Kerstin Neumann,
CRISPR-Cas9 Genome Editing. New Era of Agricultural Biotechnology
2017 Grains Research Update - CRISPR-Cas9 Genome Editing New Era of Agricultural Biotechnology Yong Han & Chengdao Li y.han@murdoch.edu.au Western Barley Genetics Alliance 28 Feb,2017 One of the ten breakthrough
Map-based cloning of the gene Pm21 that confers broad spectrum resistance to wheat powdery
Map-based cloning of the gene Pm21 that confers broad spectrum resistance to wheat powdery mildew Huagang He 1 *, Shanying Zhu 2, Yaoyong Ji 1, Zhengning Jiang 3, Renhui Zhao 3, Tongde Bie 3 * *Corresponding
Barley Vulnerability to Wheat Stem Rust: Enhancing our Limited Resistance Sources
Barley Vulnerability to Wheat Stem Rust: Enhancing our Limited Resistance Sources Maricelis Acevedo Plant Pathology Department North Dakota State University Dr. Robert Brueggeman, NDSU, Barley Pathologist
About this document: This review document was prepared by Paul Brennan, PB&B Consulting, PO Box 9055, Rock Valley via Lismore, NSW, 2480, Australia,
About this document: This review document was prepared by Paul Brennan, PB&B Consulting, PO Box 9055, Rock Valley via Lismore, NSW, 2480, Australia, for the Global Partnership Initiative for Plant Breeding
10:20-10:50 Gene Editing in Maize and Wheat at CIMMYT: Impact on Smallholder Farmers
Part I. Case examples showing contribution of genome editing 10:20-10:50 Gene Editing in Maize and Wheat at CIMMYT: Impact on Smallholder Farmers Dr. Kanwarpal Dhugga, Principal Scientist, Head, Biotechnology
Lecture 15: Functional Genomics II
Lecture 15: Functional Genomics II High-throughput RNAi screens High-throughput insertional/chemical screens Homologous recombination (yeast and mouse) - Other methods in discerning gene function Activation
Greg Rebetzke, CSIRO Agriculture and Food, Canberra ACT 2601
Greg Rebetzke, CSIRO Agriculture and Food, Canberra ACT 2601 Background - Crop type, weed seed management Lambda (ryegrass) Pasture Oaten Hay Chemical Fallow Legume Barley Canola Wheat 25 20 n=57 15 10
Using mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
Molecular Diagnostics of Rust Fungi: Lessons Learned From Ug99. Les J Szabo USDA ARS Cereal Disease Laboratory University of Minnesota St.
Molecular Diagnostics of Rust Fungi: Lessons Learned From Ug99 Les J Szabo USDA ARS Cereal Disease Laboratory University of Minnesota St. Paul, MN Development of qpcr assays for rust pathogens Crop/Pathogen
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1
Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang
Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome 6A
The Plant Journal (2014) 79, 334 347 doi: 10.1111/tpj.12550 TECHNICAL ADVANCE Whole-genome profiling and shotgun sequencing delivers an anchored, gene-decorated, physical map assembly of bread wheat chromosome
A single meiotic gene, ZIP4, is responsible for the Ph1 locus effect on recombination. Azahara C. Martín John Innes Centre, Norwich, UK
A single meiotic gene, ZIP4, is responsible for the Ph1 locus effect on recombination Azahara C. Martín John Innes Centre, Norwich, UK How to make a better use of the genetic variability within crop species
Identifying and exploiting natural variation
Identifying and exploiting natural variation New methods of fine mapping: association mapping MAGIC Methods for increasing diversity: synthetic wheat Advantages of new methods for fine mapping More efficient
Alterations in host transcriptional activity to rust pathogens
Alterations in host transcriptional activity to rust pathogens J. Briggs, J. Garbe, M. N. Rouse, J. Kurle University of Minnesota, USDA-ARS Cereal Disease Laboratory #bgri2014 Plant-Pathogen Interactions
Development of Genomic Tools for RKN Resistance Breeding in Cotton
Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,
Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.
Applying next-generation sequencing to enable marker-assisted breeding for adaptive traits in a homegrown haricot bean (Phaseolus vulgaris L.) Andrew Tock Prof Eric Holub & Dr Guy Barker University of
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
I.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
Plant Science into Practice: the Pre-Breeding Revolution
Plant Science into Practice: the Pre-Breeding Revolution Alison Bentley, Ian Mackay, Richard Horsnell, Phil Howell & Emma Wallington @AlisonRBentley NIAB is active at every point of the crop improvement
2.5 Preventative action
2.5 Preventative action Reports The Durable Rust Resistance in Wheat Project, a collaborative effort begun in April 2008, which now includes 22 research institutions around the world and led by Cornell
B) You can conclude that A 1 is identical by descent. Notice that A2 had to come from the father (and therefore, A1 is maternal in both cases).
Homework questions. Please provide your answers on a separate sheet. Examine the following pedigree. A 1,2 B 1,2 A 1,3 B 1,3 A 1,2 B 1,2 A 1,2 B 1,3 1. (1 point) The A 1 alleles in the two brothers are
INVESTIGATION OF Puccinia graminis RESISTANCE GENES IN BARLEY ROBERT SAXON BRUEGGEMAN
INVESTIGATION OF Puccinia graminis RESISTANCE GENES IN BARLEY By ROBERT SAXON BRUEGGEMAN A dissertation submitted in partial fulfillment of The requirements for the degree of DOCTOR OF PHILOSOPHY WASHINGTON
New sunflower rust projects in the USDA Sunflower Research Unit
New sunflower rust projects in the USDA Sunflower Research Unit Lili Qi, Tom Gulya, Brent Hulke, Brady Vick USDA-ARS Sunflower Unit Rust is becoming a serious threat to the sunflower industry in North
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group
Identification and characterization of Sr13, a tetraploid wheat gene that confers resistance to the Ug99 stem rust race group Wenjun Zhang a,1, Shisheng Chen a,1, Zewdie Abate a, Jayaveeramuthu Nirmala
Genetic Analysis and Molecular Mapping of a Leaf Rust Resistance Gene in the Wheat Line 19HRWSN-129
Genetic Analysis and Molecular Mapping of a Leaf Rust Resistance Gene in the Wheat Line 19HRWSN-129 Lingzhi SHI, Zaifeng LI, Xiaodong WANG, Zhanhai KANG, Lin ZHU, Zhikuan REN, Xing LI and Daqun LIU College
The Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
Molecular markers for leaf rust resistance genes in wheat
J. Appl. Genet. 42(2), 2001, pp. 117-126 Review article Molecular markers for leaf rust resistance genes in wheat Jerzy CHE KOWSKI, ukasz STÊPIEÑ Institute of Plant Genetics, Polish Academy of Sciences,
Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat
Mol Breeding (2013) 31:405 418 DOI 10.1007/s11032-012-9798-4 Identification and mapping of leaf, stem and stripe rust resistance quantitative trait loci and their interactions in durum wheat A. Singh M.
A high density GBS map of bread wheat and its application for genetic improvement of the crop
A high density GBS map of bread wheat and its application for genetic improvement of the crop Sukhwinder-Singh Wheat-Lead Seeds of Discovery (suk.singh@cgiar.org) International Maize and Wheat Improvement
Improving barley and wheat germplasm for changing environments
AWARD NUMBER: 2011-68002-30029 Improving barley and wheat germplasm for changing environments Triticeae CAP (T-CAP) 56 participants, 28 institutions, 21 states Integration of wheat and barley research