Lecture 21: Association Studies and Signatures of Selection. November 6, 2006

Size: px
Start display at page:

Download "Lecture 21: Association Studies and Signatures of Selection. November 6, 2006"

Transcription

1 Lecture 21: Association Studies and Signatures of Selection November 6, 2006

2 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection Term paper draft due November 17 (10 points)

3 Last Time QTL examples and limitations Linkage Disequilibrium and Association studies

4 Today Signatures of selection Reverse genetics

5 Modes of selection on single genes s AA < s Aa < s aa or s aa < s Aa < s AA Directional One extreme genotype has the highest fitness (purifying selection) w AA Aa aa Overdominance An intermediate genotype has the highest fitness (balancing selection) Underdominance The two extreme genotypes have the highest fitness (diversifying selection) w w w = fitness, s i =selection against genotype i s Aa < s aa & s AA AA Aa aa s Aa > s aa & s AA AA Aa aa

6 What are the Signatures of Selection? Compare patterns of phenotypic variation to patterns of neutral genetic variation among populations Neutral genetic variation: F ST and analogs σ = a 2 where σ a = variance in allele frequency among populations F ST = 2 2 σ Analog of F ST for adaptive traits: Q ST Howe and Aitken

7 Comparing Q ST to F ST Howe et al. Q ST generally > F ST (allozymes) for adaptive traits Relative importance of adaptive traits can be inferred from difference

8 Inferring Selection from Patterns of Diversity Purifying or directional selection should reduce diversity due to 'Selective Sweep' Reduces number of alleles present in population compared to expectations Generate expectations based on comparisons to closely related species or neutral theory Directional selection should also increase differentiation of populations: unusual pairwise F ST values

9 Detecting Selection in European beech Common beech (Fagus sylvatica) occurs throughout most of western Europe Sampled 210 trees along elevational gradient at 3 study sites Scanned genome with 254 AFLP loci

10 Selection in Fagus One AFLP locus had unusually high F st Frequency of allele decreased with temperature at time of establishment of individual trees Jump et al MOLECULAR ECOLOGY 15 (11):

11 Linking sequence to phenotypes QTL I Candidate Region Candidate Gene Identification Candidate Gene Assessment COARSE ROOT ABOVE:BELOW P_204_C S8_32 P_2385_C P_2385_A T4_10 S15_8S5_37 T4_7S6_12 S8_29 P_2786_A S12_18 T1_13 T7_4 T3_13 T3_36 S17_21 S15_16T12_15 T2_30 S13_20 S1_20 T9_1 S1_19 S3_13 S1_24 S2_7 P_575_A T12_22 S2_32 T7_9 S2_6 S13_16 T5_25 T5_12 T10_4 T1_26 T7_13 P_93_A S4_20 S7_13 S7_12 T12_4 S4_24T3_10 S6_4 P_2852_A S3_1 S6_20 S13_31 T7_15 T2_31 S8_4 S8_28 O_30_A T5_4 T3_17 T12_12 S5_29 P_2789_A P_634_A S17_43 S17_33 S17_12 S4_19 S17_26 Homology- Based Selection SNP Association Studies Metabolic QTL Expression QTL Mutants: Knockouts Overexpression Complementation

12 Case Study: Disease Resistance Melampsora spp. Is a leaf rust of great commercial importance in poplar culture MXC3 confers major gene resistance to Populus trichocarpa Positional cloning and chromosome walking failed: suppressed recombination Attempt to identify candidate genes by examining genomic scaffolds in this region Stirling et al TAG 103:1121

13 Candidate Gene Identification Examined 6.65 Mb of sequence linked to marker: 1530 genes No NBS-LRR genes, typical of gene-for-gene interactions. (NBS-LRR closely linked to another rust locus in poplar (Lescot et al. 2004)) Closest putative resistance genes were thaumatin-like pathogenesisrelated proteins: A new mechanism for plant disease resistance? I STK II C-C NBS LRR III IV TIR NBS LRR LRR TM Thau TM STK V LRR TM STK Yin et al., 2004 Sauter et al. Proteins 48: 146 (2002)

14 No Genome Sequence? Use Expressed Sequence Tags from enriched libraries and/or differential display to identify genes up-regulated in contrasting individuals Creation of large insert DNA libraries and screening for chromosomal regions containing markers Bacterial Artificial Chromosome contains kb fragments Redundant coverage of genome required (50,000 BACs required for Populus genome) Complex pooling and PCRscreening strategies can be efficient

15 Proving genes cause phenotypes Forward Genetics: Start with the phenotype and try to find the gene QTL mapping, association studies, random mutagenesis Usually correlative and therefore lacking experimental proof Reverse Genetics: Start with the gene and try to find the phenotype Association studies with candidate genes in populations with low LD Signatures of selection within candidate genes: SNPs

16 SNPs A Single Nucleotide Polymorphism (SNP) is a single base mutation in DNA. The most common source of genetic polymorphism (e.g., 90% of all human DNA polymorphisms). Two types of nucleotide base substitutions resulting in SNPs: transitions and transversions

17 First and second position SNP often changes amino acid Third position SNP often synonymous.

18 SNP Characteristics Two Major Classes in Coding Regions: Synonymous and Nonsynonymous Nonsynonymous substitution: Thr Tyr Leu Leu ACC TAT T T TTG CTG Synonymous substitution: Thr Tyr Leu Leu ACC TAT TTG CTG ACC TCT T T TTG CTG Thr Ser Leu Leu ACC TCC TTG CTG Thr Tyr Leu Leu The rates of nucleotide substitutions in the third position are much higher than in the first and second positions, due to redundancy in the third position:

19 Synonymous & Nonsynonymous Substitutions K S is the relative rate of synonymous mutations per synonymous site K A is the relative rate of nonsynonymous mutations per non-synonymous site ω = K A /K S If ω = 1, neutral selection If ω < 1, purifying selection If ω > 1, positive Darwinian selection For human genes, ω 0.1 Neutral selection: no selection for or against amino acid changes; generally, K A = K S = µ (genome-wide mutation rate, heavily influenced by non-coding regions) Purifying selection: amino acid changes are selected against; only synonymous substitutions persist Positive (Darwinian) selection: amino acid changes are advantageous; this is relatively rare Often, different sections of a gene will have different K A /K S McDonald-Kreitman test can be used to determine significance of K A /K S ratios: compares rates within and between species

20 Allele Frequency Spectra and Signatures of Selection Statistical tests for departure from neutrality: Tajima's D is essentially an estimate of whether there is an excess of low frequency alleles Nielsen 2005

21 Reverse Genetics and Standards of Proof for Gene Function The best way to prove a gene is associated with a phenotype is to mutate the gene and show that the phenotype is eliminated Simplest for Mendelian traits, but also applies to quantitative traits 'Gold Standard' is complementation of mutant with wild-type gene Mutagenesis and genetic engineering are the primary approaches

22 What is Genetic Engineering? Gene isolation, configuration, and asexual transfer Genes isolated from any organism, introduced into cell in tissue culture Whole plants or animals regenerated from single cell Transgenic organisms contain DNA introduced by genetic engineering Allows isolation of effect of single gene by turning up or turning down expression

23 Agrobacterium is a natural plant genetic engineer Courtesy of Steve Strauss, Oregon State University

24 The Ti-plasmid is required for crown gall disease T-DNA = Transferred DNA T-DNA Ti plasmid Ti = Tumor inducing Courtesy of Terri Lomax, Oregon State University

25 Disarming the T-DNA Border Hormones Food Border Auxin Synthesis Cytokinin Synthesis Opine Synthesis Cut and replace Antibiotic Resistance Gene of Interest Reporter Gene Courtesy of Steve Strauss, Oregon State University

26 Insertion of DNA into cells via biolistics ( gene gun ) Courtesy of Terri Lomax, Oregon State University

27 Plate of regenerating Golden Promise Process of Genetic Engineering of Plants Create rdna with gene from same or different organism Transfer DNA to plant cell; allow plant cells to divide under selection Cue cells to reform plant every cell will have new DNA Confirm introduced DNA and expression of foreign protein in plants Selection rdna Introduce DNA Cells dividing Source of gene Hormones Regenerating barley plants in Magenta box Check for introduced trait Put in soil Remove hormones Courtesy of Peggy Lemaux, University of California, Berkeley

28 Next Time Landscape genetics

Genome research in eukaryotes

Genome research in eukaryotes Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics

More information

Park /12. Yudin /19. Li /26. Song /9

Park /12. Yudin /19. Li /26. Song /9 Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.

More information

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016

CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene

More information

Genomic resources and gene/qtl discovery in cereals

Genomic resources and gene/qtl discovery in cereals Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline

More information

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )

Chapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: ) Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products

More information

Genetic Engineering Methods

Genetic Engineering Methods Genetic Engineering Methods Outline Why do it? Research examples: poplar trees Plant gene transfer concepts and methods Getting genes ready for transfer (recombinant DNA/plasmids) Analysis of transgenic

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Conifer Translational Genomics Network Coordinated Agricultural Project

Conifer Translational Genomics Network Coordinated Agricultural Project Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry

More information

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010

Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of

More information

Chapter 14: Genes in Action

Chapter 14: Genes in Action Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate

More information

SNPs - GWAS - eqtls. Sebastian Schmeier

SNPs - GWAS - eqtls. Sebastian Schmeier SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association

More information

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score

Midterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping

POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping - from Darwin's time onward, it has been widely recognized that natural populations harbor a considerably degree of genetic

More information

Gene mutation and DNA polymorphism

Gene mutation and DNA polymorphism Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes

More information

Genomics assisted Genetic enhancement Applications and potential in tree improvement

Genomics assisted Genetic enhancement Applications and potential in tree improvement Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore

More information

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms

Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination

More information

Identifying Genes Underlying QTLs

Identifying Genes Underlying QTLs Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative

More information

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1

R1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1 Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

Answers to additional linkage problems.

Answers to additional linkage problems. Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini

GENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping

More information

LS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class

LS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class LS4 final exam Problem based, similar in style and length to the midterm Articles: just the information covered in class Complementation and recombination rii and others Neurospora haploid spores, heterokaryon,

More information

MSc specialization Animal Breeding and Genetics at Wageningen University

MSc specialization Animal Breeding and Genetics at Wageningen University MSc specialization Animal Breeding and Genetics at Wageningen University The MSc specialization Animal Breeding and Genetics focuses on the development and transfer of knowledge in the area of selection

More information

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014

Single Nucleotide Variant Analysis. H3ABioNet May 14, 2014 Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide

More information

Lecture 10 Molecular evolution. Jim Watson, Francis Crick, and DNA

Lecture 10 Molecular evolution. Jim Watson, Francis Crick, and DNA Lecture 10 Molecular evolution Jim Watson, Francis Crick, and DNA Molecular Evolution 4 characteristics 1. c-value paradox 2. Molecular evolution is sometimes decoupled from morphological evolution 3.

More information

BTRY 7210: Topics in Quantitative Genomics and Genetics

BTRY 7210: Topics in Quantitative Genomics and Genetics BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here

More information

Genome-wide association studies (GWAS) Part 1

Genome-wide association studies (GWAS) Part 1 Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations

More information

Genome-Wide Association Studies (GWAS): Computational Them

Genome-Wide Association Studies (GWAS): Computational Them Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus

More information

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION

M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication

More information

Psych 3102 Introduction to Behavior genetics. Lecture 13 Identifying genes for behavioral traits

Psych 3102 Introduction to Behavior genetics. Lecture 13 Identifying genes for behavioral traits Psych 3102 Introduction to Behavior genetics Lecture 13 Identifying genes for behavioral traits - towards behavioral genomics QUANTITATIVE GENETICS biometrical methods natural genetic variation complex

More information

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.

Biology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write. Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After

More information

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome

3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,

Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial

More information

LS50B Problem Set #7

LS50B Problem Set #7 LS50B Problem Set #7 Due Friday, March 25, 2016 at 5 PM Problem 1: Genetics warm up Answer the following questions about core concepts that will appear in more detail on the rest of the Pset. 1. For a

More information

Disease and selection in the human genome 3

Disease and selection in the human genome 3 Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.

The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might

More information

Linking Genetic Variation to Important Phenotypes

Linking Genetic Variation to Important Phenotypes Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Regulation of enzyme synthesis

Regulation of enzyme synthesis Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example

More information

Lecture 2-3: Using Mutants to study Biological processes

Lecture 2-3: Using Mutants to study Biological processes Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen

More information

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA

Lecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:

More information

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest

Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in

More information

The neutral theory of molecular evolution

The neutral theory of molecular evolution The neutral theory of molecular evolution Objectives the neutral theory detecting natural selection exercises 1 - learn about the neutral theory 2 - be able to detect natural selection at the molecular

More information

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs

By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs (3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable

More information

Theory and Application of Multiple Sequence Alignments

Theory and Application of Multiple Sequence Alignments Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)

More information

Experimental Design and Sample Size Requirement for QTL Mapping

Experimental Design and Sample Size Requirement for QTL Mapping Experimental Design and Sample Size Requirement for QTL Mapping Zhao-Bang Zeng Bioinformatics Research Center Departments of Statistics and Genetics North Carolina State University zeng@stat.ncsu.edu 1

More information

3I03 - Eukaryotic Genetics Repetitive DNA

3I03 - Eukaryotic Genetics Repetitive DNA Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

Genomics and Biotechnology

Genomics and Biotechnology Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein

More information

Gene Flow and Paternity Analysis. Oct 6, 2006

Gene Flow and Paternity Analysis. Oct 6, 2006 Gene Flow and Paternity Analysis Oct 6, 2006 Last Time Variation among populations: F- statistics Indirect estimates of gene flow Today Lab recap More about indirect measures of gene flow Direct measures

More information

Review. Molecular Evolution and the Neutral Theory. Genetic drift. Evolutionary force that removes genetic variation

Review. Molecular Evolution and the Neutral Theory. Genetic drift. Evolutionary force that removes genetic variation Molecular Evolution and the Neutral Theory Carlo Lapid Sep., 202 Review Genetic drift Evolutionary force that removes genetic variation from a population Strength is inversely proportional to the effective

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations

5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

Chapter 9 Genetic Engineering

Chapter 9 Genetic Engineering Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation

More information

Chapter 13: Biotechnology

Chapter 13: Biotechnology Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,

More information

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.

Mutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity. Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA

More information

Mutation Rates and Sequence Changes

Mutation Rates and Sequence Changes s and Sequence Changes part of Fortgeschrittene Methoden in der Bioinformatik Computational EvoDevo University Leipzig Leipzig, WS 2011/12 From Molecular to Population Genetics molecular level substitution

More information

A little knowledge is a dangerous thing. So is a lot. Albert Einstein. Distribution of grades: Exam I. Genetics. Genetics. Genetics.

A little knowledge is a dangerous thing. So is a lot. Albert Einstein. Distribution of grades: Exam I. Genetics. Genetics. Genetics. A little knowledge is a dangerous thing. So is a lot. Albert Einstein Percentage Distribution of grades: Exam I.5.4.3.2. A B C D F Grade If Huntington s disease is a dominant trait, shouldn t most people

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Lecture 2: Biology Basics Continued

Lecture 2: Biology Basics Continued Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and

More information

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions

Measurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure

More information

Developing New GM Products and Detection Methods

Developing New GM Products and Detection Methods Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta

More information

7.014 Quiz II Handout

7.014 Quiz II Handout 7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,

More information

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping

Sept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,

More information

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.

MAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening. Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications

More information

Conifer Translational Genomics Network Coordinated Agricultural Project

Conifer Translational Genomics Network Coordinated Agricultural Project Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 4 Quantitative Genetics Nicholas Wheeler & David Harry Oregon

More information

Trasposable elements: Uses of P elements Problem set B at the end

Trasposable elements: Uses of P elements Problem set B at the end Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches

More information

Detecting selection on nucleotide polymorphisms

Detecting selection on nucleotide polymorphisms Detecting selection on nucleotide polymorphisms Introduction At this point, we ve refined the neutral theory quite a bit. Our understanding of how molecules evolve now recognizes that some substitutions

More information

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation

Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert

More information

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.

Introducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome. Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid

More information

It s not a fundamental force like mutation, selection, and drift.

It s not a fundamental force like mutation, selection, and drift. What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing

More information

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics

Genetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get

More information

TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?

TEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human? TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day

More information

What is genetic variation?

What is genetic variation? enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center

More information

The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana

The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana Brian Staskawicz Department of Plant and Microbial Biology University of California, Berkeley Rice Model Plant-Pathogen Systems

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?

FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Computational Workflows for Genome-Wide Association Study: I

Computational Workflows for Genome-Wide Association Study: I Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases

More information

Basic Concepts of Human Genetics

Basic Concepts of Human Genetics Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes

More information

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B

Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture DNA microarray hybridization

More information

Development of Genomic Tools for RKN Resistance Breeding in Cotton

Development of Genomic Tools for RKN Resistance Breeding in Cotton Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,

More information

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS

More information

This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.

This is a closed book, closed note exam. No calculators, phones or any electronic device are allowed. MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than

More information

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications

Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria

More information

An introduction to genetics and molecular biology

An introduction to genetics and molecular biology An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly

Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence

More information

Chapter 11: Applications of Biotechnology

Chapter 11: Applications of Biotechnology Chapter 11: Applications of Biotechnology Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 11-1 Why Biotechnology Works 11-2 Biotechnology

More information

Chapter 7 Agricultural Biotechnology

Chapter 7 Agricultural Biotechnology Chapter 7 Agricultural Biotechnology Outline: 7.1 Introduction 7.2 Plant tissue culture 7.3 Genetically Modified Plant 7.4 Animal cloning 7.5 Genetically modified animal 2 Learning outcomes: Describe the

More information

BIO303, Genetics Study Guide II for Spring 2007 Semester

BIO303, Genetics Study Guide II for Spring 2007 Semester BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that

More information

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5

Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table

More information