Lecture 21: Association Studies and Signatures of Selection. November 6, 2006
|
|
- Shanon McLaughlin
- 6 years ago
- Views:
Transcription
1 Lecture 21: Association Studies and Signatures of Selection November 6, 2006
2 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection Term paper draft due November 17 (10 points)
3 Last Time QTL examples and limitations Linkage Disequilibrium and Association studies
4 Today Signatures of selection Reverse genetics
5 Modes of selection on single genes s AA < s Aa < s aa or s aa < s Aa < s AA Directional One extreme genotype has the highest fitness (purifying selection) w AA Aa aa Overdominance An intermediate genotype has the highest fitness (balancing selection) Underdominance The two extreme genotypes have the highest fitness (diversifying selection) w w w = fitness, s i =selection against genotype i s Aa < s aa & s AA AA Aa aa s Aa > s aa & s AA AA Aa aa
6 What are the Signatures of Selection? Compare patterns of phenotypic variation to patterns of neutral genetic variation among populations Neutral genetic variation: F ST and analogs σ = a 2 where σ a = variance in allele frequency among populations F ST = 2 2 σ Analog of F ST for adaptive traits: Q ST Howe and Aitken
7 Comparing Q ST to F ST Howe et al. Q ST generally > F ST (allozymes) for adaptive traits Relative importance of adaptive traits can be inferred from difference
8 Inferring Selection from Patterns of Diversity Purifying or directional selection should reduce diversity due to 'Selective Sweep' Reduces number of alleles present in population compared to expectations Generate expectations based on comparisons to closely related species or neutral theory Directional selection should also increase differentiation of populations: unusual pairwise F ST values
9 Detecting Selection in European beech Common beech (Fagus sylvatica) occurs throughout most of western Europe Sampled 210 trees along elevational gradient at 3 study sites Scanned genome with 254 AFLP loci
10 Selection in Fagus One AFLP locus had unusually high F st Frequency of allele decreased with temperature at time of establishment of individual trees Jump et al MOLECULAR ECOLOGY 15 (11):
11 Linking sequence to phenotypes QTL I Candidate Region Candidate Gene Identification Candidate Gene Assessment COARSE ROOT ABOVE:BELOW P_204_C S8_32 P_2385_C P_2385_A T4_10 S15_8S5_37 T4_7S6_12 S8_29 P_2786_A S12_18 T1_13 T7_4 T3_13 T3_36 S17_21 S15_16T12_15 T2_30 S13_20 S1_20 T9_1 S1_19 S3_13 S1_24 S2_7 P_575_A T12_22 S2_32 T7_9 S2_6 S13_16 T5_25 T5_12 T10_4 T1_26 T7_13 P_93_A S4_20 S7_13 S7_12 T12_4 S4_24T3_10 S6_4 P_2852_A S3_1 S6_20 S13_31 T7_15 T2_31 S8_4 S8_28 O_30_A T5_4 T3_17 T12_12 S5_29 P_2789_A P_634_A S17_43 S17_33 S17_12 S4_19 S17_26 Homology- Based Selection SNP Association Studies Metabolic QTL Expression QTL Mutants: Knockouts Overexpression Complementation
12 Case Study: Disease Resistance Melampsora spp. Is a leaf rust of great commercial importance in poplar culture MXC3 confers major gene resistance to Populus trichocarpa Positional cloning and chromosome walking failed: suppressed recombination Attempt to identify candidate genes by examining genomic scaffolds in this region Stirling et al TAG 103:1121
13 Candidate Gene Identification Examined 6.65 Mb of sequence linked to marker: 1530 genes No NBS-LRR genes, typical of gene-for-gene interactions. (NBS-LRR closely linked to another rust locus in poplar (Lescot et al. 2004)) Closest putative resistance genes were thaumatin-like pathogenesisrelated proteins: A new mechanism for plant disease resistance? I STK II C-C NBS LRR III IV TIR NBS LRR LRR TM Thau TM STK V LRR TM STK Yin et al., 2004 Sauter et al. Proteins 48: 146 (2002)
14 No Genome Sequence? Use Expressed Sequence Tags from enriched libraries and/or differential display to identify genes up-regulated in contrasting individuals Creation of large insert DNA libraries and screening for chromosomal regions containing markers Bacterial Artificial Chromosome contains kb fragments Redundant coverage of genome required (50,000 BACs required for Populus genome) Complex pooling and PCRscreening strategies can be efficient
15 Proving genes cause phenotypes Forward Genetics: Start with the phenotype and try to find the gene QTL mapping, association studies, random mutagenesis Usually correlative and therefore lacking experimental proof Reverse Genetics: Start with the gene and try to find the phenotype Association studies with candidate genes in populations with low LD Signatures of selection within candidate genes: SNPs
16 SNPs A Single Nucleotide Polymorphism (SNP) is a single base mutation in DNA. The most common source of genetic polymorphism (e.g., 90% of all human DNA polymorphisms). Two types of nucleotide base substitutions resulting in SNPs: transitions and transversions
17 First and second position SNP often changes amino acid Third position SNP often synonymous.
18 SNP Characteristics Two Major Classes in Coding Regions: Synonymous and Nonsynonymous Nonsynonymous substitution: Thr Tyr Leu Leu ACC TAT T T TTG CTG Synonymous substitution: Thr Tyr Leu Leu ACC TAT TTG CTG ACC TCT T T TTG CTG Thr Ser Leu Leu ACC TCC TTG CTG Thr Tyr Leu Leu The rates of nucleotide substitutions in the third position are much higher than in the first and second positions, due to redundancy in the third position:
19 Synonymous & Nonsynonymous Substitutions K S is the relative rate of synonymous mutations per synonymous site K A is the relative rate of nonsynonymous mutations per non-synonymous site ω = K A /K S If ω = 1, neutral selection If ω < 1, purifying selection If ω > 1, positive Darwinian selection For human genes, ω 0.1 Neutral selection: no selection for or against amino acid changes; generally, K A = K S = µ (genome-wide mutation rate, heavily influenced by non-coding regions) Purifying selection: amino acid changes are selected against; only synonymous substitutions persist Positive (Darwinian) selection: amino acid changes are advantageous; this is relatively rare Often, different sections of a gene will have different K A /K S McDonald-Kreitman test can be used to determine significance of K A /K S ratios: compares rates within and between species
20 Allele Frequency Spectra and Signatures of Selection Statistical tests for departure from neutrality: Tajima's D is essentially an estimate of whether there is an excess of low frequency alleles Nielsen 2005
21 Reverse Genetics and Standards of Proof for Gene Function The best way to prove a gene is associated with a phenotype is to mutate the gene and show that the phenotype is eliminated Simplest for Mendelian traits, but also applies to quantitative traits 'Gold Standard' is complementation of mutant with wild-type gene Mutagenesis and genetic engineering are the primary approaches
22 What is Genetic Engineering? Gene isolation, configuration, and asexual transfer Genes isolated from any organism, introduced into cell in tissue culture Whole plants or animals regenerated from single cell Transgenic organisms contain DNA introduced by genetic engineering Allows isolation of effect of single gene by turning up or turning down expression
23 Agrobacterium is a natural plant genetic engineer Courtesy of Steve Strauss, Oregon State University
24 The Ti-plasmid is required for crown gall disease T-DNA = Transferred DNA T-DNA Ti plasmid Ti = Tumor inducing Courtesy of Terri Lomax, Oregon State University
25 Disarming the T-DNA Border Hormones Food Border Auxin Synthesis Cytokinin Synthesis Opine Synthesis Cut and replace Antibiotic Resistance Gene of Interest Reporter Gene Courtesy of Steve Strauss, Oregon State University
26 Insertion of DNA into cells via biolistics ( gene gun ) Courtesy of Terri Lomax, Oregon State University
27 Plate of regenerating Golden Promise Process of Genetic Engineering of Plants Create rdna with gene from same or different organism Transfer DNA to plant cell; allow plant cells to divide under selection Cue cells to reform plant every cell will have new DNA Confirm introduced DNA and expression of foreign protein in plants Selection rdna Introduce DNA Cells dividing Source of gene Hormones Regenerating barley plants in Magenta box Check for introduced trait Put in soil Remove hormones Courtesy of Peggy Lemaux, University of California, Berkeley
28 Next Time Landscape genetics
Genome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationPark /12. Yudin /19. Li /26. Song /9
Each student is responsible for (1) preparing the slides and (2) leading the discussion (from problems) related to his/her assigned sections. For uniformity, we will use a single Powerpoint template throughout.
More informationCS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016
CS273B: Deep Learning in Genomics and Biomedicine. Recitation 1 30/9/2016 Topics Genetic variation Population structure Linkage disequilibrium Natural disease variants Genome Wide Association Studies Gene
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationChapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )
Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products
More informationGenetic Engineering Methods
Genetic Engineering Methods Outline Why do it? Research examples: poplar trees Plant gene transfer concepts and methods Getting genes ready for transfer (recombinant DNA/plasmids) Analysis of transgenic
More information2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
More informationConifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 2 Genes, Genomes, and Mendel Nicholas Wheeler & David Harry
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More informationChapter 14: Genes in Action
Chapter 14: Genes in Action Section 1: Mutation and Genetic Change Mutation: Nondisjuction: a failure of homologous chromosomes to separate during meiosis I or the failure of sister chromatids to separate
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationMidterm 1 Results. Midterm 1 Akey/ Fields Median Number of Students. Exam Score
Midterm 1 Results 10 Midterm 1 Akey/ Fields Median - 69 8 Number of Students 6 4 2 0 21 26 31 36 41 46 51 56 61 66 71 76 81 86 91 96 101 Exam Score Quick review of where we left off Parental type: the
More information7 Gene Isolation and Analysis of Multiple
Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple
More informationPOPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping
POPULATION GENETICS Winter 2005 Lecture 18 Quantitative genetics and QTL mapping - from Darwin's time onward, it has been widely recognized that natural populations harbor a considerably degree of genetic
More informationGene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
More informationGenomics assisted Genetic enhancement Applications and potential in tree improvement
Genomics assisted Genetic enhancement Applications and potential in tree improvement Sheshshayee MS, Sumanthkumar K and Raju BR Dept. of Crop Physiology and Genetics and Plant breeding UAS, GKVK, Bangalore
More informationGenetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms
Genetics - Problem Drill 19: Dissection of Gene Function: Mutational Analysis of Model Organisms No. 1 of 10 1. The mouse gene knockout is based on. (A) Homologous recombination (B) Site-specific recombination
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationR1 12 kb R1 4 kb R1. R1 10 kb R1 2 kb R1 4 kb R1
Bcor101 Sample questions Midterm 3 1. The maps of the sites for restriction enzyme EcoR1 (R1) in the wild type and mutated cystic fibrosis genes are shown below: Wild Type R1 12 kb R1 4 kb R1 _ _ CF probe
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More information1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?
Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationGENE MAPPING. Genetica per Scienze Naturali a.a prof S. Presciuttini
GENE MAPPING Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo http://creativecommons.org/licenses/by-nc-sa/2.5/deed.it Genetic mapping
More informationLS4 final exam. Problem based, similar in style and length to the midterm. Articles: just the information covered in class
LS4 final exam Problem based, similar in style and length to the midterm Articles: just the information covered in class Complementation and recombination rii and others Neurospora haploid spores, heterokaryon,
More informationMSc specialization Animal Breeding and Genetics at Wageningen University
MSc specialization Animal Breeding and Genetics at Wageningen University The MSc specialization Animal Breeding and Genetics focuses on the development and transfer of knowledge in the area of selection
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationLecture 10 Molecular evolution. Jim Watson, Francis Crick, and DNA
Lecture 10 Molecular evolution Jim Watson, Francis Crick, and DNA Molecular Evolution 4 characteristics 1. c-value paradox 2. Molecular evolution is sometimes decoupled from morphological evolution 3.
More informationBTRY 7210: Topics in Quantitative Genomics and Genetics
BTRY 7210: Topics in Quantitative Genomics and Genetics Jason Mezey Biological Statistics and Computational Biology (BSCB) Department of Genetic Medicine jgm45@cornell.edu January 29, 2015 Why you re here
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationGenome-Wide Association Studies (GWAS): Computational Them
Genome-Wide Association Studies (GWAS): Computational Themes and Caveats October 14, 2014 Many issues in Genomewide Association Studies We show that even for the simplest analysis, there is little consensus
More informationM I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION
M I C R O B I O L O G Y WITH DISEASES BY TAXONOMY, THIRD EDITION Chapter 7 Microbial Genetics Lecture prepared by Mindy Miller-Kittrell, University of Tennessee, Knoxville The Structure and Replication
More informationPsych 3102 Introduction to Behavior genetics. Lecture 13 Identifying genes for behavioral traits
Psych 3102 Introduction to Behavior genetics Lecture 13 Identifying genes for behavioral traits - towards behavioral genomics QUANTITATIVE GENETICS biometrical methods natural genetic variation complex
More informationBiology 201 (Genetics) Exam #3 120 points 20 November Read the question carefully before answering. Think before you write.
Name KEY Section Biology 201 (Genetics) Exam #3 120 points 20 November 2006 Read the question carefully before answering. Think before you write. You will have up to 50 minutes to take this exam. After
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationName Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,
AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial
More informationLS50B Problem Set #7
LS50B Problem Set #7 Due Friday, March 25, 2016 at 5 PM Problem 1: Genetics warm up Answer the following questions about core concepts that will appear in more detail on the rest of the Pset. 1. For a
More informationDisease and selection in the human genome 3
Disease and selection in the human genome 3 Ka/Ks revisited Please sit in row K or forward RBFD: human populations, adaptation and immunity Neandertal Museum, Mettman Germany Sequence genome Measure expression
More informationChapter 20: Biotechnology
Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter
More informationThe demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A.
The demonstration that wild-type T-DNA coding region can be replaced by any DNA sequence without any effect on its transfer from A. tumefaciens to the plant inspired the promise that A. tumefaciens might
More informationLinking Genetic Variation to Important Phenotypes
Linking Genetic Variation to Important Phenotypes BMI/CS 776 www.biostat.wisc.edu/bmi776/ Spring 2018 Anthony Gitter gitter@biostat.wisc.edu These slides, excluding third-party material, are licensed under
More informationMolecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
More informationRegulation of enzyme synthesis
Regulation of enzyme synthesis The lac operon is an example of an inducible operon - it is normally off, but when a molecule called an inducer is present, the operon turns on. The trp operon is an example
More informationLecture 2-3: Using Mutants to study Biological processes
Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen
More informationLecture 3 Mutagens and Mutagenesis. 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA
Lecture 3 Mutagens and Mutagenesis 1. Mutagens A. Physical and Chemical mutagens B. Transposons and retrotransposons C. T-DNA 2. Mutagenesis A. Screen B. Selection C. Lethal mutations Read: 508-514 Figs:
More informationLectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest
Lectures 28 and 29 applications of recombinant technology I. Manipulate gene of interest C A. site-directed mutagenesis A C A T A DNA B. in vitro mutagenesis by PCR T A 1. anneal primer 1 C A 1. fill in
More informationThe neutral theory of molecular evolution
The neutral theory of molecular evolution Objectives the neutral theory detecting natural selection exercises 1 - learn about the neutral theory 2 - be able to detect natural selection at the molecular
More informationBy the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs
(3) QTL and GWAS methods By the end of this lecture you should be able to explain: Some of the principles underlying the statistical analysis of QTLs Under what conditions particular methods are suitable
More informationTheory and Application of Multiple Sequence Alignments
Theory and Application of Multiple Sequence Alignments a.k.a What is a Multiple Sequence Alignment, How to Make One, and What to Do With It Brett Pickett, PhD History Structure of DNA discovered (1953)
More informationExperimental Design and Sample Size Requirement for QTL Mapping
Experimental Design and Sample Size Requirement for QTL Mapping Zhao-Bang Zeng Bioinformatics Research Center Departments of Statistics and Genetics North Carolina State University zeng@stat.ncsu.edu 1
More information3I03 - Eukaryotic Genetics Repetitive DNA
Repetitive DNA Satellite DNA Minisatellite DNA Microsatellite DNA Transposable elements LINES, SINES and other retrosequences High copy number genes (e.g. ribosomal genes, histone genes) Multifamily member
More informationBio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
More informationGenomics and Biotechnology
Genomics and Biotechnology Expansion of the Central Dogma DNA-Directed-DNA-Polymerase RNA-Directed- DNA-Polymerase DNA-Directed-RNA-Polymerase RNA-Directed-RNA-Polymerase RETROVIRUSES Cell Free Protein
More informationGene Flow and Paternity Analysis. Oct 6, 2006
Gene Flow and Paternity Analysis Oct 6, 2006 Last Time Variation among populations: F- statistics Indirect estimates of gene flow Today Lab recap More about indirect measures of gene flow Direct measures
More informationReview. Molecular Evolution and the Neutral Theory. Genetic drift. Evolutionary force that removes genetic variation
Molecular Evolution and the Neutral Theory Carlo Lapid Sep., 202 Review Genetic drift Evolutionary force that removes genetic variation from a population Strength is inversely proportional to the effective
More informationRecombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.
PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?
More information5/18/2017. Genotypic, phenotypic or allelic frequencies each sum to 1. Changes in allele frequencies determine gene pool composition over generations
Topics How to track evolution allele frequencies Hardy Weinberg principle applications Requirements for genetic equilibrium Types of natural selection Population genetic polymorphism in populations, pp.
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More informationLearning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
More informationChapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
More informationChapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
More informationMutagenesis. Classification of mutation. Spontaneous Base Substitution. Molecular Mutagenesis. Limits to DNA Pol Fidelity.
Mutagenesis 1. Classification of mutation 2. Base Substitution 3. Insertion Deletion 4. s 5. Chromosomal Aberration 6. Repair Mechanisms Classification of mutation 1. Definition heritable change in DNA
More informationMutation Rates and Sequence Changes
s and Sequence Changes part of Fortgeschrittene Methoden in der Bioinformatik Computational EvoDevo University Leipzig Leipzig, WS 2011/12 From Molecular to Population Genetics molecular level substitution
More informationA little knowledge is a dangerous thing. So is a lot. Albert Einstein. Distribution of grades: Exam I. Genetics. Genetics. Genetics.
A little knowledge is a dangerous thing. So is a lot. Albert Einstein Percentage Distribution of grades: Exam I.5.4.3.2. A B C D F Grade If Huntington s disease is a dominant trait, shouldn t most people
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationLecture 2: Biology Basics Continued
Lecture 2: Biology Basics Continued Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine, Guanine, Thymine, and Cytosine which pair A-T and
More informationMeasurement of Molecular Genetic Variation. Forces Creating Genetic Variation. Mutation: Nucleotide Substitutions
Measurement of Molecular Genetic Variation Genetic Variation Is The Necessary Prerequisite For All Evolution And For Studying All The Major Problem Areas In Molecular Evolution. How We Score And Measure
More informationDeveloping New GM Products and Detection Methods
Developing New GM Products and Detection Methods Dave Grothaus Monsanto Company Slides Thanks to: International Life Sciences Institute Crop Life International Indus try Colleagues Hope Hart - Syngenta
More information7.014 Quiz II Handout
7.014 Quiz II Handout Quiz II: Wednesday, March 17 12:05-12:55 54-100 **This will be a closed book exam** Quiz Review Session: Friday, March 12 7:00-9:00 pm room 54-100 Open Tutoring Session: Tuesday,
More informationSept 2. Structure and Organization of Genomes. Today: Genetic and Physical Mapping. Sept 9. Forward and Reverse Genetics. Genetic and Physical Mapping
Sept 2. Structure and Organization of Genomes Today: Genetic and Physical Mapping Assignments: Gibson & Muse, pp.4-10 Brown, pp. 126-160 Olson et al., Science 245: 1434 New homework:due, before class,
More informationMAS refers to the use of DNA markers that are tightly-linked to target loci as a substitute for or to assist phenotypic screening.
Marker assisted selection in rice Introduction The development of DNA (or molecular) markers has irreversibly changed the disciplines of plant genetics and plant breeding. While there are several applications
More informationConifer Translational Genomics Network Coordinated Agricultural Project
Conifer Translational Genomics Network Coordinated Agricultural Project Genomics in Tree Breeding and Forest Ecosystem Management ----- Module 4 Quantitative Genetics Nicholas Wheeler & David Harry Oregon
More informationTrasposable elements: Uses of P elements Problem set B at the end
Trasposable elements: Uses of P elements Problem set B at the end P-elements have revolutionized the way Drosophila geneticists conduct their research. Here, we will discuss just a few of the approaches
More informationDetecting selection on nucleotide polymorphisms
Detecting selection on nucleotide polymorphisms Introduction At this point, we ve refined the neutral theory quite a bit. Our understanding of how molecules evolve now recognizes that some substitutions
More informationReading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
More informationIntroducing new DNA into the genome requires cloning the donor sequence, delivery of the cloned DNA into the cell, and integration into the genome.
Key Terms Chapter 32: Genetic Engineering Cloning describes propagation of a DNA sequence by incorporating it into a hybrid construct that can be replicated in a host cell. A cloning vector is a plasmid
More informationIt s not a fundamental force like mutation, selection, and drift.
What is Genetic Draft? It s not a fundamental force like mutation, selection, and drift. It s an effect of mutation at a selected locus, that reduces variation at nearby (linked) loci, thereby reducing
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationTEST FORM A. 2. Based on current estimates of mutation rate, how many mutations in protein encoding genes are typical for each human?
TEST FORM A Evolution PCB 4673 Exam # 2 Name SSN Multiple Choice: 3 points each 1. The horseshoe crab is a so-called living fossil because there are ancient species that looked very similar to the present-day
More informationWhat is genetic variation?
enetic Variation Applied Computational enomics, Lecture 05 https://github.com/quinlan-lab/applied-computational-genomics Aaron Quinlan Departments of Human enetics and Biomedical Informatics USTAR Center
More informationThe Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana
The Molecular Basis of Bacterial Innate Immunity in Arabidopsis thaliana Brian Staskawicz Department of Plant and Microbial Biology University of California, Berkeley Rice Model Plant-Pathogen Systems
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationFINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype?
FINDING THE PAIN GENE How do geneticists connect a specific gene with a specific phenotype? 1 Linkage & Recombination HUH? What? Why? Who cares? How? Multiple choice question. Each colored line represents
More informationBiotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for
Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright
More informationComputational Workflows for Genome-Wide Association Study: I
Computational Workflows for Genome-Wide Association Study: I Department of Computer Science Brown University, Providence sorin@cs.brown.edu October 16, 2014 Outline 1 Outline 2 3 Monogenic Mendelian Diseases
More informationBasic Concepts of Human Genetics
Basic Concepts of Human Genetics The genetic information of an individual is contained in 23 pairs of chromosomes. Every human cell contains the 23 pair of chromosomes. One pair is called sex chromosomes
More informationMutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B
Mutagenesis for Studying Gene Function Spring, 2007 Guangyi Wang, Ph.D. POST103B guangyi@hawaii.edu http://www.soest.hawaii.edu/marinefungi/ocn403webpage.htm Overview of Last Lecture DNA microarray hybridization
More informationDevelopment of Genomic Tools for RKN Resistance Breeding in Cotton
Development of Genomic Tools for RKN Resistance Breeding in Cotton Dr. Hongbin Zhang Department of Soil & Crop Sciences and Institute for Plant Genomics & Biotechnology Texas A&M University, College Station,
More informationLECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING
Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS
More informationThis is a closed book, closed note exam. No calculators, phones or any electronic device are allowed.
MCB 104 MIDTERM #2 October 23, 2013 ***IMPORTANT REMINDERS*** Print your name and ID# on every page of the exam. You will lose 0.5 point/page if you forget to do this. Name KEY If you need more space than
More informationEvaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications
Ranajit Chakraborty, Ph.D. Evaluation of Genome wide SNP Haplotype Blocks for Human Identification Applications Overview Some brief remarks about SNPs Haploblock structure of SNPs in the human genome Criteria
More informationAn introduction to genetics and molecular biology
An introduction to genetics and molecular biology Cavan Reilly September 5, 2017 Table of contents Introduction to biology Some molecular biology Gene expression Mendelian genetics Some more molecular
More informationCHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
More informationSupplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly
Supplementary Tables Supplementary Table 1. Summary of whole genome shotgun sequence used for genome assembly Library Read length Raw data Filtered data insert size (bp) * Total Sequence depth Total Sequence
More informationChapter 11: Applications of Biotechnology
Chapter 11: Applications of Biotechnology Lecture Outline Enger, E. D., Ross, F. C., & Bailey, D. B. (2012). Concepts in biology (14th ed.). New York: McGraw- Hill. 11-1 Why Biotechnology Works 11-2 Biotechnology
More informationChapter 7 Agricultural Biotechnology
Chapter 7 Agricultural Biotechnology Outline: 7.1 Introduction 7.2 Plant tissue culture 7.3 Genetically Modified Plant 7.4 Animal cloning 7.5 Genetically modified animal 2 Learning outcomes: Describe the
More informationBIO303, Genetics Study Guide II for Spring 2007 Semester
BIO303, Genetics Study Guide II for Spring 2007 Semester 1 Questions from F05 1. Tryptophan (Trp) is encoded by the codon UGG. Suppose that a cell was treated with high levels of 5- Bromouracil such that
More informationName_BS50 Exam 3 Key (Fall 2005) Page 2 of 5
Name_BS50 Exam 3 Key (Fall 2005) Page 2 of 5 Question 1. (14 points) Several Hfr strains derived from the same F + strain were crossed separately to an F - strain, giving the results indicated in the table
More information