Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1
|
|
- Kellie Cobb
- 6 years ago
- Views:
Transcription
1 Functional identification of the wheat gene enhancing mycotoxin detoxification of the major Fusarium resistance QTL Fhb1 Barbara Steiner, Simone Zimmerl, Marc Lemmens, Gerhard Adam, Bradley Till, Wolfgang Schweiger, Hermann Buerstmayr BOKU-University of Natural Resources and Life Sciences Vienna, Department IFA-Tulln, Institute for Biotechnology in Plant Production, Konrad Lorenz Str. 20, A-3430 Tulln, Austria
2 Fhb1 milestones from BOKU University Molecular mapping in the highly resistant CIMMYT line CM Buerstmayr et al. 2002, 2003 Fhb1 confers deoxynivalenol (DON) resistance and detoxifies DON into DON-3-glucoside Lemmens et al. 2005, Xbarc075 Xgwm Xgwm Xbarc Xbarc Xgwm Xbarc102 LOD Transcriptomic and metabolomic characterization Introgressing in European winter wheat, durum wheat and triticale Steiner et al. 2009, Schweiger et al. 2013, Kugler et al. 2013, Warth et al. 2014, Nussbaumer et al. 2015, Kluger et al. 2015, Samad-Zamini et al Salameh et al Prat et al. 2016, Oiller et al cm Xs18m18_9
3 Establishment of the genomic region spanning Fhb1 and fine-mapping FHB severity* DON severity* * mean number of FHB/DONbleached spikelets/head Control lines: resistant alleles resistant alleles susceptible alleles Localisation of Fhb1 in an 860 kb region harboring 28 genes Gene(s) confer FHB and DON resistance R = resistant S = susceptible Schweiger and Steiner et al. (2016) TAG
4 Phenotype Genotype Identification of the DON detoxification gene Mutant populations of the highly resistant line CM-82036: EMS (ethyl methane sulfonate)-treated: 6,000 lines Gamma-irradiated: 1,200 lines Forward genetics lines were inoculated with Fusarium or infiltrated with DON -> susceptible mutants were genotyped Reverse genetics - TILLING Screening for mutations in candidates <- phenotyping of lines with mutations in candidate genes
5 Reverse genetics excludes 9 candidate genes EMS population was screened for mutations in 9 genes ~ 10 lines/gene with truncation/deleterious missense mutations phenotyped few mutants showed susceptible phenotypes, but no conclusive results for one candidate all tested genes excluded as Fhb1 control near isogenic lines differing in Fhb1 mutant lines Fhb1 fhb1 Fhb1 fhb1 F. gram. point inoculation DON infiltration DON infiltration
6 Number of infected spikelts/spike Number of lines Forward genetics: Fhb1 is a dominat resistance gene 1,200 radiated lines inoculated with Fusarium 80 lines FHB susceptible in the field 12 lines confirmed in the greenhouse 4 of these also DON susceptible controls with Fhb1 Genotypic characteristation: 3 lines have deletions covering the whole Fhb1 region, these are FHB and DON susceptible controls lacking Fhb1 genes for FHB and DON resistance are located in this genomic region of CM Mean number of infected spikelets per head Fhb1 acts dominant resistant fhb1/ fhb1 Fhb1/ fhb1 Fhb1/ Fhb1
7 Average number of reads/amplicon Forward genetics for DON susceptibility 1,300 EMS-treated lines infiltrated with DON 8 lines DON susceptible in the field and greenhouse 7 of these lines also FHB susceptible Sequencing of the Fhb1 genic region 80 kb analysed (70 amplicons cover 34 genes) of 32 lines (susceptible mutants and controls) MiSeq sequencing: 500k to 1500k reads per line 5 amplicons insufficient coverage Zero to 5 mutations/line Stop codon and putative deleterious missense mutations were found in several genes 60K 50K 40K 30K 20k 10K 0 Amplicons
8 Outlook and conclusions Current work confirmation of mutations identified by NGS re-sequencing of missing coding regions co-segregation analysis: mutation - phenotype Fhb1 achievements Complete contig with all annotated genes Fhb1 gene-specific primers developed Dominant resistance gene(s) present in CM Confer resistance against FHB and DON DON susceptibility associated with FHB susceptibility
9 Acknowledgments BOKU University Matthias Fidesser field Theresia Köstlbauer greenhouse Evelyn Weissbacher greenhouse Simon Allerstorfer Molla Fentie Mengist Simon Mühl Roman Polzer Bernhard Seidl Marc Lemmens DON, Fusarium inoculum External cooperation: Bradley Till, IAEA Laboratory, A NGS, irradiation Hélène Berges, CNRGV-INRA, F BAC library Austrian Science Fund SFB F3711: Functional genomics of Fusarium resistance in wheat. Project coordinator: Gerhard Adam
10
11 Phenotyping for FHB and DON susceptibility Greenhouse or field F. gram point inoculation or DON infiltration at anthesis Evaluation of FHB/DON severity at several time-points Genotyping of the Fhb1 region SNP detection in genes: TILLING 8-fold 2D pool screening, heteroduplex analysis on Fragment Analyzer TM System Sequencing of the Fhb1 genic region Fhb1 gene-specific primers, sequencing of amplicons on MiSeq System
12 RNA-seq data mapped to the Fhb1 contig -> selection of promising Fhb1 candidate genes
13 Materials and Methods Phenotyping of mutant lines for FHB and DON resistance F. gram inoculation and DON infiltration 2 spikelet (4 florets) / head 10 µl spore suspension (500 conidia) / floret 20 μl DON solution (12 g/l DON) / floret 26 days after inoculation/infiltration: number of diseased /DON bleached spikelets = FHB / DON severity
14 Transcriptomic characterisation of the Fhb1 region using RNA sequencing Greenhouse experiment: Genotypes 2 CM NILs differing in Fhb1: NIL38 (Fhb1) NIL51 Treatments 2 Fusarium inoculated Mock inoculated Sampling time points Replications Total number of samples hai 72 F. gram spore conc conidia/ml 5 heads/sample with 6 inoculated spikelets/head spikelet 6 spikelet 4 spikelet 5 spikelet 3 spikelet 2 spikelet 1
15 Plant Material CM82036 chr. 3B Fhb1 region x chr. 3B Fhb1 region Remus F1 Regeneration of haploid plants (n) from F1 plants Duplication of the genom of the haploid plants (n) to doubled haploid plants (2n) DH line Fhb1 region x CM times backcrossed with CM82036 BC5F1 x 98.5 % CM82036 alleles BC5F2 chr. 3B 5A chr. 3B 5A Fhb1 Qfhs.ifa-5A Fhb1 region region region Qfhs.ifa-5A region CM Nil 38 CM Nil 51
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding
Current Knowledge on the Genetics of Fusarium Head Blight Resistance in Wheat - Implications for Resistance Breeding Hermann Buerstmayr, Barbara Steiner, Marc Lemmens BOKU-University of Natural Resources
More informationFHB Resistance in Durum -Progress and Challenge
FHB Resistance in Durum -Progress and Challenge Elias Elias, Shahryar Kianian, Shaobin Zhong, and Xiwen Cai North Dakota State University, Fargo, ND Steven Xu USDA-ARS, Fargo, ND Outline Sources of resistance
More informationValidation and Marker Assisted Selection of Three QTL Conditioning Fusarium Head Blight Resistance in Wheat
Validation and Marker Assisted Selection of Three QTL Conditioning Fusarium Head Blight Resistance in Wheat Jianli Chen, Carl. Griffey,, Jody Fanelli,, and Saghai Maroof Virginia Polytechnic Institute
More informationUSWBSI Barley CP Milestone Matrix Updated
USWBSI Barley CP Milestone Matrix Updated 10-10-13 RA: Variety Development and Host Resistance (VDHR) CP Objective 2: Map Novel QTL for resistance to FHB in barley BS, KS Dec 2013 Make initial crosses
More informationGenomic resources and gene/qtl discovery in cereals
Genomic resources and gene/qtl discovery in cereals Roberto Tuberosa Dept. of Agroenvironmental Sciences & Technology University of Bologna, Italy The ABDC Congress 1-4 March 2010 Gudalajara, Mexico Outline
More informationGenome research in eukaryotes
Functional Genomics Genome and EST sequencing can tell us how many POTENTIAL genes are present in the genome Proteomics can tell us about proteins and their interactions The goal of functional genomics
More informationDeveloping Fusarium head blight resistant wheat. Gary J. Muehlbauer University of Minnesota
Developing Fusarium head blight resistant wheat Gary J. Muehlbauer University of Minnesota Wheat Type II R FHB resistance Wheat susceptible Barley Trichothecenes are virulence factors on wheat Deoxynivalenol
More informationJoint transcriptomic and metabolomic analyses reveal changes in the primary. metabolism and imbalances in the subgenome orchestration in the bread
G3: Genes Genomes Genetics Early Online, published on October 4, 2015 as doi:10.1534/g3.115.021550 Joint transcriptomic and metabolomic analyses reveal changes in the primary metabolism and imbalances
More informationToward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly
Toward a better understanding of plant genomes structure: combining NGS and optical mapping technology to improve the sunflower assembly Céline CHANTRY-DARMON 1 CNRGV The French Plant Genomic Center Created
More informationGRADUATE AND POSTDOCTORAL STUDIES FINAL ORAL EXAMINATION
GRADUATE AND POSTDOCTORAL STUDIES MCGILL UNIVERSITY FINAL ORAL EXAMINATION FOR THE DEGREE OF DOCTOR OF PHILOSOPHY OF DHANANJAY DHOKANE DEPARTMENT OF PLANT SCIENCE Identification of fusarium head blight
More informationNext Generation Genetics: Using deep sequencing to connect phenotype to genotype
Next Generation Genetics: Using deep sequencing to connect phenotype to genotype http://1001genomes.org Korbinian Schneeberger Connecting Genotype and Phenotype Genotyping SNPs small Resequencing SVs*
More informationFrom the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding.
From the genome to the field : how to improve the isolation of genomic regions of interest for plant breeding. Hélène BERGES Director of the French Plant Genomic Center INRA Toulouse The French Plant Genomic
More informationMapping a Type 1 FHB resistance on chromosome 4AS of Triticum macha and deployment in combination with two Type 2 resistances
Theor Appl Genet (2015) 128:1725 1738 DOI 10.1007/s00122-015-2542-9 ORIGINAL PAPER Mapping a Type 1 FHB resistance on chromosome 4AS of Triticum macha and deployment in combination with two Type 2 resistances
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More informationGenome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Supplementary Information Genome-wide genetic screening with chemically-mutagenized haploid embryonic stem cells Josep V. Forment 1,2, Mareike Herzog
More informationNature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 Quantitative RT PCR analysis of the genes of the Fhb1 region in spikes of R-NIL and S-NIL. Gene expression changes were calculated as fold change in Fusarium graminearum inoculations
More informationGene Editing in Cereals. Emma Wallington
Gene Editing in Cereals Emma Wallington emma.wallington@niab.com NIAB Group NIAB established in 1919 by charitable donations for the improvement of crops.. with higher.. genetic quality A charitable company
More informationComparison of Spray and Point Inoculation with Fusarium graminearum to Evaluate FHB Disease in Two Winter Wheat Genotypes Under Temperature Stress
Computational Biology and Bioinformatics 2017; 5(1): 1-5 http://www.sciencepublishinggroup.com/j/cbb doi: 10.11648/j.cbb.20170501.11 ISSN: 2330-8265 (Print); ISSN: 2330-8281 (Online) Comparison of Spray
More informationChapter 8. Microbial Genetics. Lectures prepared by Christine L. Case. Copyright 2010 Pearson Education, Inc.
Chapter 8 Microbial Genetics Lectures prepared by Christine L. Case Structure and Function of Genetic Material Learning Objectives 8-1 Define genetics, genome, chromosome, gene, genetic code, genotype,
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationUtilization of the IWGSC Resources: Application to Wheat Breeding
Utilization of the IWGSC Resources: Application to Wheat Breeding Wheat Breeding: Securing Tomorrow s Profitability. Dr. Curtis J. Pozniak IWGSC Workshop, PAG, Jan 2014 Use and/or distribution of these
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computational Bioscience
Building Excellence in Genomics and Computational Bioscience Wheat genome sequencing: an update from TGAC Sequencing Technology Development now Plant & Microbial Genomics Group Leader Matthew Clark matt.clark@tgac.ac.uk
More informationSingle Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s) 7/26/2017
USDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, 2017 Cover Page Principle Investigator (PI): Guihua Bai Institution: USDA-ARS E-mail: gbai@ksu.edu Phone:
More informationMUTANT: A mutant is a strain that has suffered a mutation and exhibits a different phenotype from the parental strain.
OUTLINE OF GENETICS LECTURE #1 A. TERMS PHENOTYPE: Phenotype refers to the observable properties of an organism, such as morphology, growth rate, ability to grow under different conditions or media. For
More informationCloning a DNA marker associated to wheat scab resistance
J. Appl. Genet. 45(1), 2004, pp. 17-25 Cloning a DNA marker associated to wheat scab resistance Guihong YU, Hongxiang MA, Zhang XU, Lijian REN, Maoping ZHOU, Weizhong LU Institute of Agro-Biological Genetics
More informationUnderstanding yield potential and bread making quality in bread wheat. Simon Griffiths Crop Genetics John Innes Centre
Understanding yield potential and bread making quality in bread wheat Simon Griffiths Crop Genetics John Innes Centre The evolution of GRAIN yield and quality in wheat Ancient ield and quality alleles
More informationhttp://fire.biol.wwu.edu/trent/trent/direct_detection_of_genotype.html 1 Like most other model organism Arabidopsis thaliana has a sequenced genome? What do we mean by sequenced genome? What sort of info
More information* Custom assays developed based on customer requirements. * Rigorous QC process to ensure test performance and accuracy
Price List 2012-13 About Scigenom * Genomics focused R & D organization * Expertise in rapid and accurate DNA test development * Several DNA based tests readily available * Custom assays developed based
More informationMapping of Two White Stem Genes in Tetraploid Tobacco (Nicotiana tabacum L.)
Mapping of Two White Stem Genes in Tetraploid Tobacco (Nicotiana tabacum L.) WU Xinru Tobacco Research Institute, Chinese Academy of Agricultural Sciences Québec, Oct 13, 2014 Outline Background: leaf
More informationGenetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection
Genetic dissection of complex traits, crop improvement through markerassisted selection, and genomic selection Awais Khan Adaptation and Abiotic Stress Genetics, Potato and sweetpotato International Potato
More informationLecture 21: Association Studies and Signatures of Selection. November 6, 2006
Lecture 21: Association Studies and Signatures of Selection November 6, 2006 Announcements Outline due today (10 points) Only one reading for Wednesday: Nielsen, Molecular Signatures of Natural Selection
More informationVariant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4
WHITE PAPER Oncomine Comprehensive Assay Variant calling workflow for the Oncomine Comprehensive Assay using Ion Reporter Software v4.4 Contents Scope and purpose of document...2 Content...2 How Torrent
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationA mutation in TaGW2-A increases thousand grain weight in wheat. James Simmonds
A mutation in TaGW2-A increases thousand grain weight in wheat James Simmonds Keeping up with demand As the world population continues to rise, demands are increasing and the rate of yield advances are
More informationToward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach
Toward a better understanding of plant genomes structure : Combining NGS, optical mapping technology and CRISPR-CATCH approach Hélène BERGES Director of the Plant Genomic Center Global warming effects,
More informationI.1 The Principle: Identification and Application of Molecular Markers
I.1 The Principle: Identification and Application of Molecular Markers P. Langridge and K. Chalmers 1 1 Introduction Plant breeding is based around the identification and utilisation of genetic variation.
More informationIdentify the Lethal Dose of EMS and Gamma Radiation Mutagenesis in Rice MR219
2012 2nd International Conference on Environment Science and Biotechnology IPCBEE vol.48 (2012) (2012) IACSIT Press, Singapore DOI: 10.7763/IPCBEE. 2012. V48. 5 Identify the Lethal Dose of EMS and Gamma
More informationBSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06
Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift
More informationLecture 2: Using Mutants to study Biological processes
Lecture 2: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen for
More informationChapter 5 Genetic Analysis in Cell Biology. (textbook: Molecular Cell Biology 6 ed, Lodish section: )
Chapter 5 Genetic Analysis in Cell Biology (textbook: Molecular Cell Biology 6 ed, Lodish section: 5.1+5.4-5.5) Understanding gene function: relating function, location, and structure of gene products
More informationGenetic variations and Gene Rearrangements. Mutation
Genetic variations and Gene Rearrangements Mutation Def.: It is a physical change of one or more nucleotide pairs in the DNA of a cell. The change is inherited by every descendant of the mutant cell. Classification:
More informationSingle Nucleotide Variant Analysis. H3ABioNet May 14, 2014
Single Nucleotide Variant Analysis H3ABioNet May 14, 2014 Outline What are SNPs and SNVs? How do we identify them? How do we call them? SAMTools GATK VCF File Format Let s call variants! Single Nucleotide
More informationPharmacogenetics: A SNPshot of the Future. Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001
Pharmacogenetics: A SNPshot of the Future Ani Khondkaryan Genomics, Bioinformatics, and Medicine Spring 2001 1 I. What is pharmacogenetics? It is the study of how genetic variation affects drug response
More informationA barley root mutant collection for NGS-based fast-forward genetics
A barley root mutant collection for NGS-based fast-forward genetics Roberto Tuberosa Dept. of Agricultural Sciences University of Bologna, Italy 2 nd Plant Genomics Congress Kuala Lumpur, 19-20 March,
More informationSEQUENCING. M Ataei, PhD. Feb 2016
CLINICAL NEXT GENERATION SEQUENCING M Ataei, PhD Tehran Medical Genetics Laboratory Feb 2016 Overview 2 Background NGS in non-invasive prenatal diagnosis (NIPD) 3 Background Background 4 In the 1970s,
More informationFrom Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow
From Variants to Pathways: Agilent GeneSpring GX s Variant Analysis Workflow Technical Overview Import VCF Introduction Next-generation sequencing (NGS) studies have created unanticipated challenges with
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationOutline. ü Post gene expression regulation and RNA editing ü Epigenetic modification
Outline Resources, approaches, technologies, and tools used in functional genomics studies Chemical, physical, and insertional mutagens induced mutations Reverse genetics Site-specific mutation Forward
More informationSUPPLEMENT MATERIALS FOR CURTIN,
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 SUPPLEMENT MATERIALS FOR CURTIN, et al. Validating genome-wide association candidates: Selecting, testing, and characterizing
More informationUSDA-ARS/ U.S. Wheat and Barley Scab Initiative FY16 Final Performance Report Due date: July 28, USWBSI Individual Project(s)
USDA-ARS/ U.S. Wheat and Barley Scab Initiative Due date: July 28, 2017 Cover Page Principle Investigator (PI): Brian Steffenson Institution: University of Minnesota E-mail: bsteffen@umn.edu Phone: 612-325-4735
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationIdentifying Genes Underlying QTLs
Identifying Genes Underlying QTLs Reading: Frary, A. et al. 2000. fw2.2: A quantitative trait locus key to the evolution of tomato fruit size. Science 289:85-87. Paran, I. and D. Zamir. 2003. Quantitative
More informationMicrosatellite markers
Microsatellite markers Review of repetitive sequences 25% 45% 8% 21% 13% 3% Mobile genetic elements: = dispersed repeat included: transposition: moving in the form of DNA by element coding for transposases.
More informationNext GEM Next Generation Mutagenesis. Guri Johal. Department of Botany and Plant Pathology. Purdue University
Next GEM Next Generation Mutagenesis Guri Johal Department of Botany and Plant Pathology Purdue University June 24, 2015 The focus of this approach is how to enhance genetic variation, which drives almost
More informationSUPPLEMENTARY INFORMATION
AS-NMD modulates FLM-dependent thermosensory flowering response in Arabidopsis NATURE PLANTS www.nature.com/natureplants 1 Supplementary Figure 1. Genomic sequence of FLM along with the splice sites. Sequencing
More informationCloning drought-related QTLs. WUEMED training course June 5-10, 2006
Cloning drought-related QTLs silvio.salvi@unibo.it WUEMED training course June 5-10, 2006 Introgression libraries QTL cloning Mapping populations High LD germplasm collections Low LD germplasm collections
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationA brief introduction to Marker-Assisted Breeding. a BASF Plant Science Company
A brief introduction to Marker-Assisted Breeding a BASF Plant Science Company Gene Expression DNA is stored in chromosomes within the nucleus of each cell RNA Cell Chromosome Gene Isoleucin Proline Valine
More informationPerformance Characteristics drmid Dx for Illumina NGS systems
Performance Characteristics drmid Dx for Illumina NGS systems MANUFACTURER Multiplicom N.V. Galileïlaan 18 2845 Niel BELGIUM Revision date: August, 2017 Page 1 of 7 TABLE OF CONTENTS 1. TEST PRINCIPLE...
More informationLecture 2-3: Using Mutants to study Biological processes
Lecture 2-3: Using Mutants to study Biological processes Objectives: 1. Why use mutants? 2. How are mutants isolated? 3. What important genetic analyses must be done immediately after a genetic screen
More informationDE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN. (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN
DE NOVO WHOLE GENOME ASSEMBLY AND SEQUENCING OF THE SUPERB FAIRYWREN (Malurus cyaneus) JOSHUA PEÑALBA LEO JOSEPH CRAIG MORITZ ANDREW COCKBURN ... 2014 2015 2016 2017 ... 2014 2015 2016 2017 Synthetic
More informationGenes, Mendel and Meiosis
Genes, Mendel and Meiosis Why are Genetics Important? Key to plants being able to survive (evolve) changes in environment is genetic variation. Plant breeders use this genetic variation to breed new cultivars.
More informationIllumina Genome Analyzer. Progenika Experience. - Susana Catarino -
Illumina Genome Analyzer Progenika Experience - Susana Catarino - Who are we? 2000 PROGENIKA BIOPHARMA Development, production and commercialization of new genomic tools for diagnosis, prognosis and drug-response
More informationWheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline
Wheat Genome Structural Annotation Using a Modular and Evidence-combined Annotation Pipeline Xi Wang Bioinformatics Scientist Computational Life Science Page 1 Bayer 4:3 Template 2010 March 2016 17/01/2017
More informationGet to Know Your DNA. Every Single Fragment.
HaloPlex HS NGS Target Enrichment System Get to Know Your DNA. Every Single Fragment. High sensitivity detection of rare variants using molecular barcodes How Does Molecular Barcoding Work? HaloPlex HS
More informationCourse Syllabus for FISH/CMBL 7660 Fall 2008
Course Syllabus for FISH/CMBL 7660 Fall 2008 Course title: Molecular Genetics and Biotechnology Course number: FISH 7660/CMBL7660 Instructor: Dr. John Liu Room: 303 Swingle Hall Lecture: 8:00-9:15 a.m.
More informationIdentifying and exploiting natural variation
Identifying and exploiting natural variation New methods of fine mapping: association mapping MAGIC Methods for increasing diversity: synthetic wheat Advantages of new methods for fine mapping More efficient
More informationA. With just this information, how many genes does it take to make DNA polymerase III? 8 assuming d' and d are different polypeptides
NAME Gene 603 Exam 1 October 4, 2,002 I. According to recent work in the lab of Charles McHenry, The E. coli DNA polymerase III holoenzyme contains polypeptide subunits in the arrangement (aeq) 2 -t 2
More informationWhat determines if a mutation is deleterious, neutral, or beneficial?
BIO 184 - PAL Problem Set Lecture 6 (Brooker Chapter 18) Mutations Section A. Types of mutations Define and give an example the following terms: allele; phenotype; genotype; Define and give an example
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More information4/3/2013. DNA Synthesis Replication of Bacterial DNA Replication of Bacterial DNA
4/3/03 3 4 5 6 7 8 9 0 Chapter 8 Microbial Genetics Terminology Genetics: The study of what genes are, how they carry information, how information is expressed, and how genes are replicated Gene: A segment
More informationBENG 183 Trey Ideker. Genome Assembly and Physical Mapping
BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms
More informationDNA. bioinformatics. genomics. personalized. variation NGS. trio. custom. assembly gene. tumor-normal. de novo. structural variation indel.
DNA Sequencing T TM variation DNA amplicon mendelian trio genomics NGS bioinformatics tumor-normal custom SNP resequencing target validation de novo prediction personalized comparative genomics exome private
More informationFunctional genomics to improve wheat disease resistance. Dina Raats Postdoctoral Scientist, Krasileva Group
Functional genomics to improve wheat disease resistance Dina Raats Postdoctoral Scientist, Krasileva Group Talk plan Goal: to contribute to the crop improvement by isolating YR resistance genes from cultivated
More informationSingle-cell sequencing
Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant
More informationGENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON
GENOTYPING-BY-SEQUENCING USING CUSTOM ION AMPLISEQ TECHNOLOGY AS A TOOL FOR GENOMIC SELECTION IN ATLANTIC SALMON Matthew Baranski, Casey Jowdy, Hooman Moghadam, Ashie Norris, Håvard Bakke, Anna Sonesson,
More informationSupplementary Information
Supplementary Information Quantifying RNA allelic ratios by microfluidic multiplex PCR and sequencing Rui Zhang¹, Xin Li², Gokul Ramaswami¹, Kevin S Smith², Gustavo Turecki 3, Stephen B Montgomery¹, ²,
More informationMapping and Mapping Populations
Mapping and Mapping Populations Types of mapping populations F 2 o Two F 1 individuals are intermated Backcross o Cross of a recurrent parent to a F 1 Recombinant Inbred Lines (RILs; F 2 -derived lines)
More informationTarget Enrichment Strategies for Next Generation Sequencing
Target Enrichment Strategies for Next Generation Sequencing Anuj Gupta, PhD Agilent Technologies, New Delhi Genotypic Conference, Sept 2014 NGS Timeline Information burst Nearly 30,000 human genomes sequenced
More informationMapping long-range promoter contacts in human cells with high-resolution capture Hi-C
CORRECTION NOTICE Nat. Genet. 47, 598 606 (2015) Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C Borbala Mifsud, Filipe Tavares-Cadete, Alice N Young, Robert Sugar,
More informationSupplementary Data 1.
Supplementary Data 1. Evaluation of the effects of number of F2 progeny to be bulked (n) and average sequencing coverage (depth) of the genome (G) on the levels of false positive SNPs (SNP index = 1).
More informationSupplemental Data. Zhou et al. (2016). Plant Cell /tpc
Supplemental Figure 1. Confirmation of mutant mapping results. (A) Complementation assay with stably transformed genomic fragments (ComN-N) (2 kb upstream of TSS and 1.5 kb downstream of TES) and CaMV
More informationKWS LOCHOW GMBH, Wohlde, Germany (6 months)
PERSONAL INFORMATION Valentina Spanic +385 31 515 563 +385 99 25 18 173 valentina.spanic@poljinos.hr Sex Female Year and place of birth 1981, Osijek, Croatia Nationality Croatian WORK EXPERIENCE May 2006
More informationMolecular and Applied Genetics
Molecular and Applied Genetics Ian King, Iain Donnison, Helen Ougham, Julie King and Sid Thomas Developing links between rice and the grasses 6 Gene isolation 7 Informatics 8 Statistics and multivariate
More informationThe Why, What, and How of the Iso-Seq Method: Using Full-length RNA Sequencing to Annotate Genomes and Solve Diseases
The Why, What, and How of the Iso-Seq Method: Using Full-length RNA Sequencing to Annotate Genomes and Solve Diseases For Research Use Only. Not for use in diagnostic procedures. Copyright 2018 by Pacific
More informationMassive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput
Next Generation (Sequencing) Tools for Nucleotide-Based Information Massive Analysis of cdna Ends for simultaneous Genotyping and Transcription Profiling in High Throughput Björn Rotter, PhD GenXPro GmbH,
More information3. human genomics clone genes associated with genetic disorders. 4. many projects generate ordered clones that cover genome
Lectures 30 and 31 Genome analysis I. Genome analysis A. two general areas 1. structural 2. functional B. genome projects a status report 1. 1 st sequenced: several viral genomes 2. mitochondria and chloroplasts
More informationEcological genomics and molecular adaptation: state of the Union and some research goals for the near future.
Ecological genomics and molecular adaptation: state of the Union and some research goals for the near future. Louis Bernatchez Genomics and Conservation of Aquatic Resources Université LAVAL! Molecular
More informationMatthias Fladung, Fadia El-Sherif. vti, Institute for Forest Genetics Grosshansdorf, Germany
Activation tagging in aspen using an inducible two component Ac/Ds-enhancer element system Matthias Fladung, Fadia El-Sherif vti, Institute for Forest Genetics Grosshansdorf, Germany Poplar genome sequencing
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationInitiative Aids Progress in Development of Barley Varieties with Improved Scab Resistance
Initiative Aids Progress in Development of Barley Varieties with Improved Scab Resistance By Don Lilleboe* One of the world s oldest cultivated grains, barley currently is the fourth most important global
More informationThe RAD51pro::GFP strain was created using the standard agrobacterium-mediated floral
SUPPLEMENTAL EXPERIMENTAL PROCEDURES Generation of the RAD51pro::GFP transgene The RAD51pro::GFP strain was created using the standard agrobacterium-mediated floral dip transformation on atxr5/6 mutants
More informationF 11/23 Happy Thanksgiving! 8 M 11/26 Gene identification in the genomic era Bamshad et al. Nature Reviews Genetics 12: , 2011
3 rd Edition 4 th Edition Lecture Day Date Topic Reading Problems Reading Problems 1 M 11/5 Complementation testing reveals that genes are distinct entities Ch. 7 224-232 2 W 11/7 One gene makes one protein
More informationGenomics Based Approaches to Genetic Improvement in Sugarcane. Robert Henry
Genomics Based Approaches to Genetic Improvement in Sugarcane Robert Henry Centre for Plant Conservation Genetics Life Enriched by Plant Biodiversity Food Biomass options Sorghum Sugarcane Grasses Shrubs
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More informationGenetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton
Genetic and Molecular Characterization of Host-Plant Resistance to Root-knot Nematodes and Fusarium Wilt in Cotton Phil Roberts & Congli Wang, Department of Nematology Univ. of California, Riverside Project
More information