ACCEPTED. Goarant, 2 and S. Le Hello 1* Institut Pasteur de Nouvelle-Calédonie, Laboratoire d Epidémiologie Moléculaire, 1

Size: px

Start display at page:

Download "ACCEPTED. Goarant, 2 and S. Le Hello 1* Institut Pasteur de Nouvelle-Calédonie, Laboratoire d Epidémiologie Moléculaire, 1"

Franklin Foster
6 years ago
Views:

1 AAC Accepts, published online ahead of print on August 00 Antimicrob. Agents Chemother. doi:0./aac Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. RT-PCR detection of gyra and parc mutations in Streptococcus pneumoniae 0 S. Page,, F. Vernel-Pauillac, O. O Connor, S. Bremont, F. Charavay, P. Courvalin, C. Goarant, and S. Le Hello * Institut Pasteur de Nouvelle-Calédonie, Laboratoire d Epidémiologie Moléculaire, Laboratoire de Recherche en Bactériologie, Nouméa, Nouvelle Calédonie, Institut Pasteur, Unité des Agents Antibactériens, Paris, France * Corresponding author. Mailing address: Institut Pasteur de Nouvelle-Calédonie, - avenue Paul Doumer, BP, Nouméa Cedex, Nouvelle-Calédonie. Phone:... Fax: slehello@pasteur.nc 0

2 Abstract Fluoroquinolone-resistance in Streptococcus pneumoniae involves mainly stepwise mutation predominantly in the parc and gyra genes. We have developed a single-run RT-PCR assay for detection of the four most common mutations in the QRDRs of these genes, providing a useful tool for both clinical and epidemiological use.

3 0 0 Streptococcus pneumoniae is a major cause of community-acquired infections ranging from otitis media to pneumonia or meningitis (). Strains resistant to multiple antibiotics have recently been reported and pose a risk of therapeutic failure (). This observation has encouraged the use of newer fluoroquinolones against pneumococci () and has thus led to the emergence of fluoroquinolone-resistant clones. Prevalence rates have increased in Canada and have reached.% in Hong Kong, whilst remaining below -% in the USA and Europe (). Development of resistance to fluoroquinolones in pneumococci is a stepwise mutational process () occurring mainly in the quinolone resistance determining region (QRDR) of the parc and gyra genes (). Several reports have noted that a significant proportion of isolates harboring first-step mutations had low or no phenotypic expression but had the potential to develop higher levels of resistance to fluoroquinolones when they suffered a second mutation, resulting in treatment failure (0). This evolution implies that microbiologists must be able to detect first-step, or pre-resistant, mutants. Scheme of non-molecular test has been proposed for detection of low-level resistance but err through lack of sensibility and specificity (). A powerful and highly specific technique for detection of mutations within a DNA sequence is real-time PCR with fluorescence resonance energy transfer (FRET) hybridization probes. We report the development of a real-time PCR assay using FRET for a single-run detection of the four most common resistance mutations within the QRDRs of the parc and gyra genes of S. pneumoniae. S. pneumoniae were isolated, cultured, and identified as described (). A total of strains previously sequenced in the parc and gyra genes were studied. They consisted of R and three R derivatives kindly provided by E. Varon (), 0 in vitro generated mutants, reference strains CIP0 and CP 000, and of clinical isolates ( from New Caledonia, from Australia, and from Tahiti). Table summarises the known mutations and the results of disk agar diffusion (Biorad ) and MICs determined by agar dilution as

4 0 0 described (). DNA was extracted using the QIAamp DNA mini kit (Qiagen). Primers and probes were designed using the LightCycler Probe Design Software and ordered from Proligo Singapore Pty Ltd. The wild-type sequences of gyra (accession number: DQ) and parc (accession number: DQ0) were used for oligonucleotide design. Using the parc sequence, a LC-Red0-labeled sensor probe was designed to detect the SerTyr (C-A substitution) and the AspAla (A-C substitution) mutations. Based on the gyra sequence, LC-Red0-labeled probes were designed to detect the SerPhe (C T substitution) and GluLys (G A substitution) changes. Probes for gyra were designed so that each covered a mutation (Ser or Glu) and had the same melting temperature, thus behaving as an anchor for the other probe. Table summarizes the sequences of primers and probes, concentrations, and reaction conditions. The primers led to -bp and 0-bp amplicons for gyra and parc, respectively, allowing detection of mutations in gyra and parc in a single run in 0µl capillaries of a LightCycler.0. The parc primers were optimized at unequal concentrations to increase the fluorescence and allow better discrimination of melting peaks (T m s) (). All S. pneumoniae strains had clearly distinguishable melting curves for both gyra and parc (Fig. ). Wild-type parc had T m values of. C, single Ser or Asp mutants T m s were in the range.-.0 C except the AspGly evidenced by a T m value of. C, still significantly lower than wild types and highly reproducible. The double Ser-Asp parc mutant had a T m of. C. Wild-type gyra had T m values greater than C and mutant T m s were all below. C. The mean T m for wild-type gyra was. C, that for single Ser gyra mutant.0 C, and the T m value for single Glu gyra mutant was. C. The double Ser-Glu gyra mutant had an intermediate T m of. C. The FRET RT-PCR results obtained for the clinical isolates were in agreement with the sequencing data: all strains tested were wild-type, except H which was a single SerPhe mutant () (Table ).

5 0 0 Rapid detection of gyra and parc mutations in a single run represents a faster and more reliable approach than the current phenotypic method () which is unable to detect S. pneumoniae that have a higher potential than wild-type strains to evolve towards resistance. The design of the set of parc probes followed the current recommendations for sensor and anchor probe design which states that there should be a - C minimum difference between their T m s. Following the same recommendations for the design of the gyra probes, however, did not yield satisfactorily distinguishable melting curves between mutant and wild-type strains. We therefore designed the probes for gyra with identical T m s so that each probe covered one mutation (Ser or Glu) and behaved as an anchor for the other; only the wild- type strain having a perfect complementary match. To the best of our knowledge, this is the first report of such a strategy to successfully detect mutations lying in close proximity. Since a single probe pair is required for the detection of two putative mutations, this avoids the risk of overlapping sets of probes or of dimerisation that would require the use of two capillaries. The limitations of the assay, as with all sequence-specific techniques, are that mutations outside the sequence covered by the sensor probe escape detection and that resistance resulting from mutation in another gene, e.g. in pare or gyrb, or other mechanisms such as efflux also remain undetected. However, although these mechanisms tend to confer resistance, they are less described for high-level resistance, as opposed to the double parc and gyra mutations. The assay could be useful in epidemiological surveys for the screening of resistance as an alternative to DNA sequencing and is more sensitive in estimating the prevalence of resistance than the phenotypic screen. We have confirmed that isolates considered as levofloxacine-susceptible according to the CLSI breakpoints (of µg/ml) by the phenotypic test () and isolates as undetected by the nonmolecular test for detection of low-resistance to fluoroquinolone by Varon et al () possessed single QRDR mutations. Though not as

6 0 0 accurate as DNA sequencing in the determination of the precise genotype of the mutant strains, our assay is cheap, fast, and accurate for detection of the most common QRDR mutants, allowing to rapidly test if a clinical isolate has a wild type or a non-wild type gyra and parc QRDRs genotype. Recently, Fukushima et al. () also reported the use of melting curve analysis for the detection of QRDR mutations in S. pneumonia, using two pairs of probes for the detection of the Ser and Asp mutations in ParC and two pairs of probes for the detection of the Ser and Glu mutations in GyrA. The sensitivity and specificity of our assay allow direct detection of mutations in clinical isolates, rendering the assay useful for timely decision for therapy. Moreover, the design of our hybridization probes for detection of the two mutations in GyrA with a single probe pair indicates that in a single run and capillary, all types of gyra mutants (single Ser, single Glu, and double ser and Glu mutants) can be detected. Decousser et al. () described an assay allowing to clearly identify Ser or Asp parc mutants in S. pneumoniae using a single capillary with two locked nucleic acid probes ( TaqMan format) each matching a mutated sequence; mutated strains being identified based on the absence of fluorescence with the corresponding probe. However, due to the absence of an internal control, double Ser and Asp mutants will be characterized based on the lack of fluorescence, similar to what would be observed with a negative control or PCR inhibition. Using another FRET technology with hybridization probes ( HybProbe format), our assay yields detectable amplification whatever the genotype of the strain studied. Additionally, our assay also genotypes gyra that is the other major gene implicated in quinolone resistance in S. pneumoniae. In conclusion, our assay is a two-capillary single-run easy and rapid technique that detects the major gyra and parc QRDRs mutations associated with quinolone resistance in S.

7 pneumoniae and can be used for both surveillance and treatment-regimen decision-making purposes.

8 Acknowledgments We thank Emmanuelle Varon from Centre National des Pneumocoques and Don Low for assistance with reference isolates processing.

9 0 0. Appelbaum, P.C.. Worldwide development of antibiotic resistance in pneumococci. Eur. J. Clin. Microbiol. : -.. Barratt, K., and J. F. Mackay. 00. Improving real-time PCR genotyping assays by asymmetric amplification. J. Clin. Microbiol. 0:-.. Canton, R., M. Morosini, M. C. Enright, and I. Morrissey. 00. Worldwide incidence, molecular epidemiology and mutations implicated in fluoroquinolone- resistant Streptococcus pneumoniae: data from the global PROTEKT surveillance programme. J. Antimicrob. Chemother. :-.. Clinical and Laboratory Standards Institute (CLSI). 00. Standard M00-S. Performance Standards for Antimicrobial Susceptibility Testing; th Informational Supplement.. Decousser JW, Methlouthi I, Pina P, Collignon A, Allouch P. 00. New real-time PCR assay using locked nucleic acid probes to assess prevalence of ParC mutations in fluoroquinolone-susceptible Streptococcus pneumoniae isolates from France. Antimicrob. Agents. Chemother. 0: -.. Fukushima, K.Y., Y. Hirakata, K. Sugahara, K. Yanagihara, A. Kondo, S. Khono, and S. Kamihira. 00. Rapid screening of topoisomerase gene mutations by a novel melting curve analysis method for early warning of fluoroquinolone-resistant Streptococcus pneumoniae emergence. J. Clin. Microbiol. : -.. Gillespie, S.H., L.L. Voelker, J.E. Ambler, C. Traini, and A. Dickens. 00. Fluoroquinolone resistance in Streptococcus pneumoniae: evidence that gyra mutations arise at a lower rate and that mutation in gyra or parc predisposes to further mutation. Microb. Drug Resist. : -.. Ho, P.-I., T.L. Que, D.N. Tsanq, T.K. Nq, K.H. Chow, and W.H. Seto.. Emergence of fluoroquinolone resistance among multiply resistant strains of

10 0 Streptococcus pneumoniae in Hong Kong. Antimicrob. Agents Chemother. : 0-.. Le Hello, S., S. Page, and B. Garin. 00. Fluoroquinolone in a clinical isolate of 0 Streptococcus pneumoniae in the South Pacific. Int. J. Antimicrob. Agents. : Perez Trallero, E., J.M. Marimon, L. Iglesias, and J. Larruskain. 00. Fluoroquinolone and macrolide treatment failure in pneumococcal pneumonia and selection of multidrug-resistant isolates. Emerg. Infect. Dis. : -.. Pletz, M.W.R., R.V. Fugit, L. McGee, J.J. Glasheen, D.L. Keller, T. Welte, and K.P. Klugman. 00. Fluoroquinolone-resistant Streptococcus pneumoniae. Emerg. Infect. Dis. :-.. Rudan, I., L. Tomaskovic, C. Boschi-Pinto, H. Campbell, and WHO-CHERG. 00. Global estimate of the incidence of clinical pneumonia among children under five years of age. Bull WHO : -0.. Varon, E, S. Houssaye, S. Grondin, L. Gutmann, and the groupe des observatoires de la résistance du pneumocoque. 00. Nonmolecular test for detection of low-level resistance to fluoroquinolones in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 0:-.

11 TABLE. Susceptibility of S. pneumoniae to quinolones Inhibition zone diameter (mm) b MIC (µg/ml) b Strain QRDR mutation a NAL CIP NOR PEF SPX LVX MXF NOR PEF CIP SPX LVX MXF CIP0 None R None CP 000 None RTr* gyra SerPhe UA* gyra GluLys UA00* gyra SerPhe UA0* gyra SerTyr UA* gyra SerCys H c gyra SerPhe 0.0 ND.0 ND.0 RTr parc SerTyr UA0 parc SerPhe UA parc SerTyr UA parc AspAsn ND.0 0. UA parc AspGly > ND.0 0. UA parc SerTyr parc AspAla.0 > > RTr0 gyra SerTyr parc SerTyr.0 > > UA0 gyra SerTyr parc AspHis UA00 gyra SerPhe parc AspHis.0.0 > UA gyra GluLys parc SerPhe.0 > > > >.0 a Asp, aspartic acid; Glu, glutamic acid; Gly, glycine; His, histidine; Lys, lysine; Phe, phenylalanine; Ser, serine; Tyr, tyrosine. b CIP, ciprofloxacin; LVX, levofloxacin; MXF, moxifloxacin; NAL, nalidixic acid; NOR, norfloxacin; PEF, pefloxacin; SPX, sparfloxacin. c Clinical strain. * strains carrying mutations do not detected with the phenotypic methods as described () ND, not done.

12 TABLE. Primers, probes, and reaction conditions for detection of QRDR mutations. Oligonucleotide Sequence ( / / ) Position Wild-type mutant amino acid (nucleotide n ) gyra QRDR gyra-f GTTCACCGTCGCATTCT -0 (forward primer) gyra-r CCCATGACCATCTACAAGC - (reverse primer) gyra-p TATCACCCACACGGGGATTC - Ser Phe (sensor or anchor CTCTAT - fluorescein TCC TTC probe) (--) gyra-p LC Red 0- - Glu Lys (sensor or anchor ATGAAGCCATGGTCCGTATG GAA AAA probe) GC - phosphate (--) parc QRDR parc-f CTTTATTCTATGAATAAGGAT - (forward primer) AGCAATACT parc-r GCAGGAGGATCTCCGTC 0- (reverse primer) parc-p CGATTTTTCCAGTTCTGTGAC - (anchor probe) ATACGAACCAT - fluorescein Ser Tyr parc-p LC Red 0-0- TCT TAT (sensor probe) CATCATAGATAGAAGAATCC (--) CCGTGTGG- phosphate Asp Ala GAT GCT -0- Oligonucleotide concentrations 0. µm 0. µm µm 0. µm 0. µm Amplification and melting Both reactions using mm Mg + 0 cycles: C - s 0 C - s C - s melting: C - s C - s Ramp to C 0. C.s -

13 FIG.. Representative melting peaks. Top, gyra: the vertical bar shows the melting peak of wild types, all melting peaks below are mutants. Shown are SerPhe and SerTyr mutants. Bottom, parc: melting peaks showing the clear distinction between wild types and various Asp and Ser mutants. wt stand for wild type, DG stands for AspGly.

University Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai Japan

University Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai Japan AAC Accepts, published online ahead of print on 1 May 009 Antimicrob. Agents Chemother. doi:10.11/aac.0016-09 Copyright 009, American Society for Microbiology and/or the Listed Authors/Institutions. All