p53 exon 8 mutations tested for enrichment via COLD-PCR 210 bp 210 bp 87 bp 87 bp Kras codons 12/13 mutations tested for enrichment via COLD-PCR

Transcription

1 21 bp 21 bp 167 bp 87 bp 87 bp 167 bp T m ( o C) p53 exon 8 mutations tested for enrichment via a bck d e f g h i j del 3-7bp Kras codons 12/13 mutations tested for enrichment via a. MDA-MB435: G>A b. CT7: C>T c. SW48: G>A, A>G d. FFPE1: C>T e. MDA-MB231: G>A f. HCC17: G>C g. PC3: C>T h. HCC2218: C>T, T>C AND 3 or 7 bp del i BT474: G>A J TL74: G>T K DU145: G>T 98 bp CODON bp T m ( o C) GGT GGC a b c a. A549: G>A, A>G CALUI: G>T b. PL45: G>A SW48: G>T, T>G RPMI8226 G>C c. HCT116: G>A EGFR exon 19 deletions tested for enrichment via 119 bp 119 bp T m ( o C) CTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCGCTATCAAGGAATTAAGAGAAGCAACATCTCC del 5-15 bp Figure 1, Supplementary Data Range of mutations and deletions in p53, Kras and EGFR gene segments, used for validation of. The melting temperature profile for each sequence, calculated based on the Poland algorithm as we reported previously 9, is also depicted.

2 full Fluorescence fast F 24 2 A G>A A RFLP discrimination between w. type and mutant alleles Kras codon 12, PspGI enzyme 1:1 CALUI G>T RFLP discrimination between G (w. type) and A (mutant) alleles Nla-III enzyme digests only mutant allele -p53 exon 8 G>A A MUTATION D MUTATION 1:33 1:1 1:1 1:33 REGULAR-PCR 1:1 REGULAR-PCR NO MUTATION enrichment =11-fold Pl45 G>A w. type DNA only WILD TYPE SW48 DNA :w. type=1:25 1:1 1:33 1: :1 1: B RFLP discrimination between C (w. type) and T (mutant) alleles 5 HhaI enzyme digests only w. type allele -p53 exon 8 C>T enrichment=8-fold HCC2218 DNA:w. type=1:25 MUTATION REGULAR-PCR RFLP discrimination between w. type and mutant alleles: Kras and p53 mutations that increase or retain amplicon Tm A>G increases Tm REGULAR -PCR T>G increases Tm REGULAR 8 -PCR REGULAR -PCR G>C retains Tm T>C increases Tm G REGULAR-PCR DIRECTLY FROM GENOMIC DNA HCC2218 DNA C>T mutation :w. type=1:25 fast Mutation Enrichment =22-fold G>A mutation Mutation Enrichment fast =11.8-fold PC3 DNA :w. type=1:25 Mutation Enrichment =12-fold full SW48 DNA :w. type=1:25 C>T mutation fast dhplc RETENTION TIME (min) 8 4 RFLP discrimination between G (w. type) and A (mutant) alleles C HpyCH4IV enzyme digests only mutant allele -Kras exon 2 G>A G > A Enrichment = 7-fold Regular PCR Enrichment = 6-fold Mutation position HCT116 DNA :w. type=1:1 HCT116 DNA :w. type=1: E SurveyorTM nuclease-based digestion of mismatches 5 G>T MUTATION C>T MUTATION DU145 DNA: w. type=1:25 CT7 DNA: w. type=1: H Multiplex Enrichment of three p53 exon 8 MUTATIONS directly from genomic DNA C>T mutation G>A mutation C>T mutation Supplementary Figure 2

3 Legend for Supplementary Fig. 2. Improvement of enzymatic mutation detection via. A. Restriction enzyme-based (RFLP) discrimination between G (wild-type) and A (mutant) p53 exon 8. DNA from colon cancer cell line SW48 (homozygous G>A in p53 exon 8) was 1:25 diluted in wild-type DNA and amplified via full at Critical Denaturation Temperature Tc=83.5 o C to obtain a 87 bp PCR product. RFLP was performed using Nla-III enzyme, which digests only the mutant A-allele, and the products were examined via high precision liquid chromatography (dhplc). A parallel experiment using was performed for comparison. The inset is a magnification of the digestion region. The mutation enrichment (~11-fold) was calculated as the ratio of the areas under the digestion peaks obtained via versus. The wild-type samples alone demonstrated no Nla-III digestion following either or. B. RFLP discrimination between C (wild-type) and T (mutant) of p53 exon 8 using DNA from cell line HCC2218 (homozygous C>T in p53 exon 8) diluted 1:25-fold in wild-type DNA. The design of the experiment is identical to the one depicted in Frame A, with the difference that the restriction enzyme used (HhaI) digests selectively the wild-type DNA, and not the mutant. Following HhaI digestion, the presence of the mutation can be seen as a dhplc peak at retention time=8.2 minutes. Full- results to a much higher mutant peak, compared to, indicating an 8-fold mutation enrichment. C. RFLP discrimination between G (wild-type) and A (mutant) of Kras codon 13, exon 1. DNA from colon cancer cell line HCT116 (GGC>GAC in Kras codon 13) was diluted 1:25 and 1:1-fold in wild-type DNA and amplified via full (Tc=8 o C) to obtain a 98 bp PCR product. RFLP was performed with HpyCH4IV, which digests only the mutant A allele. Regular-PCR was performed in parallel, for comparison. D. RFLP-based discrimination between wild-type and mutant alleles of Kras and p53 mutations that increase or retain amplicon Tm. The experimental approach is similar to the one described in Frame A. A>G: Wild-type DNA 1:25 diluted in homozygous sw48 DNA, Nla-III enzyme used to digest majority A-allele. G>C: Kras codon 12 heterozygous mutant RPMI8226 DNA 1:25 diluted in wildtype DNA, PspGI used to digest majority G-allele. T>G: Wild-type DNA 1:25 diluted in sw48 DNA (Kras codon 12 homozygous GGT>GTT), PspGI used to digest minority G-allele. T>C: Wild-type DNA 1:25 diluted in p53 exon 8 mutant HCC2218 (homozygous C>T) HhaI used to digest minority C allele. Therefore for all mutations tested, full enriches the minority alleles. E. Surveyor nucleasebased detection of unknown mutations. DNA from mutation-containing cell line DU145 (14489 G>T p53 exon 8) or from colon tumor CT7 DNA (14486 C>T) were 1:25 diluted in wild-type DNA, amplified via full. Amplicons were denatured, slowly cooled, digested with Surveyor nuclease and examined via dhplc. The insets show a magnification of the digestion regions. Full resulted to highly increased digestion by the unknown-mutation scanning enzyme, Surveyor compared to regular- PCR. F. RFLP discrimination between wild-type and mutant alleles of Kras codon 12 following fast. Kras codon 12 mutation-containing cell lines (A549 GGT>AGT; PL45 GGT>GAT; CALUI GGT>TGT) were 1:1 or 1:33 diluted in wild-type DNA and amplified with fast COLD PCR (Tc=8 o C) to obtain a 98 bp PCR product. RFLP was performed with PspGI enzyme, which digests only the wild-type Kras codon 12. G. performed directly from genomic DNA (as opposed to nested-pcr format, that was applied in Frames A-F), followed by RFLP. DNA from p53 exon 8 mutation-containing cell lines HCC2218 (C>T), sw48 (G>A) and PC3 (C>T) was 1:25 diluted in wild-type DNA and amplified directly from genomic DNA using fast COLD PCR (Tc=83.5 o C) or to obtain a 87 bp PCR product. Full was also peformed directly from genomic DNA for HCC2218 DNA, for a direct comparison with fast. RFLP discrimination of mutant and wild-type was performed with HhaI (HCC2218), NlaIII (SW48), and HpaII (PC3). High mutation enrichments (11-22-fold) are obtained following both fast and full. Enrichment by fast is more pronounced. H. Multiplex enrichment of three p53 exon 8 mutations in a single amplicon, directly from genomic DNA. A mixture of 5% HCC2218, 5% sw48, 5% PC3 and 85% wild-type genomic DNA was used to perform fast or directly from genomic DNA and to obtain a 87 bp PCR product. RFLP was performed as described in frame G. Fast resulted to simultaneous enrichment of all 3 mutations, directly from genomic DNA.

4 COLD PCR of an 87 bp p53 exon 8 sequence A Dilution 1:33 HCC2218 into w. type DNA: T mutation becomes more prevalent than C wild type Dilution 1:33 SW48 into w. type DNA: T mutation becomes more prevalent than C wild type Enrichment vs. sequence size Dilution 1:1 SW48 into w. type 87 bp sequence, Tc=83.5 o C Mutant allele A becomes more prevalent than wild type allele G 167 bp sequence Tc=86.5 o C Mutant allele A becomes somewhat more prevalent than wild type allele G B Dilution 1:1 SW48 into w. type DNA: T mutation becomes clearly visible ( heterozygous C T) 21 bp sequence, Tc=87.5 o C Mutant allele A becomes almost equal to wild type allele G Supplementary fig 3 Improvement of Sanger di-deoxy-sequencing via : influence of amplicon size. A. Sanger sequencing of an 87 bp product (Tc=83.5oC) from p53 exon 8. products from a 1:33 dilution of HCC2218 DNA into wild-type DNA, or 1:33 and 1:1 SW48 DNA into wild-type DNA was sequenced using the forward or reverse primer. Mutation enrichments of ~3-5-fold were obtained. B. was performed using DNA from SW48 cells, 1:1 diluted in wild-type DNA, for different amplicon sizes. 87bp (Tc=83.5oC); 167bp (Tc=86.5oC); and 21bp (Tc=87.5oC). The mutation enrichment is clearly evident for all DNA fragments, but is more pronounced for the smaller sizes.

5 94 o C Regular PCR 98 bp Kras seq. COLD - PCR Dilution 1:1 A549 (homozyg.) into w. type GGT AGT Mutation NOT visible Dilution 1:1 A549 into w. type GGT AGT Mutation VISIBLE ~5% mutation 1% mutation Dilution 1:33 A549 into w. type GGT AGT Mutation VISIBLE ~4% mutation Dilution 1:1 PL45 (heterozyg.) into w. type Dilution 1:1 PL45 (heterozyg.) into w. type GGT GAT Mutation VISIBLE GGT GAT Mutation NOT visible ~25% mutation ~5% mutation Dilution 1:1 CALU I (heterozyg.) into w. type GGT TGT Mutation NOT visible ~5% mutation Dilution 1:33 PL45 (heterozyg.) into w. type GGT GAT Mutation VISIBLE ~15% mutation Dilution 1:1 CALU I (heterozyg.) into w. type GGT TGT Mutation VISIBLE ~25% mutation Dilution 1:1 HCT116 (heterozyg.) into w. type ~5% GGC GAC mutation NOT visible Dilution 1:1 HCT116 (heterozyg.) into w. type ~5% GGC GAC mutation VISIBLE Supplementary data figure 4 Wild type: NO mutation Improvement of Sanger di-deoxy-terminator sequencing via : Mutation detection in Kras codons 12 and 13. DNA from Kras codon 12 mutant cell lines A549, PL45, CALUI and codon 13 mutant HCT116, 1:1 and 1:33 diluted into wild-type DNA was amplified via (98 bp fragment, Tc=8oC). For comparison, the same samples were amplified via. The reverse primer was used for Sanger di-deoxy-terminator sequencing. Mutations that are not visible on the sequencing chromatograms following become readily visible following. Wild-type samples indicate no mutations with either PCR.

6 EXAMPLES OF LOW-LEVEL MUTATIONS IN PLASMA AND FFPE CLINICAL SAMPLES, PREVIOUSLY INVISIBLE VIA SANGER DI-DEOXY-SEQUENCING, THAT BECOME DETECTABLE VIA COLD PCR Detection of p53 mutations in DNA from plasma of a radiation therapy patient REGULAR PCR 87 bp fragment Patient 6-87bp-reverse Mutation is not visible COLD PCR Patient 6-87bp-reverse G A mutation visible INDEPENDENT CONFIRMATION (REMS/RFLP ASSAY) Detection of p53 mutations in a clinical FFPE sample from lung NSCLC patient 167 bp fragment C T Mutation barely visible C T Mutation clearly visible (note: T becomes stronger than C) REGULAR-PCR COLD PCR Detection of Kras mutations in clinical FFPE sample from lung NSCLC patient GGT GAT Mutation not visible 98 bp fragment GGT GAT Mutation visible REGULAR-PCR Supplementary Figure 5 COLD PCR INDEPENDENT CONFIRMATION (REMS/RFLP ASSAY) Sanger sequencing of clinical samples: a 167 bp fragment from p53 exon 8, or of a 98 bp fragment from Kras from plasma-circulating DNA or from formalin-fixed lung tumor specimens, following or. Somatic mutations that were not visible using become clearly visible following. Independent verification of the low-prevalence somatic mutations in these clinical samples was done via RFLP-PCR as described 9

7 C O L D - P C R - M A L D I - T O F R E S U L T S A N D C O M P A R I S O N T O R E G U L A R P C R - M A L D I - T O F p 5 3 m u t a t i o n s % m u t a n t o r w. t y p e a l l e l e f o r v a r i o u s p 5 3 e x o n 8 m u t a t i o n s a r e i n d i c a t e d M A L D I - T O F R E S U L T p 5 3 e x o n 8 m u t a t i o n = G > A C O L D - P C R C E L L L I N E D I L U T I O N S S C R E E N E D % A m u t a n t % G w. t y p e E N R I C H M E N T S W w. t y p e r a t io 1 : 5 r e g u la r P C R N / A S W w. t y p e r a t io 1 : 1 r e g u la r P C R 5 ( M a s s S p e c lim it ) 9 5 N / A S W w. t y p e r a t io 1 : 3 3 r e g u la r P C R 1 N / A S W w. t y p e r a t i o 1 : 1 C O L D - P C R S W w. t y p e r a t i o 1 : 1 C O L D - P C R > 1 S W w. t y p e r a t i o 1 : 2 C O L D - P C R ~ 4 S W w. t y p e r a t i o 1 : 3 C O L D - P C R S W w. t y p e r a t i o 1 : 1 C O L D - P C R > 1 W I L D T Y P E O N L Y, C O L D - P C R 1 N o n e M A L D I - T O F R E S U L T p 5 3 e x o n 8 m u t a t i o n = C > T C O L D - P C R C E L L L I N E D I L U T I O N S S C R E E N E D % T m u t a n t % C w. t y p e E N R I C H M E N T C T 7 - w. t y p e r a t io 1 : 5 r e g u la r P C R N / A C T 7 - w. t y p e r a t io 1 : 1 r e g u la r P C R N / A C T 7 - w. t y p e r a t io 1 : 3 3 r e g u la r P C R 5 ( M a s s S p e c lim it ) 9 5 N / A C T 7 - w. t y p e r a t i o 1 : 1 C O L D - P C R ~ 1 8 C T 7 - w. t y p e r a t i o 1 : 2 C O L D - P C R ~ 4 C T 7 - w. t y p e r a t i o 1 : 3 C O L D - P C R ~ 6 C T 7 - w. t y p e r a t i o 1 : 1 C O L D - P C R 1 u n d e t e c t a b l e W I L D T Y P E O N L Y, C O L D - P C R 1 N o n e M A L D I - T O F R E S U L T p 5 3 e x o n 8 m u t a t i o n = G > T C O L D - P C R C E L L L I N E D I L U T I O N S S C R E E N E D % T m u t a n t % G w. t y p e E N R I C H M E N T D U w. t y p e r a t io 1 : 5 r e g u la r P C R 2 8 N / A D U w. t y p e r a t io 1 : 1 r e g u la r P C R N / A D U w. t y p e r a t io 1 : 3 3 r e g u la r P C R N / A D U w. t y p e r a t i o 1 : 3 3 C O L D - P C R ~ 9 D U w. t y p e r a t i o 1 : 1 C O L D - P C R ~ 2 D U w. t y p e r a t i o 1 : 2 C O L D - P C R ~ 4 D U w. t y p e r a t i o 1 : 3 C O L D - P C R 1 u n d e t e c t a b l e W I L D T Y P E O N L Y, C O L D - P C R 1 N o n e M A L D I - T O F R E S U L T p 5 3 e x o n 8 m u t a t i o n = C > T C O L D - P C R C E L L L I N E D I L U T I O N S S C R E E N E D % T m u t a n t % C w. t y p e E N R I C H M E N T H C C w. t y p e r a t io 1 : 1 r e g u la r P C R N / A H C C w. t y p e r a t io 1 : 3 3 r e g u la r P C R 1 N / A H C C w. t y p e r a t i o 1 : 1 C O L D - P C R ~ 5 H C C w. t y p e r a t i o 1 : 3 3 C O L D - P C R ~ 1 H C C w. t y p e r a t i o 1 : 1 C O L D - P C R ~ 1 7 H C C w. t y p e r a t i o 1 : 2 C O L D - P C R H C C w. t y p e r a t i o 1 : 3 C O L D - P C R 1 u n d e t e c t a b l e W I L D T Y P E O N L Y, C O L D - P C R 1 N o n e p 5 3 e x o n 8 m u t a t i o n = G > A C O L D - P C R C L I N I C A L S A M P L E S % A m u t a n t % G w. t y p e E N R I C H M E N T T L 6 4 ( lu n g t u m o r s a m p le ) r e g u la r P C R N / A T L 6 4 ( l u n g t u m o r s a m p l e ) C O L D P C R ~ 1 1 p la s m a - c ir c u la t in g D N A r e g u la r P C R N / A p l a s m a - c i r c u l a t i n g D N A C O L D P C R ~ 1 8 Supplementary Fig. 6. Summary of mutation enrichments obtained following -MALDI-TOF: p53 codon 273 mutation and Kras codons 12/13. Enrichments of up to 1-fold were obtained via. The enrichment is more pronounced for samples that contain the lowest mutant-to-wild-type ratios.

8 A Wild type HCC827:WT=1:5-REGULAR PCR (EGFR deletion not detectable) HCC827:WT=1:5-full- Deletion detectable Mix of del and w. type HCC827:WT=1:3-full- Deletion detecable 2-rounds full- Supplementary Figure 7 Mix of del and w. type deletion is isolated by FLUORESCENCE C B fast- d H P L C fo llo w in g fa st C O L D -P C R p 5 3 d e le tio n m u ta n t d ilu te d in to w ild typ e D N A D e l:w t= 1 :3 -F A S T C O L D P C R D E L E T IO N D E T E C T A B L E (com plete isolation) D e l:w t= 1 :1 -F A S T C O L D P C R D E L E T IO N D E T E C T A B L E (com plete isolation ) 7 b p d e l m u ta n t R egular P C R W IL D -TYP E D e l:w t= 1 :2 5 -fa st C O L D P C R D E L E T IO N D E T E C T A B L E (com plete isolation ) D e l:w t= 1 :2 5 -re g u la r P C R (D E L E T IO N N O T D E T E C T A B L E ) d H P L C R E T E N T IO N T IM E (m in ) Sequencing following fast- 7 bp deletion Del:wt=1:25 Del:wt=1:1 Del:wt=1:3 Selection of EGFR and p53 micro-deletions via. A. Enrichment of EGFR exon 19 micro-deletions via full (Tc=8oC). DNA from cell line HCC827 (EGFR exon 19 micro-deletion) was diluted in wild-type DNA (5 -TATCAAGgaattaagagaagcaACATCTCCG-3, the underlined nucleotides represents 15 bp deletion of HCC827), amplified via full COLD PCR and sequenced. The deletion was not detectable when wild-type DNA was used or in a 1:5 dilution of mutant to wild-type DNA following (Frames A1 and A2 respectively), but was clearly detectable following full (Frame A3). The HCC827 deletion was also clearly detectable in a 1:3 dilution of mutant into wild-type DNA following two rounds of full. The data indicate the ability to increase the enrichment obtained by consecutive rounds. B and C. Isolation of a 7 bp p53 deletion from wild-type using fast COLD PCR (Tc=83.5oC). A 7 bp p53 exon 8 deletion mutant (see also Supplementary Fig. 1 for the position of this deletion on the GC-rich region of exon 8) was diluted into wild-type DNA at ratios of 1:25, 1:1 and 1:3, amplified using fast to obtain a 87bp PCR product and examined via dhplc or direct sequencing. Fast lead to an exclusive amplification and isolation of the deletion mutant, at dilutions down to 1:3, mutant-to-wild-type ratio. The sequencing data in frame C show exclusively the anticipated sequence of the deletion mutant at all dilutions tested, and the wild-type sequence is not visible.

9 fast : ISOLATION OF 3 bp DELETION IN p53 EXON 8 Del:wt=1:1- Regular PCR 3bp del region Del:wt=1:1 Deletion isolated Cold-PCR Del:wt=1:25 Deletion isolated Supplementary figure 8 Exclusive amplification of 3 bp deletion-containing DNA from wild-type DNA using fast. 3 bp del of p53 exon 8 diluted in wild-type DNA at ratio 1:1 and 1:25 was amplified using fast (Tc=83.5oC) to obtain an 87 bp PCR product, which was then sequenced. Sequencing demonstrated that deletion-containing DNA was exclusively amplified. Regular-PCR of the 1:1 dilution followed by sequencing could not identify this 3 bp deletion.

10 Supplementary Table I: Summary of COLD PCR primers. Sequence Name Primers Product Tc Size P53 exon 8 A1-Forwad: TGGTAATCTACTGGGACG 87 bp 83.5 C P53 exon 8 P53 exon 8 Kras exon 1 EGFR exon 19 A2-Reverse: CGGAGATTCTCTTCCTCT A3-Forwad: GCTTCTCTTTTCCTATCCTG A4-Reverse: CTTACCTCGCTTAGTGCT A5-Forwad: GCTTCTCTTTTCCTATCCTG A6-Reverse: TAACTGCACCCTTGGTC A7-Forwad: ACTTGTGGTAGTTGGACCT A8-Reverse: CCTCTATTGTTGGATCATATT A9-Forwad: TGCCAGTTAACGTCTTCCT A1-Reverse: GGATTTCCTTGTTGGCTTT 167 bp 86.5 C 21 bp 87.5 C 98 bp 8 C 129 bp 8 C