Supplementary Table I: List of primers used for qpcr

Size: px
Start display at page:

Download "Supplementary Table I: List of primers used for qpcr"

Transcription

1 Supplementary Table I: List of primers used for qpcr Primer ABCG2 F ABCG2 R β Actin F β Actin R ALDH1A1 F ALDH1A1 R ALDH1A1 promoter F ALDH1A1 promoter R CD24 F CD24 R CD44 F CD44 R CXCR1 F CXCR1 R CXCR4 F CXCR4 R E Cad F E Cad R EGFR F EGFR R GAPDH F GAPDH R N Cad F N Cad R NOTCH4 F NOTCH4 R OCT4 F OCT4 R Snail1 F Snail1 R Snail2 F Snail2 R TGFB2 F TGFB2 R Twist F Twist R Vimentin F Vimentin R Sequence AGCTCAGATCATTGTCACAGTCGT GAACCCCAGCTCTGTTCTGG CATCCACGAAACTACCTTCAACTCC GAGCCGCCGATCCACAC GGAGTCACTCAAGGCCCTCAG GGCCTCCTCCACATTCCAG TTCTGATTCGGCTCCTGG TTGCTCTGAGTTTGTTCATCC CCCAAATCCAACTAATGCCAC AGAGTAGAGATGCAGAAGAGAG ATCAGATGGACACTCACATGGGAG ATGCCAAGATGATCAGCCATTCT TGGCCGGTGCTTCAGTTAG CATGTCCTCTTCAGTTTCAGCAAT ACGGACAAGTACAGGCTGCAC CCCAGAAGGGAAGCGTGA TACGCCTGGGACTCCACCTA CCAGAAACGGAGGCCTGAT GCTCTACAACCCCACCACGTA ACGCACGAGCCGTGATCT ACCCACTCCTCCACCTTTGAC CATACCAGGAAATGAGCTTGACAA TCAAAGCCTGGAACATATGTGATG GTATACTGTTGCACTTTTTCTCGTACAA GCCCCTCTGGTTTCACAGG AGTTGGCCTTGTCTTTCTGGTC CCTGCACCGTCACCCCT GGCTGAATACCTTCCCAAATAGAAC ATGCCGCGCTCTTTCCT GCTGGAAGGTAAACTCTGGATTAGA GGCTGGCCAAACATAAGCA GCTTCTCCCCCGTGTGAGT CGTCTCAGCAATGGAGAAGAATG CGCTGGGTTGGAGATGTTAAA GCAGGGCCGGAGACCTAG TTTTTAGTTATCCAGCTCCAGAGTCTCTA CTCCGGGAGAAATTGCAGG AGACGTGCCAGAGACGCATT

2 SUPPLEMENTARY FIGURES Supplementary figure 1: CSC subpopulation reaches stable percentage overtime. MCF7 and HCT116 tdtomato + cells were sorted by FACS and cultured during 14 passages and up to 200,000 cells. The percentage of tdtomato + cells was progressively restored to the initial percentage found in MCF7 (A) and HCT116 (B) cell lines before sorting. (C) Once the percentage of tdtomato+ cells (CSC) is restored it remains stable in culture in successive rounds of isolation and culture, reproducing the original cell line. FACS images obtained every 3 passages are shown.

3 Supplementary figure 2: HCT116-ALDH1A1/tdTomato CSC model. (A) Expression of tdtomato in colon HCT116 cancer cells after transfection with the reporter vector ALDH1A1/tdTomato. (B) CSC quantification and sorting by FACS showed positive tdtomato expression in 12.31±0.72 % of cell population. (C) Expression of stemness markers in tdtomato + cells (CSC) by q-pcr showed overexpression of ALDH1, ABCG2, CD44, CXCR4 and PUF5F1 with a respective fold change of 2.61 ± 0.42, 1.47 ± 0.10, 1.33 ± 0.08, 1.66 ± 0.25 and 2.33 ± 0.36 compared to tdtomato- cells (non-csc). At least three biological replicates are reported as mean±sem. Differences were regarded as statistically significant (unpaired Student's t-test) when p-values were smaller than 0.05 (*) and 0.01 (**).

4 Supplementary figure 3: Expression levels of CD44 and EGFR in tumor cell lines. (A) Expression of CD44 by qpcr in various breast cancer cell lines. (B) Expression of EGFR in various colon cancer cell lines. The expression levels of CD44 and EGFR from SKBR3 and MCF7 cell lines were respectively used as reference controls. At the protein level, the expression of CD44 (C) and EGFR (D) was confirmed in CSC sorted from MCF7 and HCT116 cell lines, by immunostaining and flow cytometry.

5 Supplementary figure S4: Storage stability of PTX micelles. (A) The stability of PTX in PLGA-co-PEG micelles at room temperature was controlled overtime. The initial concentration of PTX (day 0) remained constant until day 7 (14.3 ± 0.37μg/mL). At day 21, the amount of PTX was reduced to 12.4 ± 0.15 μg/ml (87% of the initial amount). After 30 days, the total amount of drug dropped to 84% (10.22 ± 0.11 µg/ml) and then remained constant for 60 days. (B) TEM micrographs showed monodisperse micelles with a spherical shape.

6 SUPPORTING INFORMATION Information S1: Cell cultures MDA-MB-231, HCT116 and HCT8 cells were cultured in RPMI medium (Lonza) supplemented with 10% FBS (Lonza), 6mM L-Glutamine (Lonza), 0,1 mm Non Essential Amino acids (NEAA) (Lonza) and and 1% penicillin-streptomycin. MCF7 cells were cultured in DMEM F12 complete medium (Life Technologies) supplemented with a 10% of fetal bovine serum (FBS) (Lonza) and 1% penicillin-streptomycin. Blasticidin (10 µg/ml) (Life Technologies) was used as a selective antibiotic for ALDH1A1/tdTomato cell lines. All cell lines were maintained in atmosphere with 5% of CO2 at 37ºC. MCF7 cells were cultured as mamospheres in serum-free media containing DMEM F12 (Life Technologies), 30% of glucose (Sigma), 20 μg /ml of human recombinant EGF (Sigma-Aldrich), 10 μg/ml human recombinant bfgf (BD Biosciences), 1% penicillin-streptomycin (Life Technologies), 1% L-GlutaMAX (Sigma), 100 mg/ml Heparin (Sigma) and 10% Hormone Mix (Glucosis, Putrescin, Apo-transferrin, Insulin, Selen, Progesterone) in Ultra-Low attachment surface plates (Cultec). Information S2: Fluorescence-Activated Cell Sorting (FACS) In order to sort the tdtomato + CSC, MCF7-ALDH1A1/tdTomato and HCT116- ALDH1A1/tdTomato cells were washed with PBS (Lonza) and trypsinized with 1X trypsin- EDTA (Life Technologies). Then they were resuspended in PBS +10%FBS, and DAPI was added to marked non-viable cells. First, cell debris and doublets were removed by forward and side scatter gating and just alive cells (DAPI negative cells) were admitted for sorting. TdTomato

7 fluorescence was detected through the CYG-A channel and sorted using the cytometer FACSAria (BD Biosciences). Information S3: Flow cytometry The amount of tdtomato + cells in continuous culture was assessed by flow cytometry using Fortessa instrument (BD Biosciences). First, cell debris and doublets were removed by forward and side scatter gating and just alive cells (DAPI negative cells) were evaluated. tdtomato fluorescence was detected through the EYG-A channel. For each sample, at least 10,000 individual cells were collected and the mean fluorescence intensity was evaluated. To assess the therapeutic effect of naked PTX or PTX loaded in micelles on CSC, cells were seeded in different quantity for 24 h to allow adhesion. For control samples, treated with vehicle or empty nanoparticle, cells were seeded and for samples treated with PTX and targeted / non-targeted PLGA-co-PEG nanoparicles cells were seeded. Cells were then treated for 72 h and let to recover in complete medium for 48 h subsequently. Cells were trypsinised and tdtomato fluorescence was detected by Fortessa (BD Biosciences) as described above. To ensure the therapeutic effect of the treatments, the cell proliferation and cell viability was controlled during all the experiment. Proliferation and viability of cells was assessed by Trypan Blue exclusion and cell counting with the automated cell counter (Countess). At least three biological replicates, each involving at least two technical replicates were involved in final results expressed as the mean±sem. Statistical analysis was performed using the unpaired Student's t-test. Differences were regarded as statistically significant when p-value were smaller than 0.05.

8 For internalization study, cells were seeded in complete medium in for 24 h to allow adhesion. 500 μg/ml micelles were added to samples at different time points: 3, 10, 30, 60, 120 min or over-night (O/N) depending on the experiment. Then, cells trypsinized and resuspended in PBS supplemented with 10% FBS and analyzed by FACSCalibur system (BD Biosciences). For each sample, at least 10,000 individual cells were collected and the mean fluorescence intensity was evaluated. Information S4: Real time quantitative PCR Total RNA was extracted from cells using RNeasy Mini Kit (Qiagen) and obtained RNA was reverse transcribed with High Capacity cdna Reverse Transcripton Kit (Applied Biosystems) according to the manufacturer's instructions. The cdna was amplified with specific primers (Table S1) by qpcr using SYBR Green on a 7500 Real Time PCR System (Applied Biosystems). Transcriptional quantification relative to both, Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) and actin housekeeping genes (Table S1) was performed using Qbase software, based on the ΔΔCt method, calculating relative normalized quantities (NRQ) of mrna expression (26). At least three biological replicates, each involving at least two technical replicates were involved in final results expressed as the mean±sem. Statistical analysis was performed using the unpaired Student's t-test. Differences were regarded as statistically significant when p-value were smaller than 0.05 Information S5: Mammospheres forming assay Cells were seeded in 6-well ultra-low attachment plates at low density (10,000 cells/well) in serum free medium and were treated with the naked PTX or targeted/no-targeted PLGA-co-PEG

9 micelles. After 72 h of incubation the medium was replaced by new drug- free medium and mammospheres were formed within additional 5 days. When they were 60 nm of size, mammospheres were transferred into complete medium with FBS in conventional cell dish. After attached colonies visible to the unarmed eye were formed, cells were fixed with methanol: acid acetic (3:1) and stained with 0.1% crystal violet. At least three biological replicates, each involving at least two technical replicates were involved in final results expressed as the mean±sem. Statistical analysis was performed using the unpaired Student's t-test. Differences were regarded as statistically significant when p-value were smaller than 0.05 Information S6: In vivo tumorigenic capacity assay Female NOD.CB17-Prkdc scid/j mice (Charles River, Barcelona, Spain) were kept in pathogenfree conditions and used at 6 weeks of age. Animal care was handled in accordance with the Guide for the Care and Use of Laboratory Animals of the Vall Hebron University Hospital Animal Facility, and the experimental procedures were approved by the Animal Experimentation Ethical Committee at the institution. MCF7.Fluc2-ALDH1A1/tdTomato + (CSC) and MCF7.Fluc2-ALDH1A1/tdTomato - (Non-CSC) at 10,000, 1,000 and 100 cells in 50 µl sterile PBS:Matrigel (1:1) were inoculated orthotopically into the right mammary fad pad (i.m.f.p.). Tumor growth was monitored twice a week by conventional caliper measurements (D d 2 /2, where D is the major diameter and d the minor diameter). At the end of the experiment, animals were euthanized by cervical dislocation and subjected to gross necropsy. Tumors were collected and analyzed by ex vivo bioluminescence imaging (BLI) to determine tumor bioluminescence intensities. Ex vivo BLI was performed using the IVIS Spectrum Imaging System, and images and measurements of bioluminescent signal

10 were acquired and analyzed using Living Image software (PerkinElmer Life Science, Inc., Boston, MA, USA). All in vivo experiments were performed at the Molecular Imaging Platform (PIM) of the CIBER- BBN In Vivo Experimental Platform located at Vall d Hebron Research Institute (VHIR) (Barcelona, Spain) Information 7: Confocal microscopy Cells were cultured in glass slides coated with gelatin in for 24 h to allow adhesion. Then, cells were incubated 2 h with nanoparticles (500 μg/ml) and lysosomes were stained with Lysotracker red DND-99 (Life Technologies). Cells were then fixed in 4% paraformaldehyde followed by DAPI nuclei staining. Cells were viewed under a Spectral Confocal Microscope MFV1000 (Olympus). Minimal single optical sections were collected for each fluorochrome sequentially and analyzed with the FV10-ASW 3.1 Viewer software (Olympus). Information 8: MTT cell viability assays 5000 cells/well were seeded in 96-well in microtiter plate and after they attached, they were incubated in the presence or absence of increasing concentrations of unloaded nanoconjugates, drug-loaded nanoconjugates, standard solution of PTX and vehicle control for 72 h. After the incubation, 0.5 mg/ml 3-(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) was added to each well. Plates were incubated for an additional 4 h at 37ºC and 180 μl of Dimethyl sulfoxide (DMSO) (Sigma) was added to each well. The absorbance at 580 nm of each well was read on a microplate reader. Cell viability was calculated a minimum of 3 biological replicates with 6 technical replicates for each assay. Final results are expressed as the

11 mean±sem. Statistical analysis was performed using the unpaired Student's t-test. Differences were regarded as statistically significant when p-value were smaller than 0.05.

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System

Plasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,

More information

Isolation, culture, and transfection of primary mammary epithelial organoids

Isolation, culture, and transfection of primary mammary epithelial organoids Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)

More information

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA

sirna Transfection Into Primary Neurons Using Fuse-It-siRNA sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative

More information

Supplemental Data. ALDH1 Is a Marker of Normal and Malignant. Human Mammary Stem Cells. and a Predictor of Poor Clinical Outcome

Supplemental Data. ALDH1 Is a Marker of Normal and Malignant. Human Mammary Stem Cells. and a Predictor of Poor Clinical Outcome Cell Stem Cell, Volume 1 Supplemental Data ALDH1 Is a Marker of Normal and Malignant Human Mammary Stem Cells and a Predictor of Poor Clinical Outcome Christophe Ginestier, Min Hee Hur, Emmanuelle Charafe-Jauffret,

More information

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications

Xeno-Free Systems for hesc & hipsc. Facilitating the shift from Stem Cell Research to Clinical Applications Xeno-Free Systems for hesc & hipsc Facilitating the shift from Stem Cell Research to Clinical Applications NutriStem Defined, xeno-free (XF), serum-free media (SFM) specially formulated for growth and

More information

Cignal Reporter Assay Handbook

Cignal Reporter Assay Handbook January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and

More information

Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1

Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1 Chapter - 9 IN VITRO CYTOTOXICITY ASSAY OF ZERUMBONE AND MDM3:1 9.1 INTRODUCTION 9.2 CHAPTER OBJECTIVE 9.3 MATERIALS AND METHODS 9.4 RESULT 9.5 DISCUSSION In Vitro Cytotoxicity Assay of Zerumbone and MDM

More information

Standard Operating Procedure

Standard Operating Procedure Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) Date finalised Document name Key words: Standard Operating Procedure (SOP) for TaqMan realtime Reverse Transcription

More information

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2

3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 3D Mammary Colony-Forming Cell Assay Giusy Tornillo 1* and Sara Cabodi 2 1 Cardiff School of Biosciences, European Cancer Stem Cell Research Institute, Cardiff University, Cardiff, UK; 2 Department of

More information

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011.

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011. Experimental: MTT assay: To determine cell viability the colorimetric MTT metabolic activity assay was used. Hela cells (1 10 4 cells/well) were cultured in a 96-well plate at 37 C, and exposed to varying

More information

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips)

ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming vector for generating induced pluripotent stem (ips) Kit for generating ips cells using ReproRNA -OKSGM, a non-integrating, self-replicating RNA reprogramming vector Product Description ReproRNA -OKSGM is a non-integrating, self-replicating RNA-based reprogramming

More information

LHCN-M2 cell culture, differentiation treatment, and cross-linking protocol.

LHCN-M2 cell culture, differentiation treatment, and cross-linking protocol. Cell Growth Protocol and Differentiation treatment for the LHCN-M2 Cell Line From: HudsonAlpha/Caltech ENCODE group Date: February 17, 2011 Prepared by: Chun-Hong Zhu and Woodring E. Wright (typed by Brian

More information

supplementary information

supplementary information DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /

More information

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5

Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation 5 Normalization of Agilent Seahorse XF Data by In-situ Cell Counting Using a BioTek Cytation Application Note Authors Yoonseok Kam 1, Ned Jastromb 1, Joe Clayton, Paul Held, and Brian P. Dranka 1 1 Agilent

More information

L6 Cell Growth Protocol

L6 Cell Growth Protocol L6 Cell Growth Protocol Background: Parental L6 cells were subcloned for high fusion (1, 2). Materials: 1. α-minimal Essential Medium (α-mem) Life Technologies #12571-063 2. Fetal Bovine Serum (FBS) Life

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Materials Chemistry Frontiers. This journal is the Partner Organisations 2017 Supporting Information Supramolecular Conjugated Polymer Materials for Organelle

More information

Developing a real-time fluorescence cell growth monitoring system

Developing a real-time fluorescence cell growth monitoring system - 65 - Developing a real-time fluorescence cell growth monitoring system Jo-Ting Wang 1, Chun-Han Lu 2, Yao-Nan Wang 2, Ko-Tung Chang 1,* 1 Department of Biological Science and Technology, National Pingtung

More information

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent

Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent APPLICATION NOTE Page 1 Transfection of Mouse ES Cells and Mouse ips cells using the Stemfect 2.0 -mesc Transfection Reagent Authors: Amelia L. Cianci 1, Xun Cheng 1 and Kerry P. Mahon 1,2 1 Stemgent Inc.,

More information

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well

To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at

More information

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using

Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using Supplementary Methods Real-time PCR. Total RNA was isolated from purified splenic or LP macrophages using the Qiagen RNeasy Mini Kit, according to the manufacturer s protocol with on-column DNase digestion

More information

Calcein AM Cell Viability Kit

Calcein AM Cell Viability Kit Instructions For Research Use Only. Not For Use In Diagnostic Procedures Calcein AM Cell Viability Kit Catalog# 4892-010-K 1000 Tests* * Calculated based on using 1 μm final concentration of Calcein AM;

More information

VZV Replication Assays Samantha J. Griffiths * and Jürgen Haas

VZV Replication Assays Samantha J. Griffiths * and Jürgen Haas VZV Replication Assays Samantha J. Griffiths * and Jürgen Haas Division of Pathway and Infection Medicine, University of Edinburgh, Edinburgh, UK *For correspondence: samantha.griffiths@ed.ac.uk [Abstract]

More information

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW)

Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Propagation of H7 hesc From: UW (John Stamatoyannopoulos) ENCODE group Date: 12/17/2009 Prepared By: S. Paige/S. Hansen (UW) Growth and Harvest Modifications Addendum to: Propagation of H7 hesc from UW

More information

Creating RAFT 3D Cell Cultures with Different Thicknesses and Different Cell Types

Creating RAFT 3D Cell Cultures with Different Thicknesses and Different Cell Types Bioscience Solutions Creating RAFT 3D Cell s with Different Thicknesses and Different Cell Types Sabine Schaepermeier 1, Lubna Hussain 2, Jenny Schroeder 1 1 Lonza Cologne GmbH, Cologne, Germany; 2 Lonza

More information

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on

Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on Supplemental Material Detailed Methods Cell culture and drug treatment. Lineage - Sca-1+ CD31+ EPCs were cultured on 5µg/mL human fibronectin coated plates in DMEM supplemented with 10% FBS and penicillin/streptomycin

More information

Amaxa Basic Neuron SCN Nucleofector Kit

Amaxa Basic Neuron SCN Nucleofector Kit Amaxa Basic Neuron SCN Nucleofector Kit For Primary Neural Cells (Small Cell Number) SCN Nucleofector Kits are compatible with Nucleofector ll Devices of serial version S with software version S4 4 or

More information

Confocal immunofluorescence microscopy

Confocal immunofluorescence microscopy Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,

More information

Supporting information

Supporting information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting information Near Infrared Light-responsive and Injectable Supramolecular Hydrogels for

More information

Cytotoxicity LDH Assay Kit-WST

Cytotoxicity LDH Assay Kit-WST Cytotoxicity LDH Assay Kit-WST Supplementary Information Notice to Users Preparation of Reagent This instruction complements the Technical Manual in the product. Please use this instruction as supplements

More information

Immunofluorescence Staining Protocol for 3 Well Chamber, removable

Immunofluorescence Staining Protocol for 3 Well Chamber, removable Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.

More information

Primary Mouse Embryonic Fibroblast Isolation Kit

Primary Mouse Embryonic Fibroblast Isolation Kit INSTRUCTIONS Primary Mouse Embryonic Fibroblast Isolation Kit 88279 Number Description Pub. No. MAN0016041 Rev A.0 Pub. Part No. 2162551.0 88279 Pierce Mouse Embryonic Fibroblast (MEF) Isolation Kit, contains

More information

Active targeting of the nucleus using non-peptidic boronate tags

Active targeting of the nucleus using non-peptidic boronate tags Supporting Information Active targeting of the nucleus using non-peptidic boronate tags Rui Tang 1, Ming Wang 2, Moumita Ray 1, Ying Jiang 1, Ziwen Jiang 1, Qiaobing Xu 2 *, Vincent M. Rotello 1 * 1 Department

More information

Accurate and Automated cell confluence assessment in microplates

Accurate and Automated cell confluence assessment in microplates Accurate and Automated cell confluence assessment in microplates TECAN S SPARK 20M MICROPLATE READER WITH INTEGRATED CELL IMAGING SIMPLIFIES CELL CULTURE QC AND SIGNAL NORMALIZATION TO CELL CONFLUENCE

More information

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618

Data Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618 Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop

More information

Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation

Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation Protocols for Hematopoietic Differentiation of Murine ES Cells (in 6 or 24 well plates) Media Preparation A) Embryonic Stem Cell Medium (ES) Dulbecco s modified Eagle s Medium (DMEM) with high glucose

More information

Xpert TM MTT Cell Assay Teaching Kit

Xpert TM MTT Cell Assay Teaching Kit Xpert TM MTT Cell Assay Teaching Kit Product Code: CCK020 Contents 1. Introduction 2. Applications 3. Kit contents and storage condition 4. Materials required but not provided in the kit 5. General guidelines

More information

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation

phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis Promega Corporation phab Amine and Thiol Reactive Dyes for Antibody Internalization Studies Nidhi Nath, Ph.D. Group Leader, Protein Analysis 1 Outline 1. phab Dyes 2. Protocols for conjugating phab Dyes to antibodies 3. Applications:

More information

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna

Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

Stem cell transfection guide

Stem cell transfection guide APPLICATION NOTE Stem cell transfection guide Gene delivery solutions Introduction Stem cells continue to show immense promise for the future of regenerative medicine and personalized therapeutic treatments.

More information

Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus

Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus G e n e C o p o eia TM Expressway to Discovery Lenti-Pac HIV Expression Packaging Kit For optimized production of recombinant lentivirus Cat. No. HPK-LvTR-20 (20 transfections) Cat. No. HPK-LvTR-40 (40

More information

Cortical Neural Induction Kit. Protocol version 1.0

Cortical Neural Induction Kit. Protocol version 1.0 Cortical Neural Induction Kit Protocol version 1.0 Protocol version 1.0 Table of Contents Product Information 2 Preparation of Reagents 3 Protocol Overview 4 Seeding ipscs 4 Cortical Neural Induction

More information

Supplementary File 3: DNA and RNA isolation

Supplementary File 3: DNA and RNA isolation Supplementary File 3: DNA and RNA isolation Q-CROC-02 Biopsy protocol For the purposes of this protocol, four needle core biopsies (NCBs) of lymph node tissue are isolated from each patient using a 16G

More information

A Novel Method for the Expansion of Mesenchymal Stem Cells using a New Brunswick S41i CO 2

A Novel Method for the Expansion of Mesenchymal Stem Cells using a New Brunswick S41i CO 2 APPLICATION NOTE No. 259 I September 2013 A Novel Method for the Expansion of Mesenchymal Stem Cells using a New Brunswick S41i CO 2 Incubator Shaker Khandaker Siddiquee and Ma Sha, Eppendorf Inc., Enfield,

More information

Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold

Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold Seeding, culturing and assaying upcyte and vericyte cells in the Mimetix 3D scaffold Description This note describes how to seed and culture upcyte Hepatocytes as 3D cultures in the Mimetix electrospun

More information

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang *

In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * In vivo BrdU Incorporation Assay for Murine Hematopioetic Stem Cells Ningfei An, Yubin Kang * Division of Hematology-Oncology, Department of Medicine, Medical University of South Carolina, Charleston,

More information

NTM486-04, NTM174-04,

NTM486-04, NTM174-04, Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.

More information

bfgf Supports Human ES Cell Self- Renewal

bfgf Supports Human ES Cell Self- Renewal APPLICATION NOTE Page 1 bfgf Supports Human ES Cell Self- Renewal Authors: Dongmei Wu, Wen Xiong, Yan Gao, Kristine Guerrero, Yi Chen, Liming Yang, Yang Liu, and Shuyuan Yao 1 Stemgent, Inc., 10575 Roselle

More information

T ECHNICAL MANUAL. Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium

T ECHNICAL MANUAL. Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium T ECHNICAL MANUAL Culture of Human Mesenchymal Stem Cells Using MesenCult -XF Medium i Table of Contents 1.0 Materials... 1 1.1 MesenCult -XF Medium and Required Products... 1 1.2 Additional Required

More information

LacZ beta Galactosidase Intracellular Detection Kit

LacZ beta Galactosidase Intracellular Detection Kit ab189816 LacZ beta Galactosidase Intracellular Detection Kit Instructions for Use For the detection of beta-galactosidase using Microplate or FACS Assay This product is for research use only and is not

More information

Growth and Maintenance of the 293A Cell Line

Growth and Maintenance of the 293A Cell Line Growth and Maintenance of the 293A Cell Line USER GUIDE Catalog Number R705-07 Publication Number MAN0000303 Revision A.0 For Research Use Only. Not for use in diagnostic procedures. The information in

More information

Human Pluripotent Stem Cell Functional Identification Kit

Human Pluripotent Stem Cell Functional Identification Kit Human Pluripotent Stem Cell Functional Identification Kit Catalog Number SC027B Reagents for the identification of human pluripotent stem cells by in vitro functional differentiation. This package insert

More information

Naturally derived dextran-peptide vector for microrna antagomir delivery

Naturally derived dextran-peptide vector for microrna antagomir delivery Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information aturally derived dextran-peptide vector for microra antagomir delivery

More information

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion

Figure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin

More information

hpsc Maintenance Media

hpsc Maintenance Media hpsc Maintenance Media Brigitte Arduini, version 2, 2013-Jun-12 Initially, it was found that pluripotency of human pluripotent stem cells (hpscs) can be maintained when plated in co-culture with mouse

More information

SOP 2 Solid Tumor Processing for Cell Culture and Xenografts

SOP 2 Solid Tumor Processing for Cell Culture and Xenografts Texas Cancer Cell Repository Cell Culture and Xenograft Repository http://cancer.ttuhsc.edu www.txccr.org www.cogcell.org SOP 2 Solid Tumor Processing for Cell Culture and Xenografts Receiving the Sample:

More information

Cellular viability - WST-1 assay in NR8383 macrophages

Cellular viability - WST-1 assay in NR8383 macrophages Standard Operation Procedure (SOP): WP 4-Number 2 Date 07/01/2015 Version 1.0 Drafted within the project Oxidant generating capacity as a metric to allow grouping of nanomaterials and prediction of human

More information

ClonaCell -CHO. Semi-Solid Cloning Testing Guidelines

ClonaCell -CHO. Semi-Solid Cloning Testing Guidelines ClonaCell -CHO Semi-Solid Cloning Testing Guidelines Table of Contents 1.0 Introduction... 3 2.0 Before Planning a Semi-Solid Cloning Protocol... 4 3.0 Equipment and Materials... 5 4.0 Storage of Semi-Solid

More information

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent

Real-time 96-well antibody internalization assays using IncuCyte FabFluor Red Antibody Labeling Reagent Nicola Bevan, Tim Dale, Del Trezise Essen BioScience Welwyn Garden City, Hertfordshire, UK Introduction Monoclonal antibodies are now widely used as anti-cancer, antiinflammatory and anti-viral therapeutic

More information

Endoglin Is Essential for the Maintenance of Self-Renewal and Chemoresistance

Endoglin Is Essential for the Maintenance of Self-Renewal and Chemoresistance Stem Cell Reports, Volume 9 Supplemental Information Endoglin Is Essential for the Maintenance of Self-Renewal and Chemoresistance in Renal Cancer Stem Cells Junhui Hu, Wei Guan, Peijun Liu, Jin Dai, Kun

More information

DEPArray Technology. Sorting and Recovery of Rare Cells

DEPArray Technology. Sorting and Recovery of Rare Cells DEPArray Technology Sorting and Recovery of Rare Cells Delivering pure, single, viable cells The DEPArray system from Silicon Biosystems is the only automated instrument that can identify, quantify, and

More information

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation

Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Smooth Muscle-Specific Expression of ipla 2 β Participates in the Initiation and Early Progression of Vascular Inflammation and Neointima Formation Shu Liu 1, Zhongwen Xie 2, Qingwei Zhao 2, Huan Pang

More information

HCT116 SW48 Nutlin: p53

HCT116 SW48 Nutlin: p53 Figure S HCT6 SW8 Nutlin: - + - + p GAPDH Figure S. Nutlin- treatment induces p protein. HCT6 and SW8 cells were left untreated or treated for 8 hr with Nutlin- ( µm) to up-regulate p. Whole cell lysates

More information

Note that Methylene Blue-stained cultures may require an additional washing step if the second wash is still very blue in appearance.

Note that Methylene Blue-stained cultures may require an additional washing step if the second wash is still very blue in appearance. Introduction: Cell culture in Alvetex Scaffold allows the formation of multilayered, high-density cell populations which approximate the complexity and structure of in vivo tissues. When viewing an unstained,

More information

Abstract. Materials and Methods. Introduction

Abstract. Materials and Methods. Introduction The Performance of Serum-Free and Animal Component-Free Media for Multiple Hybridoma Cell Lines and Culture Systems Heather N. Loke, Steven C. Peppers, Daniel W. Allison, Damon L. Talley, and Matthew V.

More information

Introduction. Figure 1. Oris Cell Migration Assay Principle

Introduction. Figure 1. Oris Cell Migration Assay Principle Optimizing Performance of the Membrane-free, Oris Cell Migration Assay for High Throughput Screening using the BioTek Synergy HT Multi-Mode Microplate Reader Keren I. Hulkower, Renee L. Herber, and Scott

More information

Introduction. Technical Note

Introduction. Technical Note DNA and RNA quantification: fast and simple with PicoGreen dsdna and RiboGreen RNA quantification reagents Fluorescence intensity on Infinite F2 and Infinite M2 Introduction DNA quantification Detection

More information

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis

Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined. Hyperthermia for Enhanced Cancer Cell Apoptosis Supporting Information: Core-Shell Nanoparticle-Based Peptide Therapeutics and Combined Hyperthermia for Enhanced Cancer Cell Apoptosis Birju P. Shah a, Nicholas Pasquale a, Gejing De b, Tao Tan b, Jianjie

More information

Avalanche -Omni Transfection Reagent

Avalanche -Omni Transfection Reagent The Transfection & Gene Expression Experts Avalanche -Omni Transfection Reagent Cat. No. EZT-OMNI-1 Description Size: 0.75 ml 1.5 ml Store at 4 C Avalanche -Omni Transfection Reagent is a proprietary lipid-polymer

More information

Cultrex BME Cell Invasion Assay

Cultrex BME Cell Invasion Assay Cultrex BME Cell Invasion Assay Catalog Number 3455-096-K 96-well assay for investigating chemotaxis, cell migration, and/or cell invasion for adhesive cell types. This package insert must be read in its

More information

Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis

Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Introduction APPLICATION NOTE IncuCyte Live-Cell Analysis System Label-free, real-time live-cell assays for spheroids: IncuCyte bright-field analysis Susana L. Alcantara, Miniver Oliver, Kalpana Patel,

More information

TACS MTT Assays. Cell Proliferation and Viability Assays. Catalog Number: TA tests. Catalog Number: TA tests

TACS MTT Assays. Cell Proliferation and Viability Assays. Catalog Number: TA tests. Catalog Number: TA tests TACS MTT Assays Cell Proliferation and Viability Assays Catalog Number: TA5355-2500 tests Catalog Number: TA5412-5000 tests This package insert must be read in its entirety before using this product. FOR

More information

Coating nanoparticles with plant-produced transferrin-hydrophobin fusion protein enhances their uptake in cancer cells

Coating nanoparticles with plant-produced transferrin-hydrophobin fusion protein enhances their uptake in cancer cells SUPPORTING INFORMATION Coating nanoparticles with plant-produced transferrin-hydrophobin fusion protein enhances their uptake in cancer cells AUTHORS Lauri J. Reuter 1, Mohammad-Ali Shahbazi 2,3, Ermei

More information

Supplementary Figure 1. Isolation of GFPHigh cells.

Supplementary Figure 1. Isolation of GFPHigh cells. Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding

More information

EGFR (Phospho-Ser695)

EGFR (Phospho-Ser695) Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 EGFR (Phospho-Ser695) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02090 Please read the provided manual entirely

More information

Color-Switch CRE Reporter Stable Cell Line

Color-Switch CRE Reporter Stable Cell Line Color-Switch CRE Reporter Stable Cell Line Catalog Number SC018-Bsd SC018-Neo SC018-Puro Product Name / Description CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). Cell line expresses "LoxP-GFP-stop-

More information

Frequently Asked Questions Stem Cells

Frequently Asked Questions Stem Cells Q: Do you add antibiotics to your media? A: Coriell does not use antibiotics when culturing stem cells. Customers should be aware that inclusion of antibiotics in media may change growth characteristics

More information

TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures.

TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures. TREVIGEN Instructions For Research Use Only. Not For Use In Diagnostic Procedures. TACS TM XTT Cell Proliferation Assay Catalog # 4891-025-K, 2500 Tests The product accompanying this document is intended

More information

Amaxa Cell Line 96-well Nucleofector Kit SF

Amaxa Cell Line 96-well Nucleofector Kit SF Amaxa Cell Line 96-well Nucleofector Kit SF For HepG2 Human hepatocellular carcinoma; adherent epithelial cells Example for Nucleofection of HepG2 cells OD 405 100 80 SEAP activity % 100 80 Transfection

More information

Enzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms

Enzyme-mediated preparation of hydrogels composed of poly(ethylene glycol) and gelatin as cell culture platforms Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Supplementary Material (ESI) for RSC Advances Enzyme-mediated preparation of hydrogels composed

More information

TransIT -mrna Transfection Kit

TransIT -mrna Transfection Kit INTRODUCTION TransIT -mrna Transfection Kit is designed to transfect RNA into a broad range of cell types with minimal cellular toxicity. RNA delivery avoids transcriptional regulation effects by directly

More information

96992 Cell Counting Kit - 8

96992 Cell Counting Kit - 8 96992 Cell Counting Kit - 8 GENERAL INFORMATION Cell Counting Kit-8 (CCK-8) allows very convenient assays by utilizing the highly water-soluble tetrazolium salt WST-8 [2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium,monosodium

More information

B-27 Plus Neuronal Culture System

B-27 Plus Neuronal Culture System USER GUIDE B-27 Plus Neuronal Culture System Catalog Number A3653401 Pub. No. MAN0017319 Rev. 1.0 WARNING! Read the Safety Data Sheets (SDSs) and follow the handling instructions. Wear appropriate protective

More information

ab Hypoxic Response Human Flow Cytometry Kit

ab Hypoxic Response Human Flow Cytometry Kit ab126585 Hypoxic Response Human Flow Cytometry Kit Instructions for Use For measuring protein levels by flow cytometry: hypoxia-inducible factor 1-alpha (HIF1A) and BCL2/adenovirus E1B 19 kda proteininteracting

More information

Cor.At. Cardiomyocytes derived from Mouse Embryonic Stem Cells. Protocol. Cor.At Cardiomyocytes Transfection

Cor.At. Cardiomyocytes derived from Mouse Embryonic Stem Cells. Protocol. Cor.At Cardiomyocytes Transfection Use our Discoveries to Help Advance Yours Cor.At Cardiomyocytes derived from Mouse Embryonic Stem Cells Protocol Cor.At Cardiomyocytes Transfection Using the Nucleofector Technology (Amaxa/Lonza Cologne)

More information

jetcrispr RNP transfection reagent PROTOCOL

jetcrispr RNP transfection reagent PROTOCOL jetcrispr RNP transfection reagent PROTOCOL DESCRIPTION jetcrispr is a RiboNucleoProtein (RNP) transfection reagent designed to perform CRISPR-Cas9 genome editing in mammalian cells. This reagent has been

More information

TransIT -Lenti Transfection Reagent

TransIT -Lenti Transfection Reagent Quick Reference Protocol, SDS and Certificate of Analysis available at mirusbio.com/6600 INTRODUCTION Lentivirus is an enveloped, single-stranded RNA virus from the Retroviridae family capable of infecting

More information

Lab Module 7: Cell Adhesion

Lab Module 7: Cell Adhesion Lab Module 7: Cell Adhesion Tissues are made of cells and materials secreted by cells that occupy the spaces between the individual cells. This material outside of cells is called the Extracellular Matrix

More information

Neural Stem Cells (ipsc from Blood Cells; Male)

Neural Stem Cells (ipsc from Blood Cells; Male) Applied StemCell, Inc. (866) 497-4180 www.appliedstemcell.com Datasheet Neural Stem Cells (ipsc from Blood Cells; Male) Product Information Catalog Number ASE-9234 (Male) Description Applied StemCell's

More information

CellPlayer NucLight Red (Lenti, EF-1 alpha, puro)

CellPlayer NucLight Red (Lenti, EF-1 alpha, puro) Essen BioScience Catalog Number: 4476 Background Third generation lentiviral-based vectors are commonly used to transfer genetic information to cells for gene therapy and/or research purposes. The Essen

More information

Color-Switch CRE recombinase stable cell line

Color-Switch CRE recombinase stable cell line Color-Switch CRE recombinase stable cell line Catalog Number Product Name / Description Amount SC018-Bsd CRE reporter cell line (Bsd): HEK293-loxP-GFP- RFP (Bsd). RFP" cassette with blasticidin antibiotic

More information

Supplementary Material. T315 was synthesized in the authors laboratory [1]. DAPT, doxycycline, and puromycin were

Supplementary Material. T315 was synthesized in the authors laboratory [1]. DAPT, doxycycline, and puromycin were 1. Supplementary Materials and Methods 2. Supplementary Figures Supplementary Material 1. Supplementary Materials and Methods Agents and antibodies T315 was synthesized in the authors laboratory [1]. DAPT,

More information

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014

Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Culturing Protocol for JM8.N4 ES Cell Clones Revised July 2014 Cell Line Information The JM8.N4 subline is derived from the JM8 parental line and are considered to be feeder independent. These cells are

More information

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization

Multiplex Fluorescence Assays for Adherence Cells without Trypsinization Multiplex Fluorescence Assays for Adherence Cells without Trypsinization The combination of a bright field and three fluorescent channels allows the Celigo to perform many multiplexed assays. A gating

More information

Supplemental Information Inventory

Supplemental Information Inventory Cell Stem Cell, Volume 6 Supplemental Information Distinct Hematopoietic Stem Cell Subtypes Are Differentially Regulated by TGF-β1 Grant A. Challen, Nathan C. Boles, Stuart M. Chambers, and Margaret A.

More information

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3

amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Contents amaxa Peptide Transfection Control 2-3 Product specifications 2 Storage and stability 3 Product use limitations 3 Intended use 3 Background Information 4 Cell culture 4 Supporting Data 5-8 Equipment

More information

NutriStem V9 XF Medium

NutriStem V9 XF Medium Stem Cells NutriStem V9 XF Medium A defined, xeno-free (XF), serum-free (SF) culture medium for hpsc using vitronectin Instructions for Use Product Description NutriStem V9 XF medium is a defined, xeno-free,

More information

TransIT -BrCa Transfection Reagent

TransIT -BrCa Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5500 INTRODUCTION TransIT -BrCa Transfection Reagent is specifically optimized to provide exceptional transfection efficiency

More information

Supplementary Information

Supplementary Information Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative

More information