AAC Accepts, published online ahead of print on 18 September 2006 Antimicrob. Agents Chemother. doi: /aac

Transcription

1 AAC Accepts, published online ahead of print on 1 September 00 Antimicrob. Agents Chemother. doi:./aac Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved Genetic environment of acquired bla ACC-1 β-lactamase gene in Enterobacteriaceae A. Doloy, 1 C. Verdet, 1, V. Gautier, 1 D. Decré, 1 E. Ronco, A. Hammami, A. Philippon and G. Arlet, 1, Université Paris VI, UPRES EA, UFR de Médecine Pierre et Marie Curie, Paris, 1 AP-HP, Hôpital Tenon, Service de Bactériologie, Paris, AP-HP, Hôpital Raymond Poincaré, Laboratoire de Microbiologie, Garches, Service de Microbiologie, CHU Habib Bourguiba, Sfax, Tunisia AP-HP, Hôpital Cochin, Service de Bactériologie, Paris, Downloaded from on May, 01 by guest 1

2 ABSTRACT The genetic organization of bla ACC-1 was studied in fourteen isolates of Enterobacteriaceae from, Tunisia and Germany. In a common ancestor, ISEcp1 was likely involved in the mobilization of this gene from the Hafnia alvei chromosome to a plasmid. Other genetic events involving insertion sequences, particularly IS, or transposons, particularly Tn1, or suli-type integrons have occurred leading to complex genetic environments. NOTE The chromosomally-encoded class C β-lactamases confer a natural resistance to β- lactams, typical of a number of Gram-negative species. Since the eighties, plasmid-encoded AmpC-type ß-lactamases have been found worldwide, most often in organisms lacking inducible chromosomal AmpC enzymes (1). Plasmid-encoded ampc genes originate from the chromosomal ampc genes of organisms such as Citrobacter freundii (CMY-type), Enterobacter spp. (MIR-1, ACT-1), Morganella morganii (DHA-type), and Hafnia alvei (ACC-1) (1). ACC-1 was characterized in isolates of several species, such as Klebsiella pneumoniae, Proteus mirabilis, Salmonella enterica, and Escherichia coli, from Germany,, Tunisia, Spain and the Netherlands (,, -,, 1, 1). In, nosocomial outbreaks were described following the admission of a patient transferred from Tunisia, a country which seems to be a potential reservoir (, 1). The ACC-1-producing rifampin-resistant K. pneumoniae SLK strain, isolated in Saint-Louis Hospital in Paris, was previously studied by cloning experiments, and the genetic organization of both plasmid-mediated genes, bla ACC-1 and arr-, was established (1, ). The presence of IS in both recombinant plasmids suggests that arr- and bla ACC-1 could be linked in the K. pneumoniae SLK plasmid. In this study, we have tested this hypothesis, and we have analyzed the genetic environment of the bla ACC-1 gene in a collection of ACC-1- producing isolates, including K. pneumoniae, one P. mirabilis and two S. enterica isolates from different settings. Table 1 lists the 1 clinical isolates and their sources. Most isolates were previously studied (,,, 1, 1). Genomic DNA from K. pneumoniae isolates was prepared as described (), digested with XbaI (New England Biolabs Inc., Saint Quentin en Yvelines, ), and subjected to pulsed-field gel electrophoresis (PFGE) in a CHEF DRIII device (Bio-Rad, Marnes-la- Coquette, ). DNA fragments were separated in a 1% (wt/vol) agarose gel in 0.X Tris- Downloaded from on May, 01 by guest

3 borate-edta buffer at 00 V for 0 h with pulse times ranging from to 0 s. The PFGE profiles obtained for C00 (Tunisia) and KUS (Germany), respectively profiles C and D, were different from each other and from the nine other K. pneumoniae isolates (data not shown). According to the interpretation criteria of Tenover et al. (1), the nine French isolates could be divided into two possibly related clusters: profiles A and B (Table 1). By mating experiments, E. coli K1 J- or E. coli K1 HB1 transconjugants were obtained with ceftazidime ( µg/ml) and either rifampin (0 µg/ml) or streptomycin (0 µg/ml) as selective agents. In case of failure, plasmid DNA was used to transform E. coli DHB cells by electroporation (Bio-Rad). Transformants were selected with ceftazidime ( µg/ml). Fingerprinting analysis was carried out with plasmid DNA purified from transformants or transconjugants using a Plasmid Midi kit (Qiagen, Courtaboeuf, ), digested with EcoRI and subjected to electrophoresis in a 1.% agarose gel at 0 V for h. This analysis showed that plasmids present in the French isolates were identical to that of Tunisian K. pneumoniae C00 (profile A) (data not shown). Each of the other three isolates had unique plasmid profiles (Table 1). It seems that the spread of bla ACC-1 in three different hospitals in is linked both to the spread of a clonal strain and a plasmid that likely originated from Tunisia. PCR experiments and DNA sequencing were carried out on the clinical isolates to detect bla TEM, as previously described (1), and bla ACC (Table, PCR A). The sequence analysis showed that, except S. enterica serovar Mbandaka MMAS 0, all isolates were TEM-1 positive (data not shown), and confirmed that all isolates and transformants or transconjugants were ACC-1-positive. The genetic contexts of bla ACC-1 was explored by PCR mapping using the bla ACC-1 - carrying plasmids from transconjugants or transformants. First, we tested whether bla ACC-1 and arr- in K. pneumoniae SLK were linked on the same plasmid. Primers were designed to amplify the region between bla ACC-1 and intli (PCR F) (Table ). As expected, the.-kb segment (PCR F) overlapped with both sequences of SLK previously submitted to the sequence databases: the first comprising bla ACC-1 (GenBank accession number AJ0), and the second comprising arr- (GenBank accession number AJ0) (Fig. 1). We then used several PCRs (PCRs B to H) to characterize the genetic context of bla ACC-1 in the other 1 isolates (Table ) (Fig.1). Eight isolates other than SLK (seven K. pneumoniae and one P. mirabilis) were positive for these PCRs (Table 1). Two aliquots of the PCR products were totally digested, one with TaqI (New England Biolabs), the other with HaeIII (New England Biolabs). The restriction profiles obtained from these PCR products were the same for each isolate (data not shown) suggesting that the genetic environment of bla ACC-1 was at least similar, if not identical, in the plasmids from these nine isolates. Downloaded from on May, 01 by guest

4 The genetic organization of bla ACC-1 in five isolates (SLK, C00, KUS, MMAS 0, and B) seemed to be different to that in SLK. Therefore, we used cloning experiments to explore the region surrounding bla ACC-1. The plasmid DNA was partially digested with SauIIIA, and the fragments ligated into the BamHI site of pacyc1. Recombinant plasmids introduced into E. coli DHB, were then selected with ceftazidime ( µg/ml) and chloramphenicol (0 µg/ml). Several clones with an insert encompassing bla ACC-1 were obtained from each of the five isolates. The largest of these were selected and their sequence analysed on both strands. Finally, overlapping inserts of recombinant plasmids together with PCR mapping segments (PCR I and J) allowed us to map the unknown region surrounding bla ACC-1 for these five isolates (Fig. 1). The genetic organization of bla ACC-1 from the 1 isolates of this study, and from Salmonella enterica serovar Bareilly 0.0 isolated in the Netherlands (), is shown in Figure 1. Common structures. The ACC-1-producing isolates all have the same genetic organization of plasmid-encoded bla ACC-1 in proximity of the β-lactamase gene. In each isolate, a 11-bp region originating from the H. alvei chromosome, comprising ampc but lacking ampr (which is consistent with the high level of β-lactamase production), was present. The total length of the sequence mobilized from H. alvei is unknown, as the previously sequenced region surrounding the ampc and ampr genes from H. alvei (accession number n AF) is too short, with only the final 1-bp segment of gdha being present in this sequence. Nevertheless, gdha is present downstream from bla ACC-1 in H. alvei (PCRs A and B, Table 1) and in the six plasmid-encoded bla ACC-1 genetic organization profiles. Moreover, gdha which encodes for a glutamate deshydrogenase is a very common housekeeping gene among Proteobacteria and its presence on the H. alvei genome would be expected. Thus, the gdha sequence present downstream from bla ACC-1 is presumed to have been mobilized from H. alvei chromosome together with bla ACC-1. The insertion sequence ISEcp1 upstream from bla ACC-1 is always present in the same orientation, but has variable deletions in the part: a 1-bp deletion for SLK and SLK, a 01-bp deletion for KUS, B and MMAS0, and a -bp deletion for S. Bareilly 0.0. Nevertheless, the length between the end of ISEcp1 and the ATG codon of bla ACC-1 is constant, which suggests that only one genetic recombination event has occurred. ISEcp1 is known to be involved in both the mobilization and expression of bla CTX-M β- lactamase genes (1). Although ISEcp1 is always truncated in the part and can no longer function for transposition events, we can not rule out that it was involved in the initial mobilization of bla ACC-1 in an ancestor common to the six different profiles described here. Indeed, ISEcp1 transposase may recognize a wide range of DNA sequences as IRRs, and use them as ends in a mobilization process involving its adjacent sequences (1). The - and - regions corresponding to putative promoter sequences for acquired bla were different for Downloaded from on May, 01 by guest

5 chromosomal bla ACC -type of H. alvei. Indeed, whatever the deletion of ISEcp1, the promoter is likely provided by ISEcp1 as reported with bla CTX-M (). Different structures: The genetic organization of plasmid-encoded bla ACC-1 differs beyond ISEcp1 and gdha, and it can be divided into three main patterns: (i) the first pattern was found in SLK and in the related isolates SLK and C00. In this pattern, ISEcp1 has a 1,-bp deletion due to an insertion of an IS in the opposite orientation. A second copy of IS (IS L ) is present,-bp upstream from the first copy, IS R. Both copies of IS are in opposite orientations with the ends facing outwards (Fig. 1). Another copy of ISEcp1 (ISEcp1 L ) is present downstream from IS L and is -truncated, with the deletion being exactly complementary to that of ISEcp1 R upstream from bla ACC-1. This, and the presence of two copies of IS suggest that a composite transposon with two directly repeated IS was inserted in ISEcp1 with the duplication of a -bp target site (characteristic of IS transposition) GACATTTT (). However, we are still unsure as to how ISEcp1 L and IS L could have been secondarily inverted and moved elsewhere, downstream from bla ACC-1. (ii) The second pattern was found in KUS, B and MMAS 0. In this group, ISEcp1 has a 1,1-bp deletion due to the insertion of an IS in the same orientation. A second copy of IS (IS L ) is present,-bp downstream from bla ACC-1 (Fig. 1). Both copies of IS are in opposite orientations, with the ends facing inwards. The DNA sequence between the two copies of IS is 0% identical in KUS, B and MMAS0. Beyond IS, the DNA sequence was different in the three structures (Fig. 1). Thus, the structures from the KUS, B and MMAS0 isolates are likely derived from a common ancestor different from that of the first pattern, with a shorter deletion of ISEcp1 due to the insertion of IS in the opposite direction. After this event, several different genetic events seem to have occurred, mainly involving Tn1, but also a class 1 integron carrying a dfra1 gene cassette. (iii) The third pattern was observed in S. Bareilly only (Fig. 1). This has an ISEcp1 deleted by bp due to the insertion of the previously described orf (). The 0-AA protein encoded by orf is % identical to a transposase described in Yersinia enterocolitica strain (GenBank accession number n CAA0). Upstream from gdha, the three previously described orfs encode proteins, the first identical to a transposase from K. pneumoniae CG (accession number n NP_0), the second identical to a protein from the Y. enterocolitica plasmid p0 (GenBank accession number n CAD0), and the third identical to a recombinase from the same plasmid (GenBank accession number n CAE). Studies of the molecular mechanisms of ampc gene transfer from chromosome to plasmids are in progress. It seems that several different DNA mobilizing elements, such as Downloaded from on May, 01 by guest

6 common regions associated to integrons, and insertion sequences (IS), are involved in the movement of the ampc gene and the adjacent region (1, 1). Although IS has been found in the genetic organization of bla ACC-1 in several clinical isolates, it is likely that this structure is not directly involved in the translocation of the ampc gene from the H. alvei chromosome to different plasmids. Nevertheless, its presence seems to be linked with recombination events occurring after the insertion of ISEcp1 upstream from bla ACC-1 that lead to the deletion of the end of ISEcp1 (Fig. 1). In all cases, ISEcp1 was never complete, and its deletion may have led to the stabilization of bla ACC-1 on different plasmids. Nucleotide sequence accession numbers. The nucleotide sequences in strains SLK, SLK, KUS, B and MMAS 0 have been submitted to GenBank and have been assigned accession numbers AJ0, AJ0, AJ0, AJ0 and AJ0, respectively. Acknowledgments This work was supported by grants from Faculté de Médecine Saint-Antoine, Université Pierre et Marie Curie, and from the European Community ( th PCRD contract LSHM-CT 00-0). A. Doloy was supported by a grant from Fonds d'etudes et de Recherche du Corps Médical des Hôpitaux de Paris, AP-HP. REFERENCES 1. Arlet, G., D. Nadjar, J. L. Herrmann, J. L. Donay, M. Rouveau, P. H. Lagrange, and A. Philippon Plasmid-mediated rifampin resistance encoded by an arr-- like gene cassette in Klebsiella pneumoniae producing an ACC-1 class C β-lactamase. Antimicrob. Agents Chemother. :1-.. Bauernfeind, A., I. Schneider, R. Jungwirth, H. Sahly, and U. Ullmann. 1. A novel type of AmpC β-lactamase, ACC-1, produced by a Klebsiella pneumoniae strain causing nosocomial pneumonia. Antimicrob. Agents Chemother. :1-1.. Bidet, P., B. Burghoffer, V. Gautier, N. Brahimi, P. Mariani-Kurkdjian, A. El- Ghoneimi, E. Bingen, and G. Arlet. 00. In vivo transfer of plasmid-encoded ACC- 1 AmpC from Klebsiella pneumoniae to Escherichia coli in an infant and selection of impermeability to imipenem in K. pneumoniae. Antimicrob. Agents Chemother. :-.. Cao, V., T. Lambert, and P. Courvalin. 00. ColE1-like plasmid pip of Klebsiella pneumoniae encoding extended-spectrum beta-lactamase CTX-M-1. Antimicrob. Agents Chemother. :11-. Downloaded from on May, 01 by guest

7 Decré, D., B. Gachot, J. C. Lucet, G. Arlet, E. Bergogne-Bérézin, and B. Régnier. 1. Clinical and bacteriological epidemiology of extended-spectrum β-lactamaseproducing strains of Klebsiella pneumoniae in a medical intensive care unit. Clin. Infect. Dis. :-.. Girlich, D., A. Karim, C. Spicq, and P. Nordmann Plasmid-mediated cephalosporinase ACC-1 in clinical isolates of Proteus mirabilis and Escherichia coli. Eur. J. Clin. Microbiol. Infect. Dis. 1:-.. Hasman, H., D. Mevius, K. Veldman, I. Olesen, and F. M. Aarestrup. 00. beta- Lactamases among extended-spectrum beta-lactamase (ESBL)-resistant Salmonella from poultry, poultry products and human patients in The Netherlands. J. Antimicrob. Chemother. :-1.. Makanera, A., G. Arlet, V. Gautier, and M. Manai. 00. Molecular epidemiology and characterization of plasmid-encoded β-lactamases produced by tunisian clinical isolates of Salmonella enterica serotype Mbandaka resistant to broad-spectrum cephalosporins. J. Clin. Microbiol. 1:0-.. Miro, E., B. Mirelis, F. Navarro, L. Matas, M. Gimenez, and C. Rabaza. 00. Escherichia coli producing an ACC-1 class C beta-lactamase isolated in Barcelona, Spain. Antimicrob. Agents Chemother. :-.. Naas, T., Y. Mikami, T. Imai, L. Poirel, and P. Nordmann Characterization of In, a class 1 plasmid- and composite transposon-located integron of Escherichia coli which carries an unusual array of gene cassettes. J. Bacteriol. 1:-.. Nadjar, D., M. Rouveau, C. Verdet, J. L. Donay, J. L. Herrmann, P. H. Lagrange, A. Philippon, and G. Arlet Outbreak of Klebsiella pneumoniae producing transferable AmpC-type β-lactamase (ACC-1) originating from Hafnia alvei. FEMS Microbiol. Lett. 1: Ohana, S., V. Leflon, E. Ronco, M. Rottman, D. Guillemot, S. Lortat-Jacob, P. Denys, G. Loubert, M. H. Nicolas-Chanoine, J. L. Gaillard, and C. Lawrence. 00. Spread of a Klebsiella pneumoniae strain producing a plasmid-mediated ACC-1 AmpC β-lactamase in a teaching hospital admitting disabled patients. Antimicrob. Agents Chemother. : Philippon, A., G. Arlet, and G. A. Jacoby. 00. Plasmid-determined AmpC-type beta-lactamases. Antimicrob. Agents Chemother. : Poirel, L., J. W. Decousser, and P. Nordmann. 00. Insertion sequence ISEcp1B is involved in expression and mobilization of a bla CTX-M β-lactamase gene. Antimicrob. Agents Chemother. :-. Downloaded from on May, 01 by guest

8 Rhimi-Mahjoubi, F., M. Bernier, G. Arlet, Z. Ben Jemaa, P. Jouve, A. Hammami, and A. Philippon. 00. Identification of plasmid-encoded cephalosporinase ACC-1 among several enterobacteria (Klebsiella pneumoniae, Proteus mirabilis, Salmonella) issued from a tunisian hospital (Sfax, 1-000). Pathol. Biol. 0:-. 1. Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1. Interpreting chromosomal DNA restriction patterns produced by pulse-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. :-. 1. Verdet, C., Y. Benzerara, V. Gautier, O. Adam, Z. Ould-Hocine, and G. Arlet. 00. Emergence of DHA-1-producing Klebsiella spp. in the parisian region: genetic organization of the ampc and ampr genes originating from Morganella morganii. Antimicrob. Agents Chemother. 0:0-1. Downloaded from on May, 01 by guest

9 TABLE 1. Clinical isolates, origin, epidemiological features and PCR mapping Strain Klebsiella pneumoniae KUS () 1 Klebsiella pneumoniae C00 (1) 1 Klebsiella pneumoniae SLK () 1 Klebsiella pneumoniae SLK () 1 Klebsiella pneumoniae SLK () 1 Klebsiella pneumoniae RP (1) 1 Klebsiella pneumoniae RP (1) 1 Klebsiella pneumoniae RP (1) 1 Klebsiella pneumoniae RP (1) 1 Klebsiella pneumoniae RP Reference Collection Origin: country ACC-1 plasmid date (yr) (city, hospital) a transfer b (1) 1 Klebsiella pneumoniae VIL This study 000 Proteus mirabilis SLP This study 1 Salmonella enterica serovar Mbandaka MMAS 0 Salmonella enterica serovar Livingstone B () 1 (1) 000 PFGE type ACC-1 plasmid fingerprint Resistance cotransferred c PCR A PCR PCR PCR PCR PCR PCR B C D E F G PCR PCR PCR H I J Germany (Kiel, H1) Tc E. coli J D C TMP Tunisia (Sfax, H) Tc E. coli J C A GM (Paris, H) Tc E.coli HB1 A1 A GM, TM, NET, SSS, RA (Paris, H) Tc E. coli J A1 A GM (Paris, H) Tc E.coli HB1 A1 A GM, TM, NET, SSS, RA Ep E. coli DHB (Garches, H) B A GM, TM, NET, SSS, RA Ep E. coli DHB (Garches, H) B A GM, TM, NET, SSS, RA Tc E.coli HB1 (Garches, H) A1 A GM, TM, NET, SSS, RA Ep E. coli DHB (Garches, H) B A GM, TM, NET, SSS, RA (Garches, H) (Paris, H) (Paris, H) Tunisia (Tunis, H) Tunisia (Sfax, H) Tc E.coli HB1 A A GM, TM, NET, K, SSS, RA Ep E. coli DHB B1 A GM, TM, NET, SSS, RA Tc E. coli J ND A GM, TM, NET, SSS, RA Ep E. coli DHB ND B GM, TM, NET, K, SSS, TMP Tc E. coli J ND D TMP Hafnia alvei HAF TN01 () ND ND ND ND ND ND a H1, Kiel University Hospital; H, Habib Bourguiba University Hospital; H, Saint-Louis University Hospital ; H, Raymond Poincaré University Hospital ; H, La Rabta University Hospital; H, University Hospital Saint-Antoine b Tc, transconjugant; Ep, transformant c Resistance cotransferred to transconjugants or electroporants: GM, gentamicin; TM, tobramycin; NET, netilmicin; K, kanamycin; SSS, sulfonamides; TMP, trimethoprim; RA,rifampin ND, not determined Downloaded from on May, 01 by guest

10 TABLE. Sequences of oligonucleotides used for PCR mapping PCR Primer sequence ( ) A B C D E F G H I Position in the published sequences (bp) Target A F : CACCGAAGCCGTTAGTTGAT, a bla ACC-1 A R : GACACCGTTGATGACCTGAT, a bla ACC-1 B F : GCTCGTATGGGCTGGAAAG, a gdha B R : GACACCGTTGATGACCTGAT, a bla ACC-1 C F : TGGGTGTCGCTCGCATAAA 1,1 a orf1 C R : GTAGTGGGTTTGCTTATCTT, a gdha D F : TGCTCATCTGGTCAATACTG a tnpr D R : CTGCCCTTTTGATTCCACTC 1, a orf1 E F : TAGCAGCCAGAGCACCTTG,1 a bla ACC-1 E R : AGCCGTTTTTCCATTTCAG - IS F F : CACCGAAGCCGTTAGTTGAT, a bla ACC-1 F R : CTTCCCGACGCCCTTGAGC b inti1 G F : AGGAGATGCTGGCTGAACG,1 a IS G R : AGGCTGAAAAGTAGATGTGCT 1, b arr- H F : GCTCAAGGGCGTCGGGAAG b inti1 H R : AGGCTGAAAAGTAGATGTGCT 1, b arr- I F : GACATCCATTACGATTGATA c ISEcp1 I R : CTGCTACTGTTCGCTCACGA 11 a tnpr PCR product length (kb) J J F : TGGTACTGGCGTAACCCTTC, c IS 1. J R : CCGATGACCAGTTGGAAAAT, c tnib 1 X F, forward primer; X R, reverse primer; a, sequence AJ0; b, sequence AJ0; c, sequence AJ Downloaded from on May, 01 by guest

11 D C B A E F G H SLK. kb AJ0 ISEcp1 L IS L orf1 gdha bla ACC-1 ISEcp1 R IS R inti1 arr- SLK, C00. kb AJ0 KUS. kb AJ0 B. kb AJ0 MMAS0. kb AJ0 ISEcp1 L I IS L Tn1 tnpa tnpr orf1 gdha bla ACC-1 ISEcp1 IS R R tnp IS L gdha Tn1 tnpa bla ACC-1 IS1 ISEcp1 IS R Tn1 tnpa IS L gdha bla ACC-1 ISEcp1 IS R IS L gdha bla ACC-1 ISEcp1 IS R inti1 tnib 1 J aac Tn1 tnpa dfra1 qace 1 IS1 S. Bareilly 0.0. kb AY orf1 orf orf gdha bla ACC-1 ISEcp1 orf 1 kb AJ0 truncated ORFs truncated ORFs and truncated ORF Inverted Repeat bp element regions of 0% identity Recombinant ORF1 plasmids. ORF AJ0 Sequences previously reported (1, ) PCR mapping Hafnia alvei homology FIG. 1. Comparison of regions surrounding bla ACC-1 Downloaded from on May, 01 by guest