Taxonomical aspects of Trichoderma as an opportunistic human pathogen

Transcription

1 Taxonomical aspects of Trichoderma as an opportunistic human pathogen L. Kredics 1, Z. Antal 1, A. Szekeres 2, L. Hatvani 2, Monika Komoń- Zelazowska 3, L. Manczinger2, C. Vágvölgyi 2, E. Nagy 1, C. P Kubicek 3, I. S Druzhinina 3 1 Microbiological Research Group, Hungarian Academy of Sciences and University of Szeged, Hungary 2 Department of Microbiology, Faculty of Sciences, University of Szeged, Hungary 3 Working Group Fungal Evolution and Biodiversity, Division of Gene Technology and Applied Biochemistry, Institute of Chemical Engineering, Vienna University of Technology, Vienna, Austria

2 Genus Trichoderma Trichoderma as a beneficial organism: - decomposition of plant residues in the soil - cellulose degradation - biological control of plant pathogenic fungi The harmful side: - green mold disease of commercially grown mushrooms - opportunistic infections in immunocompromised patients

3 Clinical importance of the genus Trichoderma The genus is on the growing list of emerging fungal pathogens. Patients at risk: - immunocompromised transplant recipients - patients with HIV infection - patients undergoing continuos ambulatory peritoneal dialysis (CAPD) Number of documented cases: - about 60 - growing from year to year Review:

4 Case reports about Trichoderma infections in the literature Age/Sex Clinical diagnosis Source Etiology Therapy Outcome Reference 82/M CAPD peritonitis Peritoneal fluid T. harzianum K, 5FC Death Guiserix et al, /F CAPD peritonitis Peritoneal fluid T. koningii Catheter removal, M Survival Ragnaud et al, /M CAPD peritonitis Peritoneal fluid T. koningii F, 5FC, AB Death Campos-Herrero et al, /M CAPD peritonitis Peritoneal fluid, autopsy T. longibrachiatum AB Death Tanis et al, /M APD peritonitis Peritoneal fluid T. pseudokoningii Catheter removal Survival Rota et al, /M CAPD peritonitis Peritoneum, autopsy T. viride AB Death Loeppky et al, /M CAPD peritonitis Peritoneal fluid T. viride AB Death Warnock et al, /M CAPD peritonitis Peritoneal fluid Trichoderma sp. Catheter removal, AB Death Eşel et al., /M CAPD peritonitis Peritoneal fluid Trichoderma sp. Catheter removal, K Survival Bren, /F TX/Lung and skin dissemination Bronchoalveolar lavage, skin biopsy T. pseudokoningii F, AB, 5FC Death Gautheret et al, /M TX/Disseminated infection Lung, liver, intestinal wall, autopsy T. longibrachiatum AB, I, liposomal AB Death Richter et al, /F TX/Abdominal dissemination Abdominal fluid, haematoma T. viride Surgery, AB, F Death Jacobs et al, /F TX/Sinusitis Ethmoidal and maxillary sinuses T. longibrachiatum Surgery, AB, I Survival Furukawa et al, /M TX/Disseminated infection Brain and lung abscesses, autopsy T. harzianum - Death Guarro et al, /F TX/Renal infection subcapsular hepatic abscess T. longibraciatum Surgery, povidone iodine Survival Chouaki et al, /M TX/Pulmonary edema Bronchoalveolar lavage, pleural drains T. longibrachiatum Lipid-associated AB Death Chouaki et al, /M Skin infection Skin biopsy T. longibrachiatum AB Survival Munoz et al, /F Brain abscess Brain biopsy, cerebral pus T. longibrachiatum Surgery, AB, 5FC/K, I Survival Seguin et al, /F Necrotizing stomatitis Oral mucosa, lung T. longibrachiatum AB, I Death Myoken et al., /ND Otitis externa Ear discharge T. longibrachiatum nystatin, polymyxin B Survival Hennequin et al, /M Pulmonary mycetoma Sputum, lung biopsy T. viride Surgery ND Escudero et al, /M Endocarditis Operation Trichoderma sp. ND ND Bustamante-Labarta et al, /F Fungemia by contaminated saline Blood Trichoderma viride AB Survival Robertson, 1970 M = male, F = female; APD = automated peritoneal dialysis, CAPD = chronic ambulatory peritoneal dialysis; 5FC = 5-fluorocytosine, AB = amphotericin B, F = fluconazole, I = itraconazole, K = ketoconazole, M = miconazole; TX = transplant; ND = no data available

5 Skin lesion caused by T. longibrachiatum Skin lesion on the medial aspect of the wrist of a pediatric patient with aplastic anemia A methenamine silver stain of the skin biopsy specimen shows septate hyphal elements with irregular forms, arranged in a radial fashion. Magnification, Munoz et al. (1997): J. Clin. Microbiol. 35,

6 Necrotizing stomatitis caused by T. longibrachiatum Oral lesions in a female with malignant lymphoma Septate fungal hyphae showing dichotomous branching at acute angles in necrotic gingiva Myoken et al. (2002): Int. J. Oral Maxillofac. Surg. 37,

7 T. harzianum infection in a renal transplant recipient Branching pattern of hyphae from a lung lesion. Periodic acid-schiff stain Methenamine silver stain of a brain abscess showing a radiating pattern of T. harzianum hyphae Guarro et al. (1999): J. Clin. Microbiol. 37, (1999)

8 Further cases Fungal filaments in the tissue section of the apical lesion of the left lung of a bone marrow transplant recipient who died of Trichoderma infection Gautheret et al. (1995): Clin. Infect. Dis. 20, Methenamine silver stain of the perianal ulcer biopsy specimen showing necrosis and infiltration by branching septate hyphal forms of T. longibraciatum Richter et al. (1999): J. Clin. Microbiol 37,

9 Clinical Trichoderma isolates examined in our studies pecies Strain Isolated from T. longibrachiatum UAMH 9515 peritoneal effluent, Newfoundland, Canada ATCC skin lesion, TX, USA ATCC HIV+ patient, TX, USA CBS lung of a man, Vienna, Austria CNM-CM 2171 cutaneous feet skin lesions, Spain T. pseudokoningii IP brain biopsy, Villejuif, France UAMH 7955 sinus, Pennsylvania, USA UAMH 7956 lung, liver, intestinal wall, Iowa, USA T. citrinoviride UAMH 9573 peritoneal catheter, Newfoundland, Canada T. koningii CNM-CM 382 peritoneal fluid, Las Palmas, Spain T. harzianum CBS brain and lung abscesses, Spain T. viride CNM-CM 1798 blood culture, Spain CNM-CM 2277 sputum of a patient with TBC, Spain

10 Physiological characteristics of clinical Trichoderma isolates: temperature- and ph-dependence, hemolysis 60 Colony diameter extension (mm/day) ph UAMH7955 UAMH7956 UAMH9515 ATCC ATCC CBS IP UAMH9573 CM382 CBS UAMH 7955 UAMH 7956 UAMH 9515 ATCC ATCC CBS IP UAMH 9573 CM 382 CBS UAMH 7955 UAMH 7956 UAMH 9515 ATCC ATCC CBS IP UAMH 9573 CM382 CBS control T ( C) Hemolytic abilities

11 Trypsin-like activities (OD 405 ) Chymotrypsin-like activities (OD 405 ) 1,0 UAMH ,8 1,0 UAMH ,8 1, , , , ATCC CBS IP UAMH ,8 0,8 0,8 0, ,0 UAMH ,8 1,0 UAMH ,8 1,0 UAMH ,8 1, , , , ATCC CBS IP UAMH 0, ,8 0, , ,0 1,0 CM 382 CBS 0,8 0, ,0 CM 382 0, ,0 UAMH ,8 Fraction number ,0 CBS , ,0 ATCC ,8 1,0 0, ATCC Physiological characteristics of clinical Trichoderma isolates: production of extracellular proteolytic activities Relative trypsin-like activities (%) Relative chymotrypsin-like activities (%) ph ph UAMH7955 UAMH7956 UAMH9515 ATCC ATCC CBS IP UAMH9573 CM382 CBS UAMH 7955 UAMH 7956 UAMH 9515 ATCC ATCC CBS IP UAMH 9573 CM 382 CBS

12 Antifungal susceptibilities of clinical Trichoderma isolates Species Clinical isolate Amphotericin B Fluconazole Itraconazole Ketoconazole T. longibrachiatum UAMH ,5 > ,125 UAMH , UAMH ,0 > ATCC ,0 > ATCC ,0 > CBS ,0 > ,50 IP ,0 >256 >32 2,0 UAMH , CNM-CM > T. harzianum CBS >256 >32 16 T. viride ,125 >256 >32 >32 T. inhamatum , >32 (MIC values in µg/ml)

13 Clinical Trichoderma isolates examined in our studies pecies Strain Isolated from T. longibrachiatum UAMH 9515 peritoneal effluent, Newfoundland, Canada ATCC skin lesion, TX, USA ATCC HIV+ patient, TX, USA CBS lung of a man, Vienna, Austria CNM-CM 2171 cutaneous feet skin lesions, Spain T. pseudokoningii IP brain biopsy, Villejuif, France UAMH 7955 sinus, Pennsylvania, USA UAMH 7956 lung, liver, intestinal wall, Iowa, USA T. citrinoviride UAMH 9573 peritoneal catheter, Newfoundland, Canada T. koningii CNM-CM 382 peritoneal fluid, Las Palmas, Spain T. harzianum CBS brain and lung abscesses, Spain T. viride CNM-CM 1798 blood culture, Spain CNM-CM 2277 sputum of a patient with TBC, Spain

14 Morphology-based identification of clinical Trichoderma isolates Section Longibrachiatum Pachybasium Trichoderma Species T. longibrachiatum T. citrinoviride T. pseudokoningii T. harzianum T. viride T. koningii??are really all of them potential opportunists??

15 Identification based on molecular techniques Kuhls et al. (1999): Molecular reidentification of human pathogenic Trichoderma isolates as Trichoderma longibrachiatum and Trichoderma citrinoviride. Med. Mycol. 37, Methods: PCR-fingerprinting, ITS sequence analysis 6 clinical isolates examined T. longibrachiatum: 5 T. citrinoviride: 1 Phylogenetic positions of clinical Trichoderma strains (marked) within the genus Trichoderma based on ITS sequences.

16 Strain identification by ITS-sequence analysis 5 primer: ITS1 (5 TCCGTAGGTGAACCTGCGG 3 ) 3 primer: ITS4 (5 TCCTCCGCTTATTGATATGC 3 ) Product: 600 bp fragment (ITS1 5.8S rdna ITS2) Sequence analysis: TrichOkey 1.0: (Druzhinina et al ) Part of the ITS-sequence of T. longibrachiatum CBS

17 Strain identification by ITS-sequence analysis Strain Species Identity CBS T. harzianum confirmed ATCC T. longibrachiatum confirmed ATCC T. longibrachiatum confirmed UAMH 9515 T. longibrachiatum confirmed CBS T. longibrachiatum confirmed CNM-CM 2171 T. longibrachiatum confirmed IP T. pseudokoningii reidentified UAMH 7955 T. pseudokoningii reidentified UAMH 7956 T. pseudokoningii reidentified UAMH 9573 T. citrinoviride reidentified CNM-CM 382 T. koningii reidentified CNM-CM 1798 T. viride reidentified CNM-CM 2277 T. viride reidentified

18 Strain identification by ITS-sequence analysis Strain Species Identity CBS T. harzianum confirmed ATCC T. longibrachiatum/h. orientalis confirmed ATCC T. longibrachiatum/h. orientalis confirmed UAMH 9515 T. longibrachiatum/h. orientalis confirmed CBS T. longibrachiatum/h. orientalis confirmed CNM-CM 2171 T. longibrachiatum/h. orientalis confirmed IP T. longibrachiatum/h. orientalis reidentified UAMH 7955 T. longibrachiatum/h. orientalis reidentified UAMH 7956 T. longibrachiatum/h. orientalis reidentified UAMH 9573 T. longibrachiatum/h. orientalis reidentified CNM-CM 382 T. longibrachiatum/h. orientalis reidentified CNM-CM 1798 T. longibrachiatum/h. orientalis reidentified CNM-CM 2277 T. longibrachiatum/h. orientalis reidentified

19 Phylogenetic positions of clinical Trichoderma isolates based on ITS1 sequence analysis T. longibrachiatum/ /H. orientalis

20 166CPK-EF1-728F CPK EF1-728F CECT EF1-728F UAMH G-EF1-728F G 109CPK-EF1-728F 241G-EF1-728F G EF1-728F CECT EF1-728F IP EF1-728F ATCC EF1-728F UAMH EF1-728F UAMH CPK-EF1-728F T. asperellum H. orientalis Phylogenetic positions of clinical Trichoderma isolates based on tef1α sequence analysis 9515-EF1-728F UAMH EF1-728F ATCC CM 382-EF1-728F CNM-CM G-EF1-728F G T. longibrachiatum Primers: EF1-728F TEF-LLErev EF1-728F CBS EF1-728F CNM-CM EF1-728F CECT 2937 Product: 700 bp fragment CM CNM-CM 1798-EF1-728F G-EF1-728F G 98G-EF1-728F G 111G-EF1-728F G 42CPK-EF1-728F 0.1 CM CNM-CM 2171-EF1-728F 2171

21 Molecular data available for clinical Trichoderma isolates Number of known cases: about 60 Molecular identification carried out: 30 T. longibrachiatum 26 H. orientalis 1 T. citrinoviride 2 T. harzianum 1 The occurence of pathogenic Trichoderma strains may be restricted almost exclusively to species of section Longibrachiatum, previous reports about infections caused by other members of the genus may not have been correct.

22 Celluloseacetate electrophoresis: tested enzymes Enzyme Abbrev. E.C. number Activity Number of electrophoretic patterns 6-phosphogluconate dehydrogenase 6PGDH Aconitase ACN Glucose-6-phosphate dehydrogenase G6PDH Glucose-6-phosphate isomerase GPI Glycerol-3-phosphate dehydrogenase GPDH Malate dehydrogenase MDH Peroxidase PRX Peptidase A (Gly-Leu) PEP A / Peptidase B (Leu-Gly-Gly) PEP B / Peptidase D (Phe-Pro) PEP D / Phosphoglucomutase PGM Shikimate dehydrogenase SKDH Succinate dehydrogenase SUD

23 Cellulose-acetate electrophoresis G6PDH PEP B GPI PEP D PEP A PGM 1. T. viride T. longibrachiatum CECT T. longibrachiatum CECT T. citrinoviride UAMH T. longibrachiatum CM T. longibrachiatum IP T. longibrachiatum UAMH T. longibrachiatum ATCC T. longibrachiatum UAMH T. longibrachiatum CBS

24 Taxonomic positions of clinical Trichoderma isolates based on isoenzyme analysis Electrophoretic Isoenzyme locus types PGM G6PDH PEP A PEP B PEP D 6PGDH GPI ET I A A A B A A A ET II C D C B F C D ET III C D C B F C E ET IV D E F D H B F ET V B C B A G D C ET VI B G D B C B C ET VII B F D C C B C ET VIII B B D B D B B ET IX B C E B B B B ET X B C D B E B B The 10 main electrophoretic types H. orientalis Neighbour-joining dendrogram resulting from the analysis of isoenzymes with different electrophoretic types

25 RFLP of mitochondrial DNA (a) (b) M. Kb M. Kb CECT ATCC UAMH CECT IP MtDNA types of soil-derived and clinical T. longibrachiatum isolates examined using the restriction enzymes BsuRI (a) and Hin6I (b). 3 4 CECT 2606 UAMH 9573 H. orientalis 1. CECT 20105, 2. CECT 2412, 3. CECT 2606, 4. UAMH 9573, 5. UAMH 9515, 6. ATCC , 7. ATCC , 8. IP , 9. UAMH 7955, 10. UAMH 7956 poster P40 (Antal, Z. et al.) UAMH 9515 ATCC UAMH 7955

26 BIOLOG Phenotype Microarrays

27 BIOLOG Phenotype Microarrays - performed for 12 clinical and a series of non-clinical isolates from several closely related species - comparisons at 9 time points and at 3 temperatures in order to detect possible physiological shifts specific for clinical isolates

28 BIOLOG phenotype arrays Preliminary results: Clinical isolates seem to exhibit the same profile as nonclinical isolates on all three temperatures tested.

29 Summary The occurence of pathogenic Trichoderma strains may be restricted almost exclusively to species of section Longibrachiatum, previous reports about infections caused by other members of the genus may not have been correct. The identification of clinical Trichoderma isolates should therefore be confirmed with molecular techniques. The tef1 marker clearly separates Trichoderma longibrachiatum from Hypocrea orientalis. The methods of CAE-based isoenzyme analysis, mtdna RFLP and BIOLOG Phenotype Microarrays proved applicable for the characterization of clinical Trichoderma strains.

30 Molecular basis of pathogenicity and virulence Schmoll, M., Kredics, L., Kratzer, C., Antal, Z., Kubicek, C.P.: Gene regulation in the emerging fungal pathogen Trichoderma longibrachiatum during its growth in the presence of bronchial epithelial cells ECFG8 poster: Xp-7 - simulated infection - Rapid Subtraction Hybridization Microscopic image of a bronchial epithelial cell infected by Trichoderma longibrachiatum

31 Acknowledgements Department of Microbiology Faculty of Sciences University of Szeged, Hungary: Dr. Csaba Vágvölgyi Dr. László Manczinger Dr. János Varga András Szekeres Lóránt Hatvani Microbiological Research Group Hungarian Academy of Sciences and University of Szeged, Hungary: Prof. Dr. Elisabeth Nagy Dr. Zsuzsanna Antal Plant Protection Institute Hungarian Academy of Sciences, Budapest, Hungary: Dr. Miklós Láday Working Group Fungal Evolution and Biodiversity Research Area Gene Technology and Applied Biochemistry Institute of Chemical Engineering and Applied Life Sciences Vienna University of Technology Austria: Univ. Prof. Christian P. Kubicek Dr. Irina S. Druzhinina Monika Komon

32 Thank you!