Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1. Xbp1 deficiency does not alter hematopoietic cellularity.

Supplementary Figure 1 Xbp1 deficiency does not alter hematopoietic cellularity. Absolute number of leukocytes obtained from bone marrow (BM, 2 tibias and 2 femurs per mouse) of Xbp1 f/f and Xbp1 Vav1

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM

Supplementary Figure 1: Analysis of monocyte subsets and lineage relationships. (a) Gating strategy for definition of MDP and cmop populations in BM of Cx3cr1 GFP/+ mice related to Fig. 1a. MDP was defined

Nature Immunology: doi: /ni.3694

Supplementary Figure 1 Expression of Bhlhe41 and Bhlhe40 in B cell development and mature B cell subsets. (a) Scatter plot showing differential expression of genes between splenic B-1a cells and follicular

Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating

Supplemental Figure Legend: Supplemental figure 1: Phenotype of IMC and MDSC after purification. A. Gating strategy for mouse MDSC. CD11b + Ly6C high Ly6G - cells are defined as M-MDSC. CD11b + Ly6C low

hcd1tg/hj1tg/ ApoE-/- hcd1tg/hj1tg/ ApoE+/+

ApoE+/+ ApoE-/- ApoE-/- H&E (1x) Supplementary Figure 1. No obvious pathology is observed in the colon of diseased ApoE-/me. Colon samples were fixed in 1% formalin and laid out in Swiss rolls for paraffin

Distribution of human ILCs during chronic lung disease.

Supplementary Figure 1 Distribution of human ILCs during chronic lung disease. Quantification of flow cytometric analysis of lung tissue from patients with COPD or IPF identifying (a) frequencies of total

Supplemental Information. Inflammatory Ly6C high Monocytes Protect. against Candidiasis through IL-15-Driven. NK Cell/Neutrophil Activation

Immunity, Volume 46 Supplemental Information Inflammatory Ly6C high Monocytes Protect against Candidiasis through IL-15-Driven NK Cell/Neutrophil Activation Jorge Domínguez-Andrés, Lidia Feo-Lucas, María

amplify the conditional allele (2-lox) and recombined allele (1-lox) following tamoxifen

Supplementary data Supplementary Table 1. Real-time PCR primer sequences Supplementary Fig. 1. (A) Genomic map of the Vhl (2-lox) conditional allele. Numbered boxes represent exon 1, which is targeted

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature11809 Supplementary Figure 1. Antibiotic treatment reduces intestinal bacterial load and allows access of non-pathogenic bacteria to the MLN, inducing intestinal

Supplementary Figure 1. Characterization of the POP2 transcriptional and post-transcriptional regulatory elements. (A) POP2 nucleotide sequence

1 5 6 7 8 9 10 11 1 1 1 Supplementary Figure 1. Characterization of the POP transcriptional and post-transcriptional regulatory elements. (A) POP nucleotide sequence depicting the consensus sequence for

Interferon- -producing immature myeloid cells confer protection. against severe invasive group A Streptococcus infections. Supplementary Information

Supplementary Information Interferon- -producing immature myeloid cells confer protection against severe invasive group A Streptococcus infections Takayuki Matsumura, Manabu Ato, Tadayoshi Ikebe, Makoto

Flowcytometry-based purity analysis of peritoneal macrophage culture.

Liao et al., KLF4 regulates macrophage polarization Revision of Manuscript 45444-RG- Supplementary Figure Legends Figure S Flowcytometry-based purity analysis of peritoneal macrophage culture. Thioglycollate

Eight-week-old wildtype mice were kept under standard diet (SD) for 4 weeks, or fed Western

Supplemental information M. Itoh et al. 0 Supplemental Methods Inducible NASH model using wildtype mice Eight-week-old wildtype mice were kept under standard diet (SD) for weeks, or fed Western diet (WD)

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1 Validation of the monoclonal antibody to mouse ACKR1 and expression of ACKR1 by BM hematopoietic cells. (a to d) Comparison of immunostaining of BM cells by anti-mouse ACKR1 antibodies:

neutrophils (CD11b+, the total Statistical multiple

Supplementary Figure 1. (A) Wild type and Vim / mice were treated with (24mg/kg LPS); lungs were harvested at 48h and enzymaticallyy digested. CD45+ cells were excluded from the total cell population and

Rassf1a -/- Sav1 +/- mice. Supplementary Figures:

1 Supplementary Figures: Figure S1: Genotyping of Rassf1a and Sav1 mutant mice. A. Rassf1a knockout mice lack exon 1 of the Rassf1 gene. A diagram and typical PCR genotyping of wildtype and Rassf1a -/-

Supplementary Figure 1

Supplementary Figure 1 Ex2 promotor region Cre IRES cherry pa Ex4 Ex5 Ex1 untranslated Ex3 Ex5 untranslated EYFP pa Rosa26 STOP loxp loxp Cre recombinase EYFP pa Rosa26 loxp 1 kb Interleukin-9 fate reporter

SUPPLEMENTARY INFORMATION

doi: 1.138/nature875 a promoter firefly luciferase CNS b Supplementary Figure 1. Dual luciferase assays on enhancer activity of CNS1, 2, and 3. a. promoter sequence was inserted upstream of firefly luciferase

Revised: RG-RV2 by Fukuhara et al.

Supplemental Figure 1 The generation of Spns2 conditional knockout mice. (A) Schematic representation of the wild type Spns2 locus (Spns2 + ), the targeted allele, the floxed allele (Spns2 f ) and the

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in

Supplementary Figure 1. Reconstitution of human-acquired lymphoid system in mouse NOD/SCID/Jak3 null mice were transplanted with human CD34 + hematopoietic stem cells. (Top) Four weeks after the transplantation

Dierks Supplementary Fig. S1

Dierks Supplementary Fig. S1 ITK SYK PH TH K42R wt K42R (kinase deficient) R29C E42K Y323F R29C E42K Y323F (reduced phospholipid binding) (enhanced phospholipid binding) (reduced Cbl binding) E42K Y323F

(A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: WT; lower

Supplementary Figures S1. (A-B) P2ry14 expression was assessed by (A) genotyping (upper arrow: ; lower arrow: KO) and (B) q-pcr analysis with Lin- cells, The white vertical line in panel A indicates that

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow

Supplementary Fig S1: Bone marrow macrophages and liver Kupffer cells increase IL-1 in response to adenosine signaling. (a) Murine bone marrow derived macrophages (BMDM) were primed with LPS for 16 hrs,

Figure S1. Generation of HspA4 -/- mice. (A) Structures of the wild-type (Wt) HspA4 -/- allele, targeting vector and targeted allele are shown together with the relevant restriction sites. The filled rectangles

Supplementary Fig. 5

Supplementary Fig. 5 Supplemental Figures legends Supplementary Figure 1 (A) Additional dot plots from CyTOF analysis from untreated group. (B) Gating strategy for assessment of CD11c + NK cells frequency

Supplementary Figures

Supplementary Figures Fig. S1. Specificity of perilipin antibody in SAT compared to various organs. (A) Images of SAT at E18.5 stained with perilipin and CD31 antibody. Scale bars: 100 μm. SAT stained

Table S1. Oligonucleotide primer sequences

Table S1. Oligonucleotide primer sequences Primer Name DNA Sequence (5 -> 3 ) Description CD19c CD19d Cre7 Sfpi1lox1 Sfpi1lox2 Sfpi1lox3 5 -AACCAGTCAACACCCTTCC-3 5 -CCAGACTAGATACAGACCAG-3 5 -TCAGCTACACCAGAGACGG-3

Supplemental Data Supplemental Figure 1.

Supplemental Data Supplemental Figure 1. Silique arrangement in the wild-type, jhs, and complemented lines. Wild-type (WT) (A), the jhs1 mutant (B,C), and the jhs1 mutant complemented with JHS1 (Com) (D)

Supplementary Data. Flvcr1a TCTAAGGCCCAGTAGGACCC GGCCTCAACTGCCTGGGAGC AGAGGGCAACCTCGGTGTCC

Supplementary Data Supplementary Materials and Methods Measurement of reactive oxygen species accumulation in fresh intestinal rings Accumulation of reactive oxygen species in fresh intestinal rings was

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2.

Supplementary Table 1. Primers used to construct full-length or various truncated mutants of ISG12b2. Construct name ISG12b2 (No tag) HA-ISG12b2 (N-HA) ISG12b2-HA (C-HA; FL-HA) 94-283-HA (FL-GFP) 93-GFP

a Lamtor1 (gene) b Lamtor1 (mrna) c WT Lamtor1 Lamtor1 flox Lamtor2 A.U. p = LysM-Cre Lamtor3 Lamtor4 Lamtor5 BMDMs: Φ WT Φ KO β-actin WT BMDMs

a Lamtor (gene) b Lamtor (mrna) c BMDMs: Φ WT Φ KO Lamtor flox 8 bp LysM-Cre 93 bp..5 p =.4 WT BMDMs: Φ WT Φ KO Lamtor (protein) BMDMs: Φ WT Φ KO Lamtor 8 kda Lamtor 4 kda Lamtor3 4 kda Lamtor4 kda Lamtor5.5

percentage of Nature Immunology: doi: /ni.3728 Supplementary Figure 1

Supplementary Figure 1 4 integrin expression in monocytes and macrophages from Cre + 4 f/f and Cre 4 f/f mice. a) Depicted is a representative histogram of flow cytometry analysis for α4 integrin expression

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3206 Supplementary Figure 1 Autophagy-related gene expression in murine and human intestinal tumors. (a) Representative LC3 immunostaining in colonic adenoma and adjacent non tumoral tissue

Table S1. Primers used in the study

Table S1. Primers used in the study Primer name Application Sequence I1F16 Genotyping GGCAAGTGAGTGAGTGCCTA I1R11 Genotyping CCCACTCGTATTGACGCTCT V19 Genotyping GGGTCTCAAAGTCAGGGTCA D18Mit184-F Genotyping

Supplementary Figure. S1

Supplementary Figure. S1 Supplementary Figure S1. Correlation of phagocytic ability measured with YG and YO beads. Fresh human monocytes (2 10 6 /ml) were labelled with APC conjugated anti CD14 mab alone

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators.

Supplementary Figure 1 PARP1 is involved in regulating the stability of mrnas from pro-inflammatory cytokine/chemokine mediators. (a) A graphic depiction of the approach to determining the stability of

DRG Pituitary Cerebral Cortex

Liver Spinal cord Pons Atg5 -/- Atg5 +/+ DRG Pituitary Cerebral Cortex WT KO Supplementary Figure S1 Ubiquitin-positive IBs accumulate in Atg5 -/- tissues. Atg5 -/- neonatal tissues were fixed and decalcified.

Mouse expression data were normalized using the robust multiarray algorithm (1) using

Supplementary Information Bioinformatics statistical analysis of microarray data Mouse expression data were normalized using the robust multiarray algorithm (1) using a custom probe set definition that

Flow cytometry Stained cells were analyzed and sorted by SORP FACS Aria (BD Biosciences).

Mice C57BL/6-Ly5.1 or -Ly5.2 congenic mice were used for LSK transduction and competitive repopulation assays. Animal care was in accordance with the guidelines of Keio University for animal and recombinant

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation

LRBA is Essential for Allogeneic Responses in Bone Marrow Transplantation Mi Young Park, 1# Raki Sudan, 1# Neetu Srivastava, 1 Sudha Neelam, 1 Christie Youngs, 1 Jia- Wang Wang, 4 Robert W. Engelman, 5,6,7

SUPPLEMENTARY INFORMATION

DOI: 10.1038/ncb3240 Supplementary Figure 1 GBM cell lines display similar levels of p100 to p52 processing but respond differentially to TWEAK-induced TERT expression according to TERT promoter mutation

Supplemental Figures. B cell tolerance via GARP-TGF-β axis

cell tolerance via GRP-TGF-β axis Supplemental Figures.. Spleen... Spleen mln Total FoxP + FoxP + Helios + FoxP + Helios - Total FoxP + FoxP + Helios + FoxP + Helios - Peyer s Small Intestine mln cell

Signatures of malaria-associated pathology revealed by high-resolution wholeblood transcriptomics in a rodent model of malaria

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Signatures of malaria-associated pathology revealed by high-resolution wholeblood transcriptomics in a rodent model of malaria Jing-wen Lin 1*, Jan Sodenkamp 1Ɨ,

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) (b)

Supplementary Figure 1 An overview of pirna biogenesis during fetal mouse reprogramming. (a) A schematic overview of the production and amplification of a single pirna from a transposon transcript. The

Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut

Immunity, Volume 33 Supplemental Information The Sensing of Environmental Stimuli by Follicular Dendritic Cells Promotes Immunoglobulin A Generation in the Gut Keiichiro Suzuki, Mikako Maruya, Shimpei

Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin

Supporting Information for Quantitative Imaging of Tumor Associated Macrophages and Their Response to Therapy Using 64Cu-Labeled Macrin Hye-Yeong Kim 1,2+, Ran Li 1+, Thomas S.C. Ng 1, Gabriel Courties

Supplementary Figure 1. Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings.

Supplementary Figure 1 Homozygous rag2 E450fs mutants are healthy and viable similar to wild-type and heterozygous siblings. (left) Representative bright-field images of wild type (wt), heterozygous (het)

Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations

Figure S1 A B C Figure S1: GM-CSF upregulates CCL17 expression in in vitro-derived and ex vivo murine macrophage populations (A-B) Murine bone cells were cultured in either M-CSF (5,000 U/ml) or GM-CSF

Nature Immunology: doi: /ni.3101

Supplementary Figure 1 Generation of Plvap / mice. (a) Schematic presentation of the targeting construct as well as the wild-type and targeted Plvap alleles]. PuroR, puromycin resistance. The location

Supplementary Figure 1. Generation of B2M -/- ESCs. Nature Biotechnology: doi: /nbt.3860

Supplementary Figure 1 Generation of B2M -/- ESCs. (a) Maps of the B2M alleles in cells with the indicated B2M genotypes. Probes and restriction enzymes used in Southern blots are indicated (H, Hind III;

Mayumi Egawa, Kaori Mukai, Soichiro Yoshikawa, Misako Iki, Naofumi Mukaida, Yohei Kawano, Yoshiyuki Minegishi, and Hajime Karasuyama

Immunity, Volume 38 Supplemental Information Inflammatory Monocytes Recruited to Allergic Skin Acquire an Anti-inflammatory M2 Phenotype via Basophil-Derived Interleukin-4 Mayumi Egawa, Kaori Mukai, Soichiro

initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for

Supplementary Figure 1: Summary of the exclusionary approach to surface marker selection for initial single-cell analysis, with a pragmatic focus on surface markers with the highest potential for protein

Nature Immunology: doi: /ni Supplementary Figure 1. Zranb1 gene targeting.

Supplementary Figure 1 Zranb1 gene targeting. (a) Schematic picture of Zranb1 gene targeting using an FRT-LoxP vector, showing the first 6 exons of Zranb1 gene (exons 7-9 are not shown). Targeted mice

Supplementary Figure S1

Supplementary Figure S1 Supplementary Figure S1. CD11b expression on different B cell subsets in anti-snrnp Ig Tg mice. (a) Highly purified follicular (FO) and marginal zone (MZ) B cells were sorted from

Supplementary information

Supplementary information Epigenetic silencing of retinoblastoma gene regulates pathologic differentiation of myeloid cells in cancer Je-In Youn, Vinit Kumar, Michelle Collazo, Yulia Nefedova, Thomas Condamine,

Supplementary Materials for

advances.sciencemag.org/cgi/content/full/4/9/eaat5401/dc1 Supplementary Materials for GLK-IKKβ signaling induces dimerization and translocation of the AhR-RORγt complex in IL-17A induction and autoimmune

Hes6. PPARα. PPARγ HNF4 CD36

SUPPLEMENTARY INFORMATION Supplementary Table Positions and Sequences of ChIP primers -63 AGGTCACTGCCA -79 AGGTCTGCTGTG Hes6-0067 GGGCAaAGTTCA ACOT -395 GGGGCAgAGTTCA PPARα -309 GGCTCAaAGTTCAaGTTCA CPTa

Nature Immunology: doi: /ni Supplementary Figure 1. Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice.

Supplementary Figure 1 Construction of lnckdm2b RFP reporter and lnckdm2b-knockout mice. (a) ILC3s (Lin CD45 lo CD90 hi ) were isolated from small intestines, followed by immunofluorescence staining. LncKdm2b

Supplementary Figure and Table Legends

1 Supplementary Figure and Table Legends Figure S1: Whole-animal metabolic analysis. 12 week old WT and Dvl1 / were singly housed in CLAMS cages (Comprehensive Laboratory Animals Monitoring System) for

Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage

Supplementary Data Supplementary Figure 1. Knockdown of VentX with a different sirna sequence reduces terminal monocyte to macrophage differentiation. Monocytes were transfected with either a scrambled

SUPPLEMENTARY INFORMATION

doi:10.1038/nature10772 Supplementary Figures: Supplementary Figure 1. Location of CNS1 within of the Foxp3 locus highlighting CNS1 and indicating transcription factor binding motifs downstream of TCR,

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature12474 Supplementary Figure 1 Analysis of mtdna mutation loads in different types of mtdna mutator mice. a, PCR, cloning, and sequencing analysis of mtdna mutations

DC enriched CD103. CD11b. CD11c. Spleen. DC enriched. CD11c. DC enriched. CD11c MLN

CD CD11 + CD + CD11 d g CD CD11 + CD + CD11 CD + CD11 + Events (% of max) Events (% of max) CD + CD11 Events (% of max) Spleen CLN MLN Irf fl/fl e Irf fl/fl h Irf fl/fl DC enriched CD CD11 Spleen DC enriched

SUPPLEMENTARY FIG. S2. Expression of single HLA loci in shns- and shb 2 m-transduced MKs. Expression of HLA class I antigens (HLA-ABC) as well as

Supplementary Data Supplementary Methods Flow cytometric analysis of HLA class I single locus expression Expression of single HLA loci (HLA-A and HLA-B) by shns- and shb 2 m-transduced megakaryocytes (MKs)

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1 Sox2 localizes in neutrophils of mouse spleen. (a) Microscopy analysis of Sox2 and MPO in wild-type mouse spleen. Nucl, nucleus. (b) Immunohistochemistry staining of Sox2 and MPO

Nature Immunology: doi: /ni Supplementary Figure 1

Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact

Figure S1. Schematic of myeloid lineage reporter mouse model used in this study.

Supplementary Figure Legends Figure S1. Schematic of myeloid lineage reporter mouse model used in this study. (A) The Lyzs-Cre mouse was crossed with Gt(ROSA)26Sor tm1(eyfp)cos/ J mice to label cells expressing

Rorα is essential for nuocyte development

Rorα is essential for nuocyte development See Heng Wong,,, Jennifer A. Walker,, Helen E. Jolin,, Lesley F. Drynan, Emily Hams 3, Ana Camelo, Jillian L. Barlow, Daniel R. Neill,6, Veera Panova, Ute Koch,

Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP +

Supplementary Figure 1 Supplementary Figure 1. Phenotype, morphology and distribution of embryonic GFP + haematopoietic cells in the intestine. GFP + cells from E15.5 intestines were obtained after collagenase

Tgfb1 ACTGATACGCCTGAGTGGCT CCCTGTATTCCGTCTCCTTG. Supplemental data. Supplemental Table 1: Sequences of qpcr primers

Supplemental data Supplemental Table 1: Sequences of qpcr primers Gene Forward primer Reverse primer B2m GTGACCCTGGTCTTTCTGGT GTATGTTCGGCTTCCCATTC Ppl TTGAGACAGCAACCAGAAGC TTCAGGGTCTGGATTTCCTC Evpl TGCTTCACCACCATGTTCAA

Supplementary Fig. 1 (Li et al.)

Supplementary Fig. 1 (Li et al.) Fcrg / Supplementary Figure 1 Microcomputed tomography (mct) images of the distal femurs isolated from the indicated bone marrow chimeric mice. indicates the Dap12 -/-

MLN8237 induces proliferation arrest, expression of differentiation markers and

Supplementary Figure Legends Supplementary Figure 1 827 induces proliferation arrest, expression of differentiation markers and polyploidization of a human erythroleukemia cell line with the activating

C57BL/6N Female. C57BL/6N Male. Prl2 WT Allele. Prl2 Targeted Allele **** **** WT Het KO PRL bp. 230 bp CNX. C57BL/6N Male 30.

A Prl Allele Prl Targeted Allele 631 bp 1 3 4 5 6 bp 1 SA β-geo pa 3 4 5 6 Het B Het 631 bp bp PRL CNX C 1 C57BL/6N Male (14) Het (7) (1) 1 C57BL/6N Female (19) Het (31) (1) % survival 5 % survival 5 ****

Local proliferation dominates lesional macrophage accumulation in atherosclerosis

SUPPLEMENTARY INFORMATION Local proliferation dominates lesional macrophage accumulation in atherosclerosis Clinton S. Robbins, Ingo Hilgendorf, Georg F. Weber, Igor Theurl, Yoshiko Iwamoto, Jose-Luiz

Supplementary Materials for

www.sciencesignaling.org/cgi/content/full/2/85/ra48/dc1 Supplementary Materials for The VDAC2-BAK Rheostat Controls Thymocyte Survival Decheng Ren, Hyungjin Kim, Ho-Chou Tu, Todd D. Westergard, Jill K.

Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV-

Supplemental Data Development of CD11b-IRF8 transgenic and MTAG double transgenic mice The CMV- IRF8 transgenic mouse was previously developed by cloning complementary DNA, containing the IRF-8 coding

Supplemental Table S1. RT-PCR primers used in this study

Supplemental Table S1. RT-PCR primers used in this study -----------------------------------------------------------------------------------------------------------------------------------------------

Supporting information. Supplementary figures.

Supporting information. Supplementary figures. Figure S1. Vacuolar parasite content is independent of the number of vacuoles per cell. The datasets employed for Fig. 1B were examined to determine the number

Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer

SUPPLEMENTAL METHODS Measurement of peritoneal macrophage apoptosis by Celigo plate imaging cytometer For Celigo experiments, 0.1 ml containing 5 x 10 4 cells was seeded into 96 well plates for 30 min

SUPPLEMENTARY INFORMATION

DOI: 1.138/ncb3342 EV O/E 13 4 B Relative expression 1..8.6.4.2 shctl Pcdh2_1 C Pcdh2_2 Number of shrns 12 8 4 293T mterc +/+ G3 mterc -/- D % of GFP + cells 1 8 6 4 2 Per2 p=.2 p>

Supplementary Figure S1: (A) Schematic representation of the Jarid2 Flox/Flox

Supplementary Figure S1: (A) Schematic representation of the Flox/Flox locus and the strategy used to visualize the wt and the Flox/Flox mrna by PCR from cdna. An example of the genotyping strategy is

TRIM31 is recruited to mitochondria after infection with SeV.

Supplementary Figure 1 TRIM31 is recruited to mitochondria after infection with SeV. (a) Confocal microscopy of TRIM31-GFP transfected into HEK293T cells for 24 h followed with SeV infection for 6 h. MitoTracker

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative

Table S1. Nucleotide sequences of synthesized oligonucleotides for quantitative RT-PCR For CD8-1 transcript, forward primer CD8-1F 5 -TAGTAACCAGAGGCCGCAAGA-3 reverse primer CD8-1R 5 -TCTACTAAGGTGTCCCATAGCATGAT-3

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail

Supplementary Figure 1. Gating strategy for flow cytometry analysis of mouse aorta. Cell suspensions from mouse aorta digested with enzyme cocktail were stained with propidium iodide (PI), anti-cd45 (FITC),

Nature Biotechnology: doi: /nbt.4086

Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3 p815 p815-hcd2 Ag (-) anti-cd3

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Experimental design for analyzing molecular circadian rhythms in mouse lung. (a) Schematic depiction of microarray time series analysis to identify the circadian

Harvesting pre-polarized macrophages using thermo-responsive substrates

Article Harvesting pre-polarized macrophages using thermo-responsive substrates Vera Malheiro, Yvonne Elbs-Glatz, Magdalena Obarzanek-Fojt, Katharina Maniura-Weber, Arie Bruinink Laboratory for Biointerfaces,

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41

Supplementary Figure 1 Caspase-8 deficient platelets respond normally to agonists and ABT-737 (A) Surface expression of GPIX, GPIb, GPVI and CD41 were assessed on purified platelets from Casp8 fl/fl and

Supplementary Figure 1

Supplementary Figure 1 Virus infection induces RNF128 expression. (a,b) RT-PCR analysis of Rnf128 (RNF128) mrna expression in mouse peritoneal macrophages (a) and THP-1 cells (b) upon stimulation with

Supplementary Figures

Supplementary Figures 1 Supplementary Figure 1. Expression of TFF2 in splenic T cells. (a) Accumulation of CD11b + Gr-1 + cells in spleen upon 2.5% DSS treatment. The values presented as mean ±s.d. per

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse

Supplementary Figure 1. Bone density was decreased in osteoclast-lineage cell specific Gna13 deficient mice. (a-c) PCR genotyping of mice by mouse tail DNA. Primers were designed to detect Gna13-WT/f (~400bp/470bp)

Nature Immunology: doi: /ni Supplementary Figure 1. Overexpression of Ym1 reduces eosinophil numbers in the lungs.

Supplementary Figure 1 Overexpression of Ym1 reduces eosinophil numbers in the lungs. (a-d) Absolute numbers per mg of tissue of CD8 + T cells (a), CD4 + T cells (b), CD19 + CD11b - B cells (c) and SigF

Supplemental Figure 1

Supplemental Figure 1 Supplemental figure 1. Generation of gene targeted mice expressing an anti-id BCR. (A,B) Generation of the VDJ aid H KI mouse. (A) Targeting Construct. Top: Targeting construct for

The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes

Supplementary Informa0on The transcrip-on factor NR4A1 (Nur77) controls bone marrow differen-a-on and survival of Ly6C monocytes Richard N. Hanna 1, Leo M. Carlin 2, Harper G. Hubbeling 3, Dominika Nackiewicz

Supplementary Methods

Supplementary Methods Microarray Data Analysis Gene expression data were obtained by hybridising a total of 24 samples from 6 experimental groups (n=4 per group) to Illumina HumanHT-12 Expression BeadChips.

Percent survival. Supplementary fig. S3 A.

Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice

Supplemental Information

Supplemental Information Itemized List Materials and Methods, Related to Supplemental Figures S5A-C and S6. Supplemental Figure S1, Related to Figures 1 and 2. Supplemental Figure S2, Related to Figure

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells. in the injured sites

Accelerating skin wound healing by M-CSF through generating SSEA-1 and -3 stem cells in the injured sites Yunyuan Li, Reza Baradar Jalili, Aziz Ghahary Department of Surgery, University of British Columbia,

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development

Strategies for Assessment of Immunotoxicology in Preclinical Drug Development Rebecca Brunette, PhD Scientist, Analytical Biology SNBL USA Preclinical Immunotoxicology The study of evaluating adverse effects

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1: Vector maps of TRMPV and TRMPVIR variants. Many derivatives of TRMPV have been generated and tested. Unless otherwise noted, experiments in this paper use