PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

Size: px
Start display at page:

Download "PCR. CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D."

Transcription

1 PCR CSIBD Molecular Genetics Course July 12, 2011 Michael Choi, M.D.

2 General Outline of the Lecture I. Background II. Basic Principles III. Detection and Analysis of PCR Products IV. Common Applications of PCR V. Real-time PCR

3 The Nobel Prize in Chemistry 1993 Decisive progress in gene technology through two new methods: the polymerase chain reaction (PCR) method and site-directed mutagenesis Press Release 13 October 1993 The Royal Swedish Academy of Sciences has decided to award the 1993 Nobel Prize in Chemistry for contributions to the development of methods within DNA-based chemistry, with half to Dr Kary B. Mullis, La Jolla, California, U.S.A., for his invention of the polymerase chain reaction (PCR) method, and half to Professor Michael Smith, University of British Columbia, Vancouver, Canada, for his fundamental contributions to the establishment of oligonucleotide-based, site-directed mutagenesis and its development for protein studies.

4 II. Basic Principles: PCR cycle design - three steps DNA denaturation (typically C): Separates strands of substrate DNA for each cycle Complete denaturation essential to efficient PCR Typically 30 sec to 2 min Primer Annealing (typically C): Allows primer binding to target DNA sequences Typically 30 sec to 2 min DNA Extension (typically C): Generates DNA product by extending hybridized primer 1 min generally adequate for product up to 1-2 kbp

5

6 II. Basic Principles : Reaction Components Primers (amplimers): sequences may be precise, degenerate or nonspecific, depending on application; generally requires some sequence information Target DNA: routine PCR excellent for amplification of nucleotide sequences; long-range PCR capable of amplifying at least 10kb Thermostable DNA polymerase: Taq notable for high processivity, lack of proofreading (3'-5' exonuclease activity) Pfu notable for proofreading activity but decreased efficiency dntps: Best to use equal concentrations to minimize misincorporation Divalent cations (MgCl2): Concentration affects annealing, denaturation, primer-primer interactions, efficiency of polymerase 2 mm generally a good starting point, but may need to test varying concentrations (e.g., mM) to optimize reaction

7 II. Basic Principles: PCR primer design Usually nt Primer 3: GC content should be between 40-60% Melting temp (Tm) of two primers should not differ by more than 5 degrees Inverted repeats or any selfcomplementary sequences >3bp should be avoided The 3 sequence of one primer should not be complementary to any region of the other primer in the same direction (avoid primer dimers)

8 Primer Dimers

9 II. Basic Principles: Pros and Cons of PCR Pros Speedy and easy Sensitivity: theoretically only one molecule of template needed great for biomedical research, forensics, molecular anthropology, etc. Robustness: often possible to amplify DNA from tissues or cells which are badly degraded or embedded Cons Need for target sequence info Short size and limited amounts of product: typically in 0-5 kb range but long range PCR protocols have been developed up to tens of kbs Infidelity of DNA replication: Taq: 1 error/10,000 bases/cycle; Pfu: has 3'-5' exonuclease proofreading activity but less efficient Contamination: aliquots, gloves, no talking, good pipetting technique

10 III. Detection and Analysis of PCR Products A. Gel Electrophoresis 1.Ethidium bromide staining 2.Autoradiography of labeled products 3.Direct or indirect nonisotopic labeling (e.g., fluorescent) 4.Blot hybridization (Southern or dot blot) B. Sequencing of PCR products 1.Direct sequencing avoids need to clone products

11 IV. Common Applications of PCR: Cloning of PCR products in bacterial cells

12 IV. Common Applications of PCR: Restriction site polymorphisms can easily be typed by PCR as an alternative to laborious RFLP assays

13 IV. Common Applications of PCR: Correct base-pairing at the 3 end of PCR primers is the basis of allele-specific PCR

14 IV. Common Applications of PCR: PCR can be used to type short tandem repeat polymorphisms (STRPs)

15 IV. Common Applications of PCR: Example of typing for a CA repeat Genotypes 1(3,6) 2(1,5) 3(3,5) 4(2,5) 5(3,6) 6(2,5) 7(3,5) 8(3,6).. Slipped strand mispairing is thought to be responsible for shadow bands in tandem nucleotide repeats: Strong main band followed by two lower shadow bands

16 IV. Common Applications of PCR: Linker-primed PCR permits indiscriminate amplification of DNA sequences in a complex target DNA

17 IV. Common Applications of PCR: Dideoxy DNA sequencing relies on synthesizing new DNA strands from a singlestranded DNA template and random incorporation of a base-specific dideoxynucleotide to terminate chain synthesis

18 Structure of a dideoxynucleotide, 2, 3 dideoxy CTP

19 IV. Common Applications of PCR: Automated DNA sequencing using fluorescent primers

20 IV. Common Applications of PCR: PCR mutagenesis

21 V. Real-time PCR Normal reverse transcriptase PCR is only semiquantitative at best because, in part, of the insensitivity of ethidium bromide. Thus real time PCR was developed because of: The need to quantitate differences in mrna expression The availability of only small amounts of mrna in some procedures such as in the use of: --- cells obtained by laser capture micro-dissection --- small amounts of tissue --- primary cells --- precious reagents

22 V. Real-time PCR Quantitation of the amount of cdna in the original sample must be done where the amplification is exponential and, this is at the very beginning of the upturn of the curve. In real time PCR, we measure the cycle number at which the increase in fluorescence (and therefore cdna) is exponential. This is shown by the orange horizontal line in the figure and is set by the user. The point at which the fluorescence crosses the threshold is called the Ct

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist

INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing

More information

Technical Review. Real time PCR

Technical Review. Real time PCR Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously

More information

Recombinant DNA Technology

Recombinant DNA Technology History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Polymerase Chain Reaction (PCR) and Its Applications

Polymerase Chain Reaction (PCR) and Its Applications Polymerase Chain Reaction (PCR) and Its Applications What is PCR? PCR is an exponentially progressing synthesis of the defined target DNA sequences in vitro. It was invented in 1983 by Dr. Kary Mullis,

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Bio Rad PCR Song Lyrics

Bio Rad PCR Song Lyrics Bio Rad PCR Song Lyrics There was a time when to amplify DNA, You had to grow tons and tons of tiny cells. (Oooh) Then along came a guy named Dr. Kary Mullis, Said you can amplify in vitro just as well.

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS

P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background PCR Amplify= Polymerase Chain Reaction (PCR) Invented in 1984 Applications Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off

More information

Lecture 18. PCR Technology. Growing PCR Industry

Lecture 18. PCR Technology. Growing PCR Industry Lecture 18 PCR Technology Growing PCR Industry Basic PCR, Cloning of PCR product, RT-PCR, RACE, Quantitative PCR, Multiplex PCR, Hot start PCR, Touchdown PCR,PCR sequencing.. How PCR started The DNA duplex

More information

Genetic Fingerprinting

Genetic Fingerprinting Genetic Fingerprinting Introduction DA fingerprinting In the R & D sector: -involved mostly in helping to identify inherited disorders. In forensics: -identification of possible suspects involved in offences.

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

2x PCR LongNova-RED PCR Master Mix

2x PCR LongNova-RED PCR Master Mix 2x PCR LongNova-RED Components RP85L 100 reactions (50 μl) RP85L-10 1000 reactions (50 μl) 2x PCR LongNova-RED 2 x 1.25 ml 20 x 1.25 ml PCR grade water 2 x 1.5 ml 20 x 1.5 ml Storage & Shiing Storage conditions

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Laboratory #7 PCR PCR

Laboratory #7 PCR PCR 1 Laboratory #7 Polymerase chain reaction () is DNA replication in a test tube. In vitro enzymatic amplification of a specific segment of DNA. Many Applications. direct cloning from DNA or cdna. Mutagenesis

More information

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -

Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology - Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The

More information

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami

Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques

More information

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR)

Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 4 - Polymerase Chain Reaction (PCR) Progressing with the sequence of experiments, we are now ready to amplify the green

More information

STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR

STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)

More information

High Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible

High Yield/ Routine Applications Problematic templates, High GC/AT High Fidelity Heat-Activated Long Products High Specificity DHPLC Compatible Yield/ Routine Applications Problematic templates, GC/AT Fidelity Heat-Activated Long Products Specificity DHPLC Compatible Polymerases Optimised dntp/ Polymerase Mixes Introduction are essential tools

More information

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi

Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated

More information

Product Name : Simple mirna Detection Kit

Product Name : Simple mirna Detection Kit Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components

More information

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents

DNA Replication. DNA Replication. Meselson & Stahl Experiment. Contents DNA Replication Contents 1 DNA Replication 1.1 Meselson & Stahl Experiment 1.2 Replication Machinery 2 Polymerase Chain Reaction (PCR) 3 External Resources: DNA Replication Meselson & Stahl Experiment

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Laboratory for Environmental Pathogens Research Department of Environmental Sciences University of Toledo Polymerase Chain Reaction (PCR) Background information The polymerase chain reaction (PCR) is an

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1

Biotechnology. Explorer Program. Serious About Science Education 5/17/09 1 Biotechnology Explorer Program Serious About Science Education 5/17/09 1 Chromosome 8: PCR TM PCR Workshop Kirk Brown,, Tracy High School; Tracy, Ca Stan Hitomi,, Monte Vista High School; Danville, CA

More information

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature

Guidelines for Preventing Contamination of PCR Reference Guidelines for Primer Design Estimation of Primer Melting Temperature Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies of a template DNA are generated. Therefore, care must be taken to avoid contamination with other templates and amplicons

More information

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)

One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time) Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.

More information

Table of content. 1. Description Component Specification Optimization of parameters Extension time...

Table of content. 1. Description Component Specification Optimization of parameters Extension time... Table of content 1. Description... 2 2. Component... 2 3. Specification... 2 4. Optimization of parameters... 3 4-1. Extension time... 3 4-2. Enzyme concentration... 3 4-3. Template DNA... 3 4-4. Primer...

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information

Session 3 Cloning Overview & Polymerase Chain Reaction

Session 3 Cloning Overview & Polymerase Chain Reaction Session 3 Cloning Overview & Polymerase Chain Reaction Learning Objective: In this lab exercise, you will become familiar with the steps of a polymerase chain reaction, the required reagents for a successful

More information

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR) Polymerase Chain Reaction (PCR) PCR protocols Polymerase Chain Reaction (PCR) A technique for the in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary

More information

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit

HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit HiPer Random Amplification of Polymorphic DNA (RAPD) Teaching Kit Product Code: HTBM031 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 3.5 hours Agarose Gel Electrophoresis:

More information

Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION

Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Exploring Genetic Variation in a Caffeine Metabolism gene LAB TWO: POLYMERASE CHAIN REACTION Purpose: In this laboratory, we will set up a polymerase chain reaction to amplify the region of the caffeine

More information

Introduction To Real-Time Quantitative PCR (qpcr)

Introduction To Real-Time Quantitative PCR (qpcr) Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular

More information

HiPer Real-Time PCR Teaching Kit

HiPer Real-Time PCR Teaching Kit HiPer Real-Time PCR Teaching Kit Product Code: HTBM032 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1.5 hours Storage Instructions: The kit is stable for 12 months from

More information

By Dr. Zainab khalid

By Dr. Zainab khalid By Dr. Zainab khalid Introduction to PCR PCR was invented in 1984 by ( Kary mullis ) & he received the Nobel Prize in chemistry in 1993, for his invention What is PCR? PCR is an exponentially progressing

More information

PCR settings, pitfalls and artefacts

PCR settings, pitfalls and artefacts De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en

More information

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time

qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template

More information

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual

GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000

More information

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes

SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus

More information

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt

Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d.

NCERT. 2. An enzyme catalysing the removal of nucleotides from the ends of DNA is: a. endonuclease b. exonuclease c. DNA ligase d. BIOTECHNOLOGY PRINCIPLES AND PROCESSES 75 CHAPTER 11 BIOTECHNOLOGY: PRINCIPLES AND PROCESSES 1. Rising of dough is due to: MULTIPLE-CHOICE QUESTIONS a. Multiplication of yeast b. Production of CO 2 c.

More information

CHAPTER 9 DNA Technologies

CHAPTER 9 DNA Technologies CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes

More information

SOP: SYBR Green-based real-time RT-PCR

SOP: SYBR Green-based real-time RT-PCR SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong

More information

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...

Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents... Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline

More information

Lab 3: amplification and isolation of enhancer using PCR & agarose gel extraction

Lab 3: amplification and isolation of enhancer using PCR & agarose gel extraction Lab 3: amplification and isolation of enhancer using PCR & Purpose The goal of this lab is to: 1) Dilute your lyophilized primer oligonucleotides to a suitable storage concentration. 2) Design and execute

More information

PRODUCT INFORMATION Long PCR Enzyme Mix #K0182 500 u Lot Exp. 00.0000 Store at -20 C. CERTIFICATE OF ANALYSIS Long PCR Enzyme Mix is functionally tested in PCR amplification of 47.4 kb fragment from lambda

More information

Module1TheBasicsofRealTimePCR Monday, March 19, 2007

Module1TheBasicsofRealTimePCR Monday, March 19, 2007 Objectives Slide notes: Page 1 of 41 Module 1: The Basics Of Real Time PCR Slide notes: Module 1: The Basics of real time PCR Page 2 of 41 Polymerase Chain Reaction Slide notes: Here is a review of PCR,

More information

Appendix A DNA and PCR in detail DNA: A Detailed Look

Appendix A DNA and PCR in detail DNA: A Detailed Look Appendix A DNA and PCR in detail DNA: A Detailed Look A DNA molecule is a long polymer consisting of four different components called nucleotides. It is the various combinations of these four bases or

More information

Genetics and Genomics in Medicine Chapter 3. Questions & Answers

Genetics and Genomics in Medicine Chapter 3. Questions & Answers Genetics and Genomics in Medicine Chapter 3 Multiple Choice Questions Questions & Answers Question 3.1 Which of the following statements, if any, is false? a) Amplifying DNA means making many identical

More information

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates.

Manipulating DNA. Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Lesson Overview 14.3 Studying the Human Genome Nucleic acids are chemically different from other macromolecules such as proteins and carbohydrates. Nucleic acids are chemically different from other macromolecules

More information

Quantitative Real Time PCR USING SYBR GREEN

Quantitative Real Time PCR USING SYBR GREEN Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology.

Recombinant DNA Technology. The Role of Recombinant DNA Technology in Biotechnology. yeast. Biotechnology. Recombinant DNA technology. PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology?

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Quant One Step RT-PCR Kit

Quant One Step RT-PCR Kit 1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant

More information

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions

Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog # reactions Absolute Human Telomere Length Quantification qpcr Assay Kit (AHTLQ) Catalog #8918 100 reactions Product Description Telomeres are repetitive nucleotide elements at the ends of chromosomes that protect

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines

Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Applied Biosystems Real-Time PCR Rapid Assay Development Guidelines Description This tutorial will discuss recommended guidelines for designing and running real-time PCR quantification and SNP Genotyping

More information

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)

QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007) QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.

More information

Basic Steps of the DNA process

Basic Steps of the DNA process As time pasted technology has improve the methods of analyzing DNA. One of the first methods for the analysis of DNA is known as Restriction Fragment Length Polymorphism (RFLP). This technique analyzed

More information

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR)

Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitation of mrna Using Real-Time Reverse Transcription PCR (RT-PCR) Quantitative Real-Time RT-PCR Versus RT-PCR In Real-Time RT- PCR, DNA amplification monitored at each cycle but RT-PCR measures the

More information

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...

Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol... Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.

More information

REAL TIME PCR. 1 of 12 12/30/2013 8:17 PM. PowerPoint version of this page. Dr Margaret Hunt

REAL TIME PCR. 1 of 12 12/30/2013 8:17 PM. PowerPoint version of this page. Dr Margaret Hunt 1 of 12 12/30/2013 8:17 PM x x x PowerPoint version of this page x To see larger images, click on the image which will be enlarged in a pop-up window. You must close this window before opening another.

More information

REAL TIME PCR. PowerPoint version of this page

REAL TIME PCR. PowerPoint version of this page REAL TIME PCR Dr Margaret Hunt PowerPoint version of this page To see larger images, click on the image which will be enlarged in a pop-up window. You must close this window before opening another. This

More information

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04

Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu

More information

Executive Summary. clinical supply services

Executive Summary. clinical supply services clinical supply services case study Development and NDA-level validation of quantitative polymerase chain reaction (qpcr) procedure for detection and quantification of residual E.coli genomic DNA Executive

More information

Roche Molecular Biochemicals Technical Note No. LC 9/2000

Roche Molecular Biochemicals Technical Note No. LC 9/2000 Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Introduction to Real-Time PCR: Basic Principles and Chemistries

Introduction to Real-Time PCR: Basic Principles and Chemistries Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the

More information

Sensitivity vs Specificity

Sensitivity vs Specificity Viral Detection Animal Inoculation Culturing the Virus Definitive Length of time Serology Detecting antibodies to the infectious agent Detecting Viral Proteins Western Blot ELISA Detecting the Viral Genome

More information

Advanced Techniques. Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays. AP Biology

Advanced Techniques. Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays. AP Biology Advanced Techniques Electrophoresis, PCR, Southern Blot, Sequencing, RFLPs, Microarrays 1 Gel Electrophoresis Separation of DNA fragments by size DNA is negatively charged moves toward + charge in electrical

More information

Quiz Submissions Quiz 4

Quiz Submissions Quiz 4 Quiz Submissions Quiz 4 Attempt 1 Written: Nov 1, 2015 17:35 Nov 1, 2015 22:19 Submission View Released: Nov 4, 2015 20:24 Question 1 0 / 1 point Three RNA polymerases synthesize most of the RNA present

More information

Premix Ex Taq (Probe qpcr)

Premix Ex Taq (Probe qpcr) For Research Use Premix Ex Taq (Probe qpcr) Product Manual Table of Contents I. Description... 3 II. Principle... 4 III. Components... 5 IV. Materials Required but not Provided... 5 V. Storage... 5 VI.

More information

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr

Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr Polymerase Chain Reaction: Application and Practical Primer Probe Design qrt-pcr review Enzyme based DNA amplification Thermal Polymerarase derived from a thermophylic bacterium DNA dependant DNA polymerase

More information

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods

Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information

Primer Design Ameer Effat M. Elfarash

Primer Design Ameer Effat M. Elfarash Primer Design Ameer Effat M. Elfarash Dept. of Genetics Fac. of Agriculture, Assiut Univ. amir_effat@yahoo.com PCR Cycle Each cycle (Round) of PCR contains 3 steps: 1- Denaturation 2- Primer annealing

More information

3 Designing Primers for Site-Directed Mutagenesis

3 Designing Primers for Site-Directed Mutagenesis 3 Designing Primers for Site-Directed Mutagenesis 3.1 Learning Objectives During the next two labs you will learn the basics of site-directed mutagenesis: you will design primers for the mutants you designed

More information

Some types of Mutagenesis

Some types of Mutagenesis Mutagenesis What Is a Mutation? Genetic information is encoded by the sequence of the nucleotide bases in DNA of the gene. The four nucleotides are: adenine (A), thymine (T), guanine (G), and cytosine

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Microarrays: since we use probes we obviously must know the sequences we are looking at!

Microarrays: since we use probes we obviously must know the sequences we are looking at! These background are needed: 1. - Basic Molecular Biology & Genetics DNA replication Transcription Post-transcriptional RNA processing Translation Post-translational protein modification Gene expression

More information

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr

USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Lecture 14 - PCR Applications and Lab Practicum (AMG text pp ) October 9, 2001

Lecture 14 - PCR Applications and Lab Practicum (AMG text pp ) October 9, 2001 Lecture 14 - PCR Applications and Lab Practicum (AMG text pp. 159-169) October 9, 2001 Diagnostic Applications of PCR There are three primary diagnostic applications of PCR: - detecting pathogens using

More information

Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to:

Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: Chapter 7 DNA Fingerprinting By the end of this chapter you will be able to: explain how crime scene evidence is collected and processed to obtain DNA describe how radioactive probes are used in DNA fingerprinting

More information

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING

LECTURE TOPICS 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS 5) RECOMBINANT DNA CONSTRUCTION AND GENE CLONING Page 1 of 25 Chapter 5 Notes Biochemistry 461 Fall 2010 CHAPTER 5, EXPLORING GENES: LECTURE TOPICS 1) RESTRICTION ENZYMES 2) GEL ELECTROPHORESIS OF DNA 3) DNA SEQUENCING, RNA SEQUENCING, DNA SYNTHESIS

More information

Gene Expression Technology

Gene Expression Technology Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase

Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase Highly efficient one-step PCR-based mutagenesis technique for large plasmids using high-fidelity DNA polymerase H. Liu, R. Ye and Y.Y. Wang Department of Medical Microbiology and Parasitology, School of

More information

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>

601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>> BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they

More information

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit

Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen

More information

Genetic Identity. Steve Harris SPASH - Biotechnology

Genetic Identity. Steve Harris SPASH - Biotechnology Genetic Identity Steve Harris SPASH - Biotechnology Comparison of Organisms ORGANISM GENES BASE PAIRS Lambda Phage 40 50,000 E.coli 400 5,000,000 Yeast 13,000 15,000,000 Human 20,000 3,000,000,000 (3 billion)

More information

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update

Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks

More information