USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE

Transcription

1 USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE Ed Desmond Acklnowledgment: Grace Lin, MS, Research Scientist Microbial Diseases Laboratory, CDPH 2012

2 MOLECULAR BEACON ASSAY (AT MDL) Target: DNA Realtime PCR PCR to amplify target sequences At the same time, Molecular beacon probes are used to detect INH and RIF resistance mutations. 2 MBs for INH (targeting katg & inha) 3 MBs for RIF (targeting core of rpob) 2

3 REAL-TIME PCR 2 components PCR to amplify target sequences. A system to monitor PCR product. Fluorophore-labeled probes An optical device to detect fluorescence Software to record data No post-pcr manipulations Fast when PCR is done, results are ready for interpretation. No amplicon contaminations icycler IQ5 3

4 What is a Molecular Beacon? Hair-pin structure Loop (15-30 nt) Stem (5-7 nt) Fluorophore Quencher 4

5 DATA FOR RIF 3 YEARS AFTER IMPLEMENTATION Cultures & sediments Combined data (186) RIF Phenotypic results R S MB Mutation detected 36 5 No mutations Inconclusive 2 4 5

6 DATA FOR INH 3 YEARS AFTER IMPLEMENTATION Cultures & sediments Combined data (186) INH Phenotypic results R S MB Mutation detected 44 1 No mutations Inconclusive 2 4 6

7 LIMITATIONS Limited genes & sites are targeted. Some mutations are not detected. Emerging resistance in mixed populations may not be detected. Some mutations do not confer resistance. Rare occurring, but lead to wrong interpretation. Silent mutation in rpob: codon 514. Not a silent mutation but only cause little change in MIC. Available for INH and RIF only. New MBs for other drugs not developed yet. Phenotypic drug susceptibility testing is still needed. 7

8 8

9 HOW DOES PYROSEQUENCING WORK? 9

10 Below are steps occur in pyrosequencer: 1. Incorporation of dntp generates ppi. 2. APS + ppi ATP, catalyzed by ATP sulfurylase. 3. Luciferin oxyluciferin, driven by ATP & catalyzed by luciferase. 4. Light released, proportional to dntp incorporated, recoded by CCD. 5. Apyrase degrades unincorporated dntp & ATP. When degradation is complete, another dntp will be added. 6. Pyrogram shows sequential event of dntp incorporated. The peak level is proportional to dntps incorporated. 10

11 PYROGRAM Hit 1: gyra resistant codon 94ggc Score: 100 Identities: 31/31 (100%) Query 1 CCACCCGCACGGCGACGCGTCGATCTACGGC 31 Library 1 CCACCCGCACGGCGACGCGTCGATCTACGGC 31 11

12 DETECTION OF DRUG RESISTANCE MUTATIONS Drugs of interest: For XDR screening INH, RIF, KAN, AMK, CAP, fqs Targeted Genes katg, inha promoter, ahpc for INH rpob for RIF rrs for KAN, AMK & CAP gyra for Quinolones 12

13 STUDY CONDUCTED TO DATE Tested purified and quantified DNA of H37Rv. Developed 8 assays for screening XDR TB. Optimized PCR. Optimized PSQ Tested strains without mutations for specificity. Tested strains with known mutations for sensitivity. The sensitivity is comparable to MB s. Tested 30+ sediments (smear 1+ to 4+). 13

14 COMPARISON OF TRADITIONAL SEQUENCING TO PYROSEQUENCING 14

15 G Lin PSQ

16 COMPARISON OF MB & PSQ MB PSQ Report Interpretation of silent mutations or mutations not conferring R Mutation present or not Misinterpret as R Exact SQ Does not misinterpret Objectivity on interpreting results More subjective More objective Hand-on time 1.5 hr, simple 2.5 hr, more steps Total test time 3.5 hr 5 hr 16

17 ADVANTAGES OF PSQ OVER MB Results show sequences. You would know what mutations are if present. More information provided and less ambiguity. Silent mutations do not lead to wrong interpretation. Mutations not conferring resistance do not lead to wrong interpretation. Difficult targets may still be sequenced. Not easy to design MBs for detection of fq mutations. Presence of specific mutations may predict susceptibility to moxifloxacin (gyra) or rifabutin (rpob) 17

18 ADVANTAGES OF MB OVER PSQ Easier to perform, less steps. Less hand-on time. Shorter total testing time. If no mutations present, easy to screen and eliminate susceptible strains. This may yield savings on materials and labor. 18

19 PYROSEQUENCING IMPLEMENTED MARCH 26, 2012 Same guidelines for submission as molecular beacons: Smear positive specimens or cultures Recommended when drug resistance is suspected, susceptible population has been exposed, or when there is a mixed culture with M. tb complex and non-tb mycobacteria Interpretation of sequence results developed in consultation with TB Control Branch 19

20 PYROSEQUENCING: WHAT TO LOOK FORWARD TO Same day detection of patients with extensively drug-resistant tuberculosis (XDRTB) = resistant to INH, rifampin, injectable drug, and fluoroquinolone Greater confidence when a mutation is detected, that it actually confers resistance Ability to test for resistance to other drugs, particularly those that give less reliable results with culture-based testing, e.g. ethambutol and pyrazinamide 20

21 MOX MIC & MUTATIONS IN GYRA MOX MIC (ug/ml) Mutations ( # of strains) 90gtg 94gcc 95acc 94ggc 91ccg 94cac 94tac % % % % % % % % Total # strains % 15% 15% 32.5% 5% 10% 2.5% Total # strains G Lin 21

22 WHY WE WILL CONTINUE TO DO CULTURES AS WELL AS DNA TESTING: Some old timers won t give up their cultures!

23 23

24 QUESTIONS? COMMENTS? 24