The pyrosequencing method" Instrumentation" Applications" ""SNP Analysis (SNP)" ""Allele Quantification (AQ)" ""Sequence Analysis (SQA)"

Size: px
Start display at page:

Download "The pyrosequencing method" Instrumentation" Applications" ""SNP Analysis (SNP)" ""Allele Quantification (AQ)" ""Sequence Analysis (SQA)""

Transcription

1 The pyrosequencing method" Instrumentation" Applications" ""SNP Analysis (SNP)" ""Allele Quantification (AQ)" ""Sequence Analysis (SQA)" 1

2 The pyrosequencing method" PPi ATP 2

3 The pyrosequencing method" - detection of the light" light time 3

4 Sequencing By Synthesis Sequencing- By- Synthesis Pyrophosphate signal generation DNA Capture Bead A A T C G G C A T G C T A A A A G T C A Sulfurylase APS PP i T Anneal Primer Luciferase ATP luciferin Light + oxy luciferin

5 The pyrosequencing method" - solution for applied DNA analysis" Sequence based technology" Accurate" Simple and robust" No labels or gels" Real-time results" 5

6 The pyrosequencing method" nucleotides dispensed sequentially" A! GG! C! A! G! A" G" C" T" A" G" the sequence in this pyrogram is AGGCAG! 6

7 Instrumentation" - PSQ 96" Automatic dispensation of reagents" 96 well format" CCD camera" Processes" " "500 samples per hour" " "4500 samples per day" 7

8 Instrumentation" The image cannot be displayed. Your computer may not have enough memory to open the image, or the image may have been corrupted. Restart your computer, and then open the file again. If the red x still appears, you may have to delete the image and then insert it again. - working with the PSQ 96" 1. Prepare samples " 2. Insert samples in PSQ 96 " 3. Insert reagent cartridge (enzymes, substrate, nucleotides)" 4. Start run" sequence automatically scored 8

9 Instrumentation" - PSQ HS 96A Automatic dispensation of reagents" 96 well format (It will be possible to upgrade to a 384- format in the future)" CCD camera" Processes" " "10000 samples per day" samples per day" (Triplex analysis)" 9

10 Instrumentation" The image cannot be displayed. Your computer may not have enough memory to open the image, or the image may have been corrupted. Restart your computer, and then open the file again. If the red x still appears, you may have to delete the image and then insert it again. - working with the PSQ HS 96A 1. Prepare samples " 2. Insert samples in PSQ HS 96A (up to 10 plates and two hours of unattended operation) " 3. Insert reagent cartridge (enzymes, substrate, nucleotides)" 4. Start run" sequence automatically scored 10

11 Vacuum Prep Tool 11

12 Applications" - one technology, many applications" Genetic variability (SNP, insertions, deletions) Haplotyping" Allele quantification / frequency" Expression profiling, clone identification etc." Bacterial and viral typing" Resistance typing" Mutation detection" Forensic study"..and more" 12

13 applications" - software modules for PSQ96" SNP Analysis " "(SNP)" Allele Quantification "(AQ)" Sequence Analysis "(SQA)" 13

14 applications" - SNP Analysis" - SNPs as genetic markers" Single Nucleotide Polymorphisms are isolated single base variations in the genome" Occur every bases along the 3 billion bases of the human genome" The most common form of genetic interindividual variation" The major source of phenotypic variability between individuals" 14

15 Applications" - SNP Analysis" - Pyrosequencing for SNP analysis" SNP! Discovery" SNP! Allele! Confirmation" Frequency! SNP! Relevance" SNP! Diagnostics! New SNPs" Sanger " In silico" etc..." Verify " SNP as " true SNP" Frequency" of SNP in" populations" Validate SNP" as marker " for phenotype" Utilization of " SNP markers" 15

16 Pyrogram Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"

17 PSQ96 Instrument

18 Primer pool 1 Primer pool 2 Primer pool 3 HPV-16 HPV-18 HPV-45 C C C A C G T A C G T A C G T A C G T A C G T A C G T HPV-31 HPV-33 HPV-35 G T G A C G T A C G T A C G T A C G T A C G T A C G T HPV-59 HPV-52 HPV-58 T G T A C G T A C G T A C G T A C G T A C G T A C G T HPV-39 HPV-56 HPV-51 C C G A C G T A C G T A C G T A C G T A C G T A C G T

19 Pyrosequencing, L1 MSPs Figure from Gharizadeh, B. et al. Sentinel-base DNA genotyping using multiple sequencing primers for high-risk human papillomaviruses. Molecular and Cellular Probes, H. Watson HPV Detection

20 HPV quadruple co- infec?on a) Primer pool 1 d) Primer pool 2 HPV- 16 HPV- 52 HPV- 31 HPV- 33 C G G T b) Specific primer HPV-16 3A e) Specific primer HPV-33 2G 2G 2A C A G C T A C T A T T G A T A c) Specific primer HPV-31 G A T A C T A C A 3T 4A f) Specific primer HPV-52 3A G G A C A C A T A

21 a HPV-16 HPV-18 Uon-specific amp. General primer General primer General primer General primer Mul?ple infec?ons and Non- specific amplifica?on products! b HPV-16 primer HPV-18 primer HPV-31 primer HPV-33 primer HPV-45 primer HPV-6 primer HPV-11 primer HPV-16 HPV-16 site General primer site HPV-18 Non-specific amp. HPV-18 site General primer site Sequencing and genotyping by pattern recognition Gharizadeh et al. Mol Cell Probes Gharizadeh et al. J Mol Diagn Gharizadeh et al. Mol Cell Probes. 2006

22 Sequencing of a low-yield PCR product containing Unspecific amplification products! a Sequenced by general primer b Sequenced and genotyped by multiple sequencing primers T A C A T A T A 5 T HPV-33 Sequence Pyrogram of HPV-33 c T A C A T A T A 5 T T

23 a General primer Pyrosequencing for Iden?fica?on of Fungi S. chartarum Irrelevant type Non-specific amp. General primer General primer General primer b S. chartarum primer S. elegans primer S. bisbyi primer S. species primer S. subsimplex primer S. kampalensis primer S. dichora primer S. chartarum Irrelevant type Non-specific amp. S. chartarum primer General primer site General primer site Sequencing and genotyping Kaller et al. Submitted 2007"

24 General Primer! T 2 C 2 T 2 C 3 G T 4 C 3 T G Specific Sequencing Primer Pool! G 2 C G C 3 G C 2 G 2 A G A C 4 A 3 C T C T 2!

25 G A T C G C A G T A C G A C A C Pyrosequencing for An?bio?c resistance a) Wild Type: GATTCCGCAGTTTACGACACC b) S91P and D95A: GATTTCGCAGTTTACGGCACC 3T 2T 2C 2C G A G C A G A C G A C A 3T 3T 2G 2C G A C G C A G A C C A c) S91P and D95G: GATTTCGCAGTTTACGCCACC 3T 3T 2C 2C G A C G C A G A C G A d) S91P: GATTTCGCAGTTTACGACACC 3T 3T 2C G A C G C A G A C G A C A e) D95N: GATTCCGCAGTTTACAACACC 3T 2T 2C 2A 2C G A G C A G A C C A

26 a) Group 1, Wild Type d) Group 4, S91P 3T 2T 2C 2C 3T 3T 2C G A G C A G A C G A C A G A C G C A G A C G A C A b) Group 2, S91P and D95A d) Group 5, D95N 3T 3T 3T G A C G C A G A C C A 2G 2C 2T 2C 2A 2C G A G C A G A C C A c) Group 3, S91P and D95G 3T 3T 2C 2C G A C G C A G A C G A Unemo et al. In Press APMIS 2007 Lindback et al. Mol Cell Probes Gharizadeh et al. Int J AnSmicrob Agents 2005

27 Pattern-recognition for improved genotyping! Multiple sequencing primer method and pattern recognition improves rapid genotyping!! The first few basecallings are enough for correct genotyping! Every sequence-pattern has its own characteristics!

28 Applications" - SNP Analysis" - Clearly distinguish heterozygotes and homozygotes" Homozygotes" ACTGCCT! Heterozygote" A/GCTGCCT! GCTGCCT! 28

29 Applications" - SNP Analysis" - SNP Analysis of HPV" 29

30 Applications" - SNP Analysis" - SNP Analysis" 5 ACTGCCT 3! 5 A/GCTGCCT 3! 5 GCTGCCT 3! 30

31 Applications" - SNP Analysis" - Insertions/deletions" Sequence to analyze: (C)ACGTGT... Theoretical Pyrosequencing output 4G/5G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations Theoretical Pyrosequencing output 4G/4G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations Theoretical Pyrosequencing output 5G/5G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations 31

32 Applications" - SNP Analysis" - multiplex genotyping by pyrosequencing "..analysis of more than one SNP per well!! Reduces cost per genotype" Increases efficiency " Increases speed...of genotyping studies" 32

33 Applications" - SNP Analysis" - principle of multiplex genotyping by pyrosequencing " SNPs located on different fragments.! 1." 2." 3."...or on the same! 33

34 Applications" - SNP Analysis" - analysis of several SNPs" 5 -C/TGGCCGGGTCACGAT/GGCCC-3! 34

35 Applications" - allele quantification" association/linkage studies" "genome-wide scans of SNPs!!!large sample populations! SNP confirmation" "potential SNPs identified in silico!!!snp confirmation in different ethnic populations! mutations associated with cancer"! presence of normal cells in tumor samples give mixed genotypes! Analysis of SNPs in polyploid genoms" " "" 35

36 Applications" - allele quantification" - pooling DNA samples"..influence efficiency and cost of SNP studies! Reduction in number of analyses" Reduced costs (reagents and labor)" Less genomic material required" 36

37 Applications" - allele quantification" - result from Karolinska Institute" 85.3%" 14.7%" SNP 1:!!!1126 individuals! SNP Software AQ:!!G: 14.7% T: 85.3%! Expected:!!!G: 15% T: 85%! 37

38 Applications" - sequence analysis" SQA - whenever a specific DNA sequence! needs to be analyzed! 38

39 Applications" - sequence analysis"...short and medium length DNA fragments! 96 well format" Fast and cost-effective Gel free, no dyes or labels Automatic scoring " Easy - installation & training within 1 1/2 day" Real-time sequence information from first base" 39

40 Applications" - sequence analysis" - Helicobacter pylori, a clinical case study" Associated with gastric cancer" Treatment: Clarithromycin, but combined antibiotic treatments often required due to resistant strains" Prof Lars Engstrand et al SMI, Uppsala Univ." 40

41 Applications" - sequence analysis" Identify H. Pylori! Analysis of 20 bases in the 16S rrna gene" Determine resistance/ sensitivity to clarithromycin " Analysis of 2 point mutations in the 23S rrna gene " Patient genotyping" - Helicobacter pylori" Interleukin 1 beta SNPs appear to be 41 linked to a susceptibility to gastric cancer"

42 Applications" - sequence analysis" - Identification of 16S rrna gene from H. pylori" Conserved region Conserved region H. pylori-specific region CGCGCAATCA GCGTCAGTAA = H. pylori! 131 isolates sequenced 126 correctly base called (99.87%) 42

43 Applications" - sequence analysis" - Determination of Clarithromycin resistance in H. pylori! 23S rrna gene AAA ( wt ) Sensitive GAA Resistant AGA Resistant 154 isolates genotyped 154 correctly typed (100%) 43

44 Applications" - sequence analysis" and Helicobacter pylori! -511! -31! Il-1 beta! A/A " G/A! G/G! 44

45 Applications" - sequence analysis" - typical time course! Isolate DNA PCR - pure culture -gastric biopsies (H. pylori) 10 min-1 h 2.5 h Preparation of PCR-products manual preparation of 96 samples <1 h Pyrosequencing <1 h <5 h 45

46 Summary: The strength of Pyrosequencing" Many applications" Accurate" Sequence confirmation (compared to yes/no)" Fast, 96 genotypes in 10 minutes" Easy, little hands-on and short optimization time" 96-well format easy to automate" Automatic scoring of the results " 46

47 Template Tailoring for DNA FingerPrin?ng Seq. primer Bio TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. ACGTU TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. Seq. primer ACGTU TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. TCAC. ACGT. Bio

48 DNA Finger Prin?ng Sample D29629, locus D7S820 (9/10 repeats): Sample D29630, locus D7S820 (8/11 repeats): Sample D29624, locus D16S539 (9/12 repeats):

49 ~16 ~39 ~56 ~68 ~73 ~34 ~42 ~45 ~52 ~59 ~69 HPV MIP- assay ~6b ~31 ~35 ~11 ~51 ~33 ~40 ~43 ~58 ~82 ~18 ~44 ~ bp E6 E2 E5 L1 E7 E1 E4 L2 UTR U 1 /U 2 Pyrosequencing by barcodes β-globin + β-globin + HPV-16 + HPV-18 + Inverted Probes Validation Microarray chip with barcodes β-globin + β-globin + HPV-16 + HPV-18 + Chip1 Chip2 β-globin HPV-6 HPV-11 HPV-16 HPV-18 HPV-31 HPV-33 HPV-34 HPV-35 HPV-39 HPV-40 HPV-42 PGMY MY09/11 GP5+/6+ SPF 10 ~ 65 bp Conventional genotyping region, ~ 450 bp ~150 bp Validation Cloning or hybridization based screening MULTIPLEX- MULTIPLEXING! conventional method HPV Detection

50 Rapid, Low- Cost, Accurate Diagnos?c Test for Poten?ally Pandemic Influenza

51 Alignment of 362 Strains of H5N1

52

53 Ini?al Results of Proof of Principle Experiment with CDC (using PCR, mulsplex pyrosequencing & mulsple sequencing primers) ChrarcterizaSon of the hemagglusnin from the H5N1 influenza viruses tested. G l y c o s y l a t i o n M o t i f ( N X T / S, X P ) a t a a 154 R e c e p t o r B i n d i n g P o c k e t ( ) C l e a v a g e M o t i f H o s t / O u t c o m e H A V i r u s N a m e C l a d e G o o s e / G u a n g d o n g / 1 / 96 - P r e s e n t G Q S G R R R K K R G o o s e H o n g K o n g / 156 / 97 3 A b s e n t G Q S G R R R K K R H u m a n / D i e d H o n g K o n g / 483 / 97 3 P r e s e n t G Q S G R R R K K R H u m a n / D i e d H o n g K o n g / 213 / 03 1 P r e s e n t G Q N G R R R K K R H u m a n / D i e d V i e t n a m / 1203 / 04 1 P r e s e n t G Q S G R R R K K R H u m a n / D i e d V i e t n a m / J P 14 / 05 1 P r e s e n t G Q S G R R R K K R H u m a n / D i e d V i e t n a m / H N / 05 1 P r e s e n t G Q S G R R K K R H u m a n / S u r v i v e d C h i c k e n / K o r e a / E S / 03 I n d o n e s i a / 5 / A b s e n t P r e s e n t G Q S G G Q S G K R K K R S R R K K R C h i c k e n H u m a n / D i e d Pourmand et al. Rapid and highly Informative Diagnostic Assay for H5N1 Influenza Viruses. PLoS One 2006"

54 Pyrosequencing Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"

55 Pyrosequencing - Solid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"

56 Pyrosequencing - Liquid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"

57 Bioluminescence Regenera?ve Cycle (BRC) The Principle US Patent B &" Hassibi et al. Biophys Chem 2005"

58 BRC Performance Characteris?cs

59 BRC Prototype Performance over 4 orders of magnitude 200 picom 20 picom 2 picom 200 femtom 20 femtom

60 Samples in Human Serum Clean sample Sample in 10% serum 200 picom sample

61 Applications" - SNP Analysis" - SNP Analysis of HPV" 61

62 Applications" - SNP Analysis" "-Human papilloma virus (HPV)" "-Angiotensin converting enzyme (ACE)" "-Melanocortin receptor 1 (MC1R)" "-Leukocyte adhesion deficiency (LAD) "" "-Obesity" "-Helicobactor pylori (IL-1B gastric cancer)" "-Apolipoprotein E (Alzheimer s disease)" " 62

63 gyra Pyro results Codon 87 Codon 83

64 Applications" - sequence analysis" - SQA Software: Evaluation" Automatic base calling by dedicated algorithm" Editing of sequence" Color coding shows quality for each well" Basic alignment function" 64

65 mexr pyro results

7. Troubleshooting Guidelines

7. Troubleshooting Guidelines 7. Troubleshooting Guidelines The Pyrosequencing TM technique provides the user with sequence information for several nucleotides 3 of the sequencing primer apart from the polymorphic site. This gives

More information

Discovery of single nucleotide polymorphisms and mutations by Pyrosequencing

Discovery of single nucleotide polymorphisms and mutations by Pyrosequencing Comparative and Functional Genomics Comp Funct Genom 2002; 3: 51 56. DOI: 10.1002 / cfg.132 Review Discovery of single nucleotide polymorphisms and mutations by Pyrosequencing Mostafa Ronaghi 1 * and Elahe

More information

Chapter 7. DNA Microarrays

Chapter 7. DNA Microarrays Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

Advances and New Technologies in Forensic DNA

Advances and New Technologies in Forensic DNA Advances and New Technologies in Forensic DNA Nader Pourmand, PhD Department of Biomolecular Engineering, University of California, Santa Cruz Branch Migratio 3 nbp 6 3 5 3 5 bp 14 bp 23 5 3 5 3 5 Bioluminescence

More information

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis 1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format

For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format ProductProfile PyroMark Q24 For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format The PyroMark Q24 uses proven Pyrosequencing technology for real-time,

More information

Pyrosequencing. Alix Groom

Pyrosequencing. Alix Groom Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases

More information

The Use of Pyrosequencing for Genomic Sequence Determination

The Use of Pyrosequencing for Genomic Sequence Determination The Use of Pyrosequencing for Genomic Sequence Determination Rongahi, Mostafa. (2001). Pyrosequencing Sheds Light on DNA Sequencing. Genome Research. 11: 3-11. Zhou, G., Tomoharu, K., et al. (2006). Enzyme

More information

Applicazioni biotecnologiche

Applicazioni biotecnologiche Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence

More information

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017

Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Molecular Diagnostics Molecular Diagnostics? Molecular Diagnostics FISH or CISH techniques FISH or CISH techniques FISH or CISH

More information

Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting

Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast

More information

Human genetic variation

Human genetic variation Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants

More information

Lecture 8: Sequencing and SNP. Sept 15, 2006

Lecture 8: Sequencing and SNP. Sept 15, 2006 Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics

More information

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze

Marker types. Potato Association of America Frederiction August 9, Allen Van Deynze Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,

More information

Genetics and Biotechnology. Section 1. Applied Genetics

Genetics and Biotechnology. Section 1. Applied Genetics Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section

More information

Applications and Uses. (adapted from Roche RealTime PCR Application Manual)

Applications and Uses. (adapted from Roche RealTime PCR Application Manual) What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it

More information

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze

SolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David

More information

LATE-PCR. Linear-After-The-Exponential

LATE-PCR. Linear-After-The-Exponential LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,

More information

Genomes contain all of the information needed for an organism to grow and survive.

Genomes contain all of the information needed for an organism to grow and survive. Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the

More information

The HLA Community s Success in Combining Clinical & Genomic Data

The HLA Community s Success in Combining Clinical & Genomic Data The HLA Community s Success in Combining Clinical & Genomic Data Elizabeth Trachtenberg MS, PhD, DABHI Director, Center for Applied Genomics HLA/Immunogenetics Laboratory Children s Hospital & Research

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Current molecular diagnostic system

Current molecular diagnostic system LAMP-BART Name: Chris Wong Supervisor: Prof. Margaret Ip Joint Graduate Seminar Department of Microbiology The Chinese University of Hong Kong 18 th December 2012 Current molecular diagnostic system Detection

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little

More information

USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE

USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE Ed Desmond Acklnowledgment: Grace Lin, MS, Research Scientist Microbial Diseases Laboratory, CDPH 2012 MOLECULAR BEACON ASSAY (AT MDL) Target: DNA

More information

Authors: Vivek Sharma and Ram Kunwar

Authors: Vivek Sharma and Ram Kunwar Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be

More information

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects. Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution

More information

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for

More information

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg

DNA Technology. Asilomar Singer, Zinder, Brenner, Berg DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other

More information

1

1 1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using

More information

Relative Fluorescent Quantitation on Capillary Electrophoresis Systems:

Relative Fluorescent Quantitation on Capillary Electrophoresis Systems: Application Note Relative Fluorescent Quantitation on the 3130 Series Systems Relative Fluorescent Quantitation on Capillary Electrophoresis Systems: Screening for Loss of Heterozygosity in Tumor Samples

More information

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall

Genome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with

More information

High-Resolution Melting Interactive Workshop AACC, July 25 th, 2006 Assay Description

High-Resolution Melting Interactive Workshop AACC, July 25 th, 2006 Assay Description AACC, July 25 th, 2006 Assay Description List of Example Assays Page Technique Example assay 2 Unlabeled probe genotyping HR-1 Factor V Leiden mutation 6 Unlabeled probe genotyping - LightScanner Factor

More information

A Crash Course in NGS for GI Pathologists. Sandra O Toole

A Crash Course in NGS for GI Pathologists. Sandra O Toole A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble

More information

White Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates

White Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates White Paper High Throughput SNP Genotyping White Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates Miniaturization and Automation Using a Novel New Reaction Substrate Originally

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

What is Bioinformatics?

What is Bioinformatics? What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is

More information

Genomic systems 67. Pathologus Kongresszus Keszthely, október 9-11.

Genomic systems 67. Pathologus Kongresszus Keszthely, október 9-11. Diagnostics Genomic systems 67. Pathologus Kongresszus Keszthely, 2008. október 9-11. Péter Becságh Diagnostics Real Time Cell Analysis RAS Workflow Integration 7 6 5 T A C G 4 3 2 1 0 1 25 49 73 97 121

More information

SureSelect XT HS. Target Enrichment

SureSelect XT HS. Target Enrichment SureSelect XT HS Target Enrichment What Is It? SureSelect XT HS joins the SureSelect library preparation reagent family as Agilent s highest sensitivity hybrid capture-based library prep and target enrichment

More information

APPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS

APPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS APPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS Hossein Keyvani Basic Diagnostic Methods in Virology Immunology and serology techniques (Antigen-Antibody Reactions) 1 ELISA ( Enzyme

More information

Molecular Biology (2)

Molecular Biology (2) Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within

More information

Genomic resources. for non-model systems

Genomic resources. for non-model systems Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing

More information

Pyrosequencing for quantitative analysis of methylation at multiple CpG sites

Pyrosequencing for quantitative analysis of methylation at multiple CpG sites Application Note for Nature Methods Pyrosequencing for quantitative analysis of methylation at multiple CpG sites Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every

More information

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International

GENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray

More information

2. Pyrosequencing Assay Design

2. Pyrosequencing Assay Design 2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about

More information

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping

LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for

More information

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)

BIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9

More information

BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:

BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name: 1. (20 points) Give the name of a mutagen that could cause the following damages to DNA: a) Thymidine dimers UV b) Breakage of DNA backbone X-Ray c) 2 bp insertion (frameshift mutation) proflavin, acridine

More information

Biotechnology Chapter 20

Biotechnology Chapter 20 Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Journal Club Kairi Raime

Journal Club Kairi Raime Journal Club 23.05.2014 Kairi Raime Introduction Small biases in amplification efficiency can quantitatively translated into substantial differences in amplicon concentrations Potential for exploiting

More information

Analysis of gene function

Analysis of gene function Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or

More information

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend

Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel

More information

Multiple choice questions (numbers in brackets indicate the number of correct answers)

Multiple choice questions (numbers in brackets indicate the number of correct answers) 1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer

More information

Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM

Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every aspect of CpG methylation analysis:

More information

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.

GENETICS - CLUTCH CH.15 GENOMES AND GENOMICS. !! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics. a. Transcriptomics b. Proteomics

I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics. a. Transcriptomics b. Proteomics I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics a. Transcriptomics b. Proteomics Fields of Genomics Structural genomics Functional genomics Transcriptomics Proteomics

More information

II. Integrative Genomics interactions between molecules and genes

II. Integrative Genomics interactions between molecules and genes . Structural Genomics Structure of Genome I. Functional Genomics Expression of Genome a. Transcriptomics b. Proteomics II. Integrative Genomics interactions between molecules and genes Fields of Genomics

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population

High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Research and Development Station for Bovine, Arad, Romania High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Daniela Elena Ilie, Ada Cean, Ioan

More information

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:

Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.

More information

Germline Genotyping and Highly Sensitive Mutation Detection on the MassARRAY System

Germline Genotyping and Highly Sensitive Mutation Detection on the MassARRAY System Sensitivity Across the Spectrum Results Reporting iplex and UltraSEEK chemistries are compatible with a broad range of nucleic acid biomarkers, from standard germline genotypes to rare somatic variants.

More information

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016

Bi 8 Lecture 5. Ellen Rothenberg 19 January 2016 Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA

More information

Mutations during meiosis and germ line division lead to genetic variation between individuals

Mutations during meiosis and germ line division lead to genetic variation between individuals Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements

More information

Multiplex Assay Design

Multiplex Assay Design Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex

More information

Biochemistry 412. New Strategies & Technologies For DNA Sequencing. 2 February 2007

Biochemistry 412. New Strategies & Technologies For DNA Sequencing. 2 February 2007 Biochemistry 412 New Strategies & Technologies For DNA Sequencing 2 February 2007 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00 In 2003, the sequencing

More information

Bio 311 Learning Objectives

Bio 311 Learning Objectives Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,

More information

Welcome to the NGS webinar series

Welcome to the NGS webinar series Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic

More information

Advanced Technology in Phytoplasma Research

Advanced Technology in Phytoplasma Research Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM

SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400

More information

Molecular Biology and Functional Genomic Core Facility

Molecular Biology and Functional Genomic Core Facility Molecular Biology and Functional Genomic Core Facility General Presentation Dr Odile Neyret Core Manager Myriam Rondeau Research Assistant Agnès Dumont Research Assistant Institut de recherche clinique

More information

Research techniques in genetics. Medical genetics, 2017.

Research techniques in genetics. Medical genetics, 2017. Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

ADIPO-screen kit. Instruction Manual

ADIPO-screen kit. Instruction Manual For Professional Use Only ADIPO-screen kit Instruction Manual AmpliSens Federal Budget Institute of Science Central Research Institute for Epidemiology 3A Novogireevskaya Street Moscow 111123 Russia TABLE

More information

Methods in virus diagnosis PCR techniques

Methods in virus diagnosis PCR techniques Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that

More information

SNP calling and VCF format

SNP calling and VCF format SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide

More information

Frequently asked questions

Frequently asked questions Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000

More information

SmartChip Real-Time PCR System

SmartChip Real-Time PCR System SmartChip Real-Time PCR System Where throughput meets flexibility For Research Use Only. Not for use in diagnostic procedures. 2017 Takara Bio Inc. All rights reserved. All trademarks are the property

More information

Using mutants to clone genes

Using mutants to clone genes Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype

More information

CHEM 4420 Exam I Spring 2013 Page 1 of 6

CHEM 4420 Exam I Spring 2013 Page 1 of 6 CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions

More information

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies

Outline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology

More information

PCB Fa Falll l2012

PCB Fa Falll l2012 PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High

More information

GREG GIBSON SPENCER V. MUSE

GREG GIBSON SPENCER V. MUSE A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.

More information

amplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009

amplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009 amplification tech note 6009 High Resolution Melt Parameter Considerations for Optimal Data Resolution Carl Fisher, Ray Meng, Francisco Bizouarn, and Rachel Scott Gene Expression Division, Bio-Rad Laboratories,

More information

The Polymerase Chain Reaction. Chapter 6: Background

The Polymerase Chain Reaction. Chapter 6: Background The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for

More information

Concepts: What are RFLPs and how do they act like genetic marker loci?

Concepts: What are RFLPs and how do they act like genetic marker loci? Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th

More information

STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR

STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)

More information

Introductory Next Gen Workshop

Introductory Next Gen Workshop Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview

More information

MassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE)

MassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System * Overview Next-generation

More information

Cancer Genetics Solutions

Cancer Genetics Solutions Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting

More information

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013

Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013 Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:

1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: 1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Gene mutation and DNA polymorphism

Gene mutation and DNA polymorphism Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes

More information

UltraFast Molecular Diagnostic System

UltraFast Molecular Diagnostic System UltraFast Molecular Diagnostic System CONTENTS 01 PCR vs Real-time PCR 02 NANOBIOSYS Sample Prep G2-16TU 03 NANOBIOSYS Real-time PCR G2-4 01 PCR vs Real-time PCR What is DNA & What is PCR? NANOBIOSYS 4

More information

Genetics Lecture 21 Recombinant DNA

Genetics Lecture 21 Recombinant DNA Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of

More information