The pyrosequencing method" Instrumentation" Applications" ""SNP Analysis (SNP)" ""Allele Quantification (AQ)" ""Sequence Analysis (SQA)"
|
|
- Maryann Pierce
- 6 years ago
- Views:
Transcription
1 The pyrosequencing method" Instrumentation" Applications" ""SNP Analysis (SNP)" ""Allele Quantification (AQ)" ""Sequence Analysis (SQA)" 1
2 The pyrosequencing method" PPi ATP 2
3 The pyrosequencing method" - detection of the light" light time 3
4 Sequencing By Synthesis Sequencing- By- Synthesis Pyrophosphate signal generation DNA Capture Bead A A T C G G C A T G C T A A A A G T C A Sulfurylase APS PP i T Anneal Primer Luciferase ATP luciferin Light + oxy luciferin
5 The pyrosequencing method" - solution for applied DNA analysis" Sequence based technology" Accurate" Simple and robust" No labels or gels" Real-time results" 5
6 The pyrosequencing method" nucleotides dispensed sequentially" A! GG! C! A! G! A" G" C" T" A" G" the sequence in this pyrogram is AGGCAG! 6
7 Instrumentation" - PSQ 96" Automatic dispensation of reagents" 96 well format" CCD camera" Processes" " "500 samples per hour" " "4500 samples per day" 7
8 Instrumentation" The image cannot be displayed. Your computer may not have enough memory to open the image, or the image may have been corrupted. Restart your computer, and then open the file again. If the red x still appears, you may have to delete the image and then insert it again. - working with the PSQ 96" 1. Prepare samples " 2. Insert samples in PSQ 96 " 3. Insert reagent cartridge (enzymes, substrate, nucleotides)" 4. Start run" sequence automatically scored 8
9 Instrumentation" - PSQ HS 96A Automatic dispensation of reagents" 96 well format (It will be possible to upgrade to a 384- format in the future)" CCD camera" Processes" " "10000 samples per day" samples per day" (Triplex analysis)" 9
10 Instrumentation" The image cannot be displayed. Your computer may not have enough memory to open the image, or the image may have been corrupted. Restart your computer, and then open the file again. If the red x still appears, you may have to delete the image and then insert it again. - working with the PSQ HS 96A 1. Prepare samples " 2. Insert samples in PSQ HS 96A (up to 10 plates and two hours of unattended operation) " 3. Insert reagent cartridge (enzymes, substrate, nucleotides)" 4. Start run" sequence automatically scored 10
11 Vacuum Prep Tool 11
12 Applications" - one technology, many applications" Genetic variability (SNP, insertions, deletions) Haplotyping" Allele quantification / frequency" Expression profiling, clone identification etc." Bacterial and viral typing" Resistance typing" Mutation detection" Forensic study"..and more" 12
13 applications" - software modules for PSQ96" SNP Analysis " "(SNP)" Allele Quantification "(AQ)" Sequence Analysis "(SQA)" 13
14 applications" - SNP Analysis" - SNPs as genetic markers" Single Nucleotide Polymorphisms are isolated single base variations in the genome" Occur every bases along the 3 billion bases of the human genome" The most common form of genetic interindividual variation" The major source of phenotypic variability between individuals" 14
15 Applications" - SNP Analysis" - Pyrosequencing for SNP analysis" SNP! Discovery" SNP! Allele! Confirmation" Frequency! SNP! Relevance" SNP! Diagnostics! New SNPs" Sanger " In silico" etc..." Verify " SNP as " true SNP" Frequency" of SNP in" populations" Validate SNP" as marker " for phenotype" Utilization of " SNP markers" 15
16 Pyrogram Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"
17 PSQ96 Instrument
18 Primer pool 1 Primer pool 2 Primer pool 3 HPV-16 HPV-18 HPV-45 C C C A C G T A C G T A C G T A C G T A C G T A C G T HPV-31 HPV-33 HPV-35 G T G A C G T A C G T A C G T A C G T A C G T A C G T HPV-59 HPV-52 HPV-58 T G T A C G T A C G T A C G T A C G T A C G T A C G T HPV-39 HPV-56 HPV-51 C C G A C G T A C G T A C G T A C G T A C G T A C G T
19 Pyrosequencing, L1 MSPs Figure from Gharizadeh, B. et al. Sentinel-base DNA genotyping using multiple sequencing primers for high-risk human papillomaviruses. Molecular and Cellular Probes, H. Watson HPV Detection
20 HPV quadruple co- infec?on a) Primer pool 1 d) Primer pool 2 HPV- 16 HPV- 52 HPV- 31 HPV- 33 C G G T b) Specific primer HPV-16 3A e) Specific primer HPV-33 2G 2G 2A C A G C T A C T A T T G A T A c) Specific primer HPV-31 G A T A C T A C A 3T 4A f) Specific primer HPV-52 3A G G A C A C A T A
21 a HPV-16 HPV-18 Uon-specific amp. General primer General primer General primer General primer Mul?ple infec?ons and Non- specific amplifica?on products! b HPV-16 primer HPV-18 primer HPV-31 primer HPV-33 primer HPV-45 primer HPV-6 primer HPV-11 primer HPV-16 HPV-16 site General primer site HPV-18 Non-specific amp. HPV-18 site General primer site Sequencing and genotyping by pattern recognition Gharizadeh et al. Mol Cell Probes Gharizadeh et al. J Mol Diagn Gharizadeh et al. Mol Cell Probes. 2006
22 Sequencing of a low-yield PCR product containing Unspecific amplification products! a Sequenced by general primer b Sequenced and genotyped by multiple sequencing primers T A C A T A T A 5 T HPV-33 Sequence Pyrogram of HPV-33 c T A C A T A T A 5 T T
23 a General primer Pyrosequencing for Iden?fica?on of Fungi S. chartarum Irrelevant type Non-specific amp. General primer General primer General primer b S. chartarum primer S. elegans primer S. bisbyi primer S. species primer S. subsimplex primer S. kampalensis primer S. dichora primer S. chartarum Irrelevant type Non-specific amp. S. chartarum primer General primer site General primer site Sequencing and genotyping Kaller et al. Submitted 2007"
24 General Primer! T 2 C 2 T 2 C 3 G T 4 C 3 T G Specific Sequencing Primer Pool! G 2 C G C 3 G C 2 G 2 A G A C 4 A 3 C T C T 2!
25 G A T C G C A G T A C G A C A C Pyrosequencing for An?bio?c resistance a) Wild Type: GATTCCGCAGTTTACGACACC b) S91P and D95A: GATTTCGCAGTTTACGGCACC 3T 2T 2C 2C G A G C A G A C G A C A 3T 3T 2G 2C G A C G C A G A C C A c) S91P and D95G: GATTTCGCAGTTTACGCCACC 3T 3T 2C 2C G A C G C A G A C G A d) S91P: GATTTCGCAGTTTACGACACC 3T 3T 2C G A C G C A G A C G A C A e) D95N: GATTCCGCAGTTTACAACACC 3T 2T 2C 2A 2C G A G C A G A C C A
26 a) Group 1, Wild Type d) Group 4, S91P 3T 2T 2C 2C 3T 3T 2C G A G C A G A C G A C A G A C G C A G A C G A C A b) Group 2, S91P and D95A d) Group 5, D95N 3T 3T 3T G A C G C A G A C C A 2G 2C 2T 2C 2A 2C G A G C A G A C C A c) Group 3, S91P and D95G 3T 3T 2C 2C G A C G C A G A C G A Unemo et al. In Press APMIS 2007 Lindback et al. Mol Cell Probes Gharizadeh et al. Int J AnSmicrob Agents 2005
27 Pattern-recognition for improved genotyping! Multiple sequencing primer method and pattern recognition improves rapid genotyping!! The first few basecallings are enough for correct genotyping! Every sequence-pattern has its own characteristics!
28 Applications" - SNP Analysis" - Clearly distinguish heterozygotes and homozygotes" Homozygotes" ACTGCCT! Heterozygote" A/GCTGCCT! GCTGCCT! 28
29 Applications" - SNP Analysis" - SNP Analysis of HPV" 29
30 Applications" - SNP Analysis" - SNP Analysis" 5 ACTGCCT 3! 5 A/GCTGCCT 3! 5 GCTGCCT 3! 30
31 Applications" - SNP Analysis" - Insertions/deletions" Sequence to analyze: (C)ACGTGT... Theoretical Pyrosequencing output 4G/5G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations Theoretical Pyrosequencing output 4G/4G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations Theoretical Pyrosequencing output 5G/5G peak heights 1,2 1 0,8 0,6 0,4 0,2 0 T C G T A C G T G T dispensations 31
32 Applications" - SNP Analysis" - multiplex genotyping by pyrosequencing "..analysis of more than one SNP per well!! Reduces cost per genotype" Increases efficiency " Increases speed...of genotyping studies" 32
33 Applications" - SNP Analysis" - principle of multiplex genotyping by pyrosequencing " SNPs located on different fragments.! 1." 2." 3."...or on the same! 33
34 Applications" - SNP Analysis" - analysis of several SNPs" 5 -C/TGGCCGGGTCACGAT/GGCCC-3! 34
35 Applications" - allele quantification" association/linkage studies" "genome-wide scans of SNPs!!!large sample populations! SNP confirmation" "potential SNPs identified in silico!!!snp confirmation in different ethnic populations! mutations associated with cancer"! presence of normal cells in tumor samples give mixed genotypes! Analysis of SNPs in polyploid genoms" " "" 35
36 Applications" - allele quantification" - pooling DNA samples"..influence efficiency and cost of SNP studies! Reduction in number of analyses" Reduced costs (reagents and labor)" Less genomic material required" 36
37 Applications" - allele quantification" - result from Karolinska Institute" 85.3%" 14.7%" SNP 1:!!!1126 individuals! SNP Software AQ:!!G: 14.7% T: 85.3%! Expected:!!!G: 15% T: 85%! 37
38 Applications" - sequence analysis" SQA - whenever a specific DNA sequence! needs to be analyzed! 38
39 Applications" - sequence analysis"...short and medium length DNA fragments! 96 well format" Fast and cost-effective Gel free, no dyes or labels Automatic scoring " Easy - installation & training within 1 1/2 day" Real-time sequence information from first base" 39
40 Applications" - sequence analysis" - Helicobacter pylori, a clinical case study" Associated with gastric cancer" Treatment: Clarithromycin, but combined antibiotic treatments often required due to resistant strains" Prof Lars Engstrand et al SMI, Uppsala Univ." 40
41 Applications" - sequence analysis" Identify H. Pylori! Analysis of 20 bases in the 16S rrna gene" Determine resistance/ sensitivity to clarithromycin " Analysis of 2 point mutations in the 23S rrna gene " Patient genotyping" - Helicobacter pylori" Interleukin 1 beta SNPs appear to be 41 linked to a susceptibility to gastric cancer"
42 Applications" - sequence analysis" - Identification of 16S rrna gene from H. pylori" Conserved region Conserved region H. pylori-specific region CGCGCAATCA GCGTCAGTAA = H. pylori! 131 isolates sequenced 126 correctly base called (99.87%) 42
43 Applications" - sequence analysis" - Determination of Clarithromycin resistance in H. pylori! 23S rrna gene AAA ( wt ) Sensitive GAA Resistant AGA Resistant 154 isolates genotyped 154 correctly typed (100%) 43
44 Applications" - sequence analysis" and Helicobacter pylori! -511! -31! Il-1 beta! A/A " G/A! G/G! 44
45 Applications" - sequence analysis" - typical time course! Isolate DNA PCR - pure culture -gastric biopsies (H. pylori) 10 min-1 h 2.5 h Preparation of PCR-products manual preparation of 96 samples <1 h Pyrosequencing <1 h <5 h 45
46 Summary: The strength of Pyrosequencing" Many applications" Accurate" Sequence confirmation (compared to yes/no)" Fast, 96 genotypes in 10 minutes" Easy, little hands-on and short optimization time" 96-well format easy to automate" Automatic scoring of the results " 46
47 Template Tailoring for DNA FingerPrin?ng Seq. primer Bio TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. ACGTU TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. Seq. primer ACGTU TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. TCAC. ACGT. TCAC. ACGT. Bio
48 DNA Finger Prin?ng Sample D29629, locus D7S820 (9/10 repeats): Sample D29630, locus D7S820 (8/11 repeats): Sample D29624, locus D16S539 (9/12 repeats):
49 ~16 ~39 ~56 ~68 ~73 ~34 ~42 ~45 ~52 ~59 ~69 HPV MIP- assay ~6b ~31 ~35 ~11 ~51 ~33 ~40 ~43 ~58 ~82 ~18 ~44 ~ bp E6 E2 E5 L1 E7 E1 E4 L2 UTR U 1 /U 2 Pyrosequencing by barcodes β-globin + β-globin + HPV-16 + HPV-18 + Inverted Probes Validation Microarray chip with barcodes β-globin + β-globin + HPV-16 + HPV-18 + Chip1 Chip2 β-globin HPV-6 HPV-11 HPV-16 HPV-18 HPV-31 HPV-33 HPV-34 HPV-35 HPV-39 HPV-40 HPV-42 PGMY MY09/11 GP5+/6+ SPF 10 ~ 65 bp Conventional genotyping region, ~ 450 bp ~150 bp Validation Cloning or hybridization based screening MULTIPLEX- MULTIPLEXING! conventional method HPV Detection
50 Rapid, Low- Cost, Accurate Diagnos?c Test for Poten?ally Pandemic Influenza
51 Alignment of 362 Strains of H5N1
52
53 Ini?al Results of Proof of Principle Experiment with CDC (using PCR, mulsplex pyrosequencing & mulsple sequencing primers) ChrarcterizaSon of the hemagglusnin from the H5N1 influenza viruses tested. G l y c o s y l a t i o n M o t i f ( N X T / S, X P ) a t a a 154 R e c e p t o r B i n d i n g P o c k e t ( ) C l e a v a g e M o t i f H o s t / O u t c o m e H A V i r u s N a m e C l a d e G o o s e / G u a n g d o n g / 1 / 96 - P r e s e n t G Q S G R R R K K R G o o s e H o n g K o n g / 156 / 97 3 A b s e n t G Q S G R R R K K R H u m a n / D i e d H o n g K o n g / 483 / 97 3 P r e s e n t G Q S G R R R K K R H u m a n / D i e d H o n g K o n g / 213 / 03 1 P r e s e n t G Q N G R R R K K R H u m a n / D i e d V i e t n a m / 1203 / 04 1 P r e s e n t G Q S G R R R K K R H u m a n / D i e d V i e t n a m / J P 14 / 05 1 P r e s e n t G Q S G R R R K K R H u m a n / D i e d V i e t n a m / H N / 05 1 P r e s e n t G Q S G R R K K R H u m a n / S u r v i v e d C h i c k e n / K o r e a / E S / 03 I n d o n e s i a / 5 / A b s e n t P r e s e n t G Q S G G Q S G K R K K R S R R K K R C h i c k e n H u m a n / D i e d Pourmand et al. Rapid and highly Informative Diagnostic Assay for H5N1 Influenza Viruses. PLoS One 2006"
54 Pyrosequencing Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"
55 Pyrosequencing - Solid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"
56 Pyrosequencing - Liquid Phase Ronaghi M. Pyrosequencing sheds light on DNA sequencing. Genome Res 2001"
57 Bioluminescence Regenera?ve Cycle (BRC) The Principle US Patent B &" Hassibi et al. Biophys Chem 2005"
58 BRC Performance Characteris?cs
59 BRC Prototype Performance over 4 orders of magnitude 200 picom 20 picom 2 picom 200 femtom 20 femtom
60 Samples in Human Serum Clean sample Sample in 10% serum 200 picom sample
61 Applications" - SNP Analysis" - SNP Analysis of HPV" 61
62 Applications" - SNP Analysis" "-Human papilloma virus (HPV)" "-Angiotensin converting enzyme (ACE)" "-Melanocortin receptor 1 (MC1R)" "-Leukocyte adhesion deficiency (LAD) "" "-Obesity" "-Helicobactor pylori (IL-1B gastric cancer)" "-Apolipoprotein E (Alzheimer s disease)" " 62
63 gyra Pyro results Codon 87 Codon 83
64 Applications" - sequence analysis" - SQA Software: Evaluation" Automatic base calling by dedicated algorithm" Editing of sequence" Color coding shows quality for each well" Basic alignment function" 64
65 mexr pyro results
7. Troubleshooting Guidelines
7. Troubleshooting Guidelines The Pyrosequencing TM technique provides the user with sequence information for several nucleotides 3 of the sequencing primer apart from the polymorphic site. This gives
More informationDiscovery of single nucleotide polymorphisms and mutations by Pyrosequencing
Comparative and Functional Genomics Comp Funct Genom 2002; 3: 51 56. DOI: 10.1002 / cfg.132 Review Discovery of single nucleotide polymorphisms and mutations by Pyrosequencing Mostafa Ronaghi 1 * and Elahe
More informationChapter 7. DNA Microarrays
Bioinformatics III Structural Bioinformatics and Genome Analysis Chapter 7. DNA Microarrays 7.9 Next Generation Sequencing 454 Sequencing Solexa Illumina Solid TM System Sequencing Process of determining
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationAdvances and New Technologies in Forensic DNA
Advances and New Technologies in Forensic DNA Nader Pourmand, PhD Department of Biomolecular Engineering, University of California, Santa Cruz Branch Migratio 3 nbp 6 3 5 3 5 bp 14 bp 23 5 3 5 3 5 Bioluminescence
More informationPhenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
More informationFor quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format
ProductProfile PyroMark Q24 For quantitative methylation and mutation analysis using Pyrosequencing technology in a 24-well format The PyroMark Q24 uses proven Pyrosequencing technology for real-time,
More informationPyrosequencing. Alix Groom
Pyrosequencing Alix Groom Pyrosequencing high-throughput CpG methylation analysis platform real-time, sequence-based detection and quantification % methylation at multiple adjacent CpG sites 80-100 bases
More informationThe Use of Pyrosequencing for Genomic Sequence Determination
The Use of Pyrosequencing for Genomic Sequence Determination Rongahi, Mostafa. (2001). Pyrosequencing Sheds Light on DNA Sequencing. Genome Research. 11: 3-11. Zhou, G., Tomoharu, K., et al. (2006). Enzyme
More informationApplicazioni biotecnologiche
Applicazioni biotecnologiche Analisi forense Sintesi di proteine ricombinanti Restriction Fragment Length Polymorphism (RFLP) Polymorphism (more fully genetic polymorphism) refers to the simultaneous occurrence
More informationOverview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017
Overview of techniques in Molecular Diagnostics ELKE BOONE 23 MAART 2017 Molecular Diagnostics Molecular Diagnostics? Molecular Diagnostics FISH or CISH techniques FISH or CISH techniques FISH or CISH
More informationRapid Cycle PCR, Real Time Analysis, and Hi-Res Melting
Rapid Cycle PCR, Real Time Analysis, and Hi-Res Melting Carl Wittwer Department of Pathology University of Utah ARUP Idaho Technology AMP, Oct. 31, 2008 Impatient, Lazy, and Cheap Rapid Cycle PCR Fast
More informationHuman genetic variation
Human genetic variation CHEW Fook Tim Human Genetic Variation Variants contribute to rare and common diseases Variants can be used to trace human origins Human Genetic Variation What types of variants
More informationLecture 8: Sequencing and SNP. Sept 15, 2006
Lecture 8: Sequencing and SNP Sept 15, 2006 Announcements Random questioning during literature discussion sessions starts next week for real! Schedule changes Moved QTL lecture up Removed landscape genetics
More informationMarker types. Potato Association of America Frederiction August 9, Allen Van Deynze
Marker types Potato Association of America Frederiction August 9, 2009 Allen Van Deynze Use of DNA Markers in Breeding Germplasm Analysis Fingerprinting of germplasm Arrangement of diversity (clustering,
More informationGenetics and Biotechnology. Section 1. Applied Genetics
Section 1 Applied Genetics Selective Breeding! The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding. Section
More informationApplications and Uses. (adapted from Roche RealTime PCR Application Manual)
What Can You Do With qpcr? Applications and Uses (adapted from Roche RealTime PCR Application Manual) What is qpcr? Real time PCR also known as quantitative PCR (qpcr) measures PCR amplification as it
More informationSolCAP. Executive Commitee : David Douches Walter De Jong Robin Buell David Francis Alexandra Stone Lukas Mueller AllenVan Deynze
SolCAP Solanaceae Coordinated Agricultural Project Supported by the National Research Initiative Plant Genome Program of USDA CSREES for the Improvement of Potato and Tomato Executive Commitee : David
More informationLATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
More informationGenomes contain all of the information needed for an organism to grow and survive.
Section 3: Genomes contain all of the information needed for an organism to grow and survive. K What I Know W What I Want to Find Out L What I Learned Essential Questions What are the components of the
More informationThe HLA Community s Success in Combining Clinical & Genomic Data
The HLA Community s Success in Combining Clinical & Genomic Data Elizabeth Trachtenberg MS, PhD, DABHI Director, Center for Applied Genomics HLA/Immunogenetics Laboratory Children s Hospital & Research
More informationChapter 6 - Molecular Genetic Techniques
Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting
More informationCurrent molecular diagnostic system
LAMP-BART Name: Chris Wong Supervisor: Prof. Margaret Ip Joint Graduate Seminar Department of Microbiology The Chinese University of Hong Kong 18 th December 2012 Current molecular diagnostic system Detection
More informationPolymerase Chain Reaction
Polymerase Chain Reaction Problem Suppose you have a patient with an infection or a heritable disease. You want to know which infection or disease it is and.. you want to know it fast and... from as little
More informationUSING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE
USING PYROSEQUENCING FOR DETECTION OF DRUG RESISTANCE Ed Desmond Acklnowledgment: Grace Lin, MS, Research Scientist Microbial Diseases Laboratory, CDPH 2012 MOLECULAR BEACON ASSAY (AT MDL) Target: DNA
More informationAuthors: Vivek Sharma and Ram Kunwar
Molecular markers types and applications A genetic marker is a gene or known DNA sequence on a chromosome that can be used to identify individuals or species. Why we need Molecular Markers There will be
More informationCourse summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.
Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationDNA Technology. Asilomar Singer, Zinder, Brenner, Berg
DNA Technology Asilomar 1973. Singer, Zinder, Brenner, Berg DNA Technology The following are some of the most important molecular methods we will be using in this course. They will be used, among other
More information1
1 2 3 4 5 Cosmids are plasmid vectors that contain cos sites. The cos site is the only requirement for DNA to be packaged into a phage particle 6 7 8 9 10 11 12 13 14 15 16 For de novo sequencing using
More informationRelative Fluorescent Quantitation on Capillary Electrophoresis Systems:
Application Note Relative Fluorescent Quantitation on the 3130 Series Systems Relative Fluorescent Quantitation on Capillary Electrophoresis Systems: Screening for Loss of Heterozygosity in Tumor Samples
More informationGenome Sequencing Technologies. Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall
Genome Sequencing Technologies Jutta Marzillier, Ph.D. Lehigh University Department of Biological Sciences Iacocca Hall Sciences start with Observation Sciences start with Observation and flourish with
More informationHigh-Resolution Melting Interactive Workshop AACC, July 25 th, 2006 Assay Description
AACC, July 25 th, 2006 Assay Description List of Example Assays Page Technique Example assay 2 Unlabeled probe genotyping HR-1 Factor V Leiden mutation 6 Unlabeled probe genotyping - LightScanner Factor
More informationA Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
More informationWhite Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates
White Paper High Throughput SNP Genotyping White Paper: High Throughput SNP Genotyping Using Array Tape in Place of Microplates Miniaturization and Automation Using a Novel New Reaction Substrate Originally
More information7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
More informationWhat is Bioinformatics?
What is Bioinformatics? Bioinformatics is the field of science in which biology, computer science, and information technology merge to form a single discipline. - NCBI The ultimate goal of the field is
More informationGenomic systems 67. Pathologus Kongresszus Keszthely, október 9-11.
Diagnostics Genomic systems 67. Pathologus Kongresszus Keszthely, 2008. október 9-11. Péter Becságh Diagnostics Real Time Cell Analysis RAS Workflow Integration 7 6 5 T A C G 4 3 2 1 0 1 25 49 73 97 121
More informationSureSelect XT HS. Target Enrichment
SureSelect XT HS Target Enrichment What Is It? SureSelect XT HS joins the SureSelect library preparation reagent family as Agilent s highest sensitivity hybrid capture-based library prep and target enrichment
More informationAPPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS
APPLICATION OF MOLECULAR TECHNICS FOR DIAGNOSIS OF VIRAL INFECTIONS Hossein Keyvani Basic Diagnostic Methods in Virology Immunology and serology techniques (Antigen-Antibody Reactions) 1 ELISA ( Enzyme
More informationMolecular Biology (2)
Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within
More informationGenomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
More informationPyrosequencing for quantitative analysis of methylation at multiple CpG sites
Application Note for Nature Methods Pyrosequencing for quantitative analysis of methylation at multiple CpG sites Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every
More informationGENOTYPING BY PCR PROTOCOL FORM MUTANT MOUSE REGIONAL RESOURCE CENTER North America, International
Please provide the following information required for genetic analysis of your mutant mice. Please fill in form electronically by tabbing through the text fields. The first 2 pages are protected with gray
More information2. Pyrosequencing Assay Design
2. Pyrosequencing Assay Design 2.1 Guidelines for PCR set-up and primer design 2.1.1 PCR primer design Design of PCR primers follows standard rules, i.e. calculated Tm of 62-65 C, primer length of about
More informationLightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping
LightScanner Hi-Res Melting Comparison of Six Master Mixes for Scanning and Small Amplicon and LunaProbes Genotyping Introduction Commercial master mixes are convenient and cost-effective solutions for
More informationBIOLOGY Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR)
BIOLOGY 207 - Dr.Locke Lecture# 27 An Introduction to Polymerase Chain Reaction (PCR) Required readings and problems: Reading: Open Genetics, Chapter 8.1 Problems: Chapter 8 Optional Griffiths (2008) 9
More informationBSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:
1. (20 points) Give the name of a mutagen that could cause the following damages to DNA: a) Thymidine dimers UV b) Breakage of DNA backbone X-Ray c) 2 bp insertion (frameshift mutation) proflavin, acridine
More informationBiotechnology Chapter 20
Biotechnology Chapter 20 DNA Cloning DNA Cloning AKA Plasmid-based transformation or molecular cloning First off-let s sum up what happens. A plasmid is taken from a bacteria A gene is inserted into the
More informationGenetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
More informationJournal Club Kairi Raime
Journal Club 23.05.2014 Kairi Raime Introduction Small biases in amplification efficiency can quantitatively translated into substantial differences in amplicon concentrations Potential for exploiting
More informationAnalysis of gene function
Genome 371, 22 February 2010, Lecture 12 Analysis of gene function Gene knockouts PHASE TWO: INTERPRETATION I THINK I FOUND A CORNER PIECE. 3 BILLION PIECES Analysis of a disease gene Gene knockout or
More informationGrowing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend
Growing Needs for Practical Molecular Diagnostics: Indonesia s Preparedness for Current Trend Dr. dr. Francisca Srioetami Tanoerahardjo, SpPK., MSi Essential Practical Molecular Diagnostics Seminar Hotel
More informationMultiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
More informationQuantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM
Quantitative analysis of methylation at multiple CpG sites by Pyrosequencing TM Robert England and Monica Pettersson Pyrosequencing from Biotage 1 improves virtually every aspect of CpG methylation analysis:
More informationGENETICS - CLUTCH CH.15 GENOMES AND GENOMICS.
!! www.clutchprep.com CONCEPT: OVERVIEW OF GENOMICS Genomics is the study of genomes in their entirety Bioinformatics is the analysis of the information content of genomes - Genes, regulatory sequences,
More informationMotivation From Protein to Gene
MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein
More informationI. Structure of Genome Structural genomics II. Expression of Genome Functional genomics. a. Transcriptomics b. Proteomics
I. Structure of Genome Structural genomics II. Expression of Genome Functional genomics a. Transcriptomics b. Proteomics Fields of Genomics Structural genomics Functional genomics Transcriptomics Proteomics
More informationII. Integrative Genomics interactions between molecules and genes
. Structural Genomics Structure of Genome I. Functional Genomics Expression of Genome a. Transcriptomics b. Proteomics II. Integrative Genomics interactions between molecules and genes Fields of Genomics
More informationSchematic representation of the endogenous PALB2 locus and gene-disruption constructs
Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying
More informationHigh-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population
Research and Development Station for Bovine, Arad, Romania High-Resolution Melting analysis as a tool for rapid and sensitive detection of genotypes in cattle population Daniela Elena Ilie, Ada Cean, Ioan
More informationMolecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
More informationGermline Genotyping and Highly Sensitive Mutation Detection on the MassARRAY System
Sensitivity Across the Spectrum Results Reporting iplex and UltraSEEK chemistries are compatible with a broad range of nucleic acid biomarkers, from standard germline genotypes to rare somatic variants.
More informationBi 8 Lecture 5. Ellen Rothenberg 19 January 2016
Bi 8 Lecture 5 MORE ON HOW WE KNOW WHAT WE KNOW and intro to the protein code Ellen Rothenberg 19 January 2016 SIZE AND PURIFICATION BY SYNTHESIS: BASIS OF EARLY SEQUENCING complex mixture of aborted DNA
More informationMutations during meiosis and germ line division lead to genetic variation between individuals
Mutations during meiosis and germ line division lead to genetic variation between individuals Types of mutations: point mutations indels (insertion/deletion) copy number variation structural rearrangements
More informationMultiplex Assay Design
Multiplex Assay Design Geeta Bhat, Luminex Molecular Diagnostics; Toronto. APHL/CDC Newborn Screening Molecular Workshop, CDC, Atlanta, GA June 28-30, 2011 Luminex Multiplexed Solutions. For Life. Luminex
More informationBiochemistry 412. New Strategies & Technologies For DNA Sequencing. 2 February 2007
Biochemistry 412 New Strategies & Technologies For DNA Sequencing 2 February 2007 Note: Scale is wrong!! (at least for sequences) 10 6 In 1980, the sequencing cost per finished bp $1.00 In 2003, the sequencing
More informationBio 311 Learning Objectives
Bio 311 Learning Objectives This document outlines the learning objectives for Biol 311 (Principles of Genetics). Biol 311 is part of the BioCore within the Department of Biological Sciences; therefore,
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationAdvanced Technology in Phytoplasma Research
Advanced Technology in Phytoplasma Research Sequencing and Phylogenetics Wednesday July 8 Pauline Wang pauline.wang@utoronto.ca Lethal Yellowing Disease Phytoplasma Healthy palm Lethal yellowing of palm
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationSNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM
SNP GENOTYPING Accurate, sensitive, flexible MassARRAY System SNP GENOTYPING WITH iplex REAGENTS AND THE MASSARRAY SYSTEM Biomarker validation Routine genetic testing Somatic mutation profiling Up to 400
More informationMolecular Biology and Functional Genomic Core Facility
Molecular Biology and Functional Genomic Core Facility General Presentation Dr Odile Neyret Core Manager Myriam Rondeau Research Assistant Agnès Dumont Research Assistant Institut de recherche clinique
More informationResearch techniques in genetics. Medical genetics, 2017.
Research techniques in genetics Medical genetics, 2017. Techniques in Genetics Cloning (genetic recombination or engineering ) Genome editing tools: - Production of Knock-out and transgenic mice - CRISPR
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)
More informationIntroduction to some aspects of molecular genetics
Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...
More informationADIPO-screen kit. Instruction Manual
For Professional Use Only ADIPO-screen kit Instruction Manual AmpliSens Federal Budget Institute of Science Central Research Institute for Epidemiology 3A Novogireevskaya Street Moscow 111123 Russia TABLE
More informationMethods in virus diagnosis PCR techniques
Methods in virus diagnosis PCR techniques 450 MBIO PRACTICAL LESSON 5 Molecular Methods Methods based on the detection of viral genome are also commonly known as molecular methods. It is often said that
More informationSNP calling and VCF format
SNP calling and VCF format Laurent Falquet, Oct 12 SNP? What is this? A type of genetic variation, among others: Family of Single Nucleotide Aberrations Single Nucleotide Polymorphisms (SNPs) Single Nucleotide
More informationFrequently asked questions
Frequently asked questions Affymetrix Mouse Diversity Genotyping Array The Affymetrix Mouse Diversity Genotyping Array features more than 623,000 single nucleotide polymorphisms (SNPs) and more than 916,000
More informationSmartChip Real-Time PCR System
SmartChip Real-Time PCR System Where throughput meets flexibility For Research Use Only. Not for use in diagnostic procedures. 2017 Takara Bio Inc. All rights reserved. All trademarks are the property
More informationUsing mutants to clone genes
Using mutants to clone genes Objectives: 1. What is positional cloning? 2. What is insertional tagging? 3. How can one confirm that the gene cloned is the same one that is mutated to give the phenotype
More informationCHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
More informationOutline General NGS background and terms 11/14/2016 CONFLICT OF INTEREST. HLA region targeted enrichment. NGS library preparation methodologies
Eric T. Weimer, PhD, D(ABMLI) Assistant Professor, Pathology & Laboratory Medicine, UNC School of Medicine Director, Molecular Immunology Associate Director, Clinical Flow Cytometry, HLA, and Immunology
More informationPCB Fa Falll l2012
PCB 5065 Fall 2012 Molecular Markers Bassi and Monet (2008) Morphological Markers Cai et al. (2010) JoVE Cytogenetic Markers Boskovic and Tobutt, 1998 Isozyme Markers What Makes a Good DNA Marker? High
More informationGREG GIBSON SPENCER V. MUSE
A Primer of Genome Science ience THIRD EDITION TAGCACCTAGAATCATGGAGAGATAATTCGGTGAGAATTAAATGGAGAGTTGCATAGAGAACTGCGAACTG GREG GIBSON SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc.
More informationamplification High Resolution Melt Parameter Considerations for Optimal Data Resolution tech note 6009
amplification tech note 6009 High Resolution Melt Parameter Considerations for Optimal Data Resolution Carl Fisher, Ray Meng, Francisco Bizouarn, and Rachel Scott Gene Expression Division, Bio-Rad Laboratories,
More informationThe Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
More informationConcepts: What are RFLPs and how do they act like genetic marker loci?
Restriction Fragment Length Polymorphisms (RFLPs) -1 Readings: Griffiths et al: 7th Edition: Ch. 12 pp. 384-386; Ch.13 pp404-407 8th Edition: pp. 364-366 Assigned Problems: 8th Ch. 11: 32, 34, 38-39 7th
More informationSTUDY OF VNTR HUMAN POLYMORPHISMS BY PCR
STUDY OF VNTR HUMAN POLYMORPHISMS BY PCR Ref. PCR1 1. OBJECTIVE OF THE EXPERIMENT The objective of this experiment is to introduce students to the principles and practice of Polymerase Chain Reaction (PCR)
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationMassARRAY Genetic Analysis System. Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE)
MassARRAY Genetic Analysis System Genotyping Methylation Analysis Molecular Typing Somatic Mutation Profiling Quantitative Gene Expression (QGE) MassARRAY Genetic Analysis System * Overview Next-generation
More informationCancer Genetics Solutions
Cancer Genetics Solutions Cancer Genetics Solutions Pushing the Boundaries in Cancer Genetics Cancer is a formidable foe that presents significant challenges. The complexity of this disease can be daunting
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More informationRecombinant DNA recombinant DNA DNA cloning gene cloning
DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific
More information1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds:
1) (15 points) Next to each term in the left-hand column place the number from the right-hand column that best corresponds: natural selection 21 1) the component of phenotypic variance not explained by
More informationBIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
More informationGene mutation and DNA polymorphism
Gene mutation and DNA polymorphism Outline of this chapter Gene Mutation DNA Polymorphism Gene Mutation Definition Major Types Definition A gene mutation is a change in the nucleotide sequence that composes
More informationUltraFast Molecular Diagnostic System
UltraFast Molecular Diagnostic System CONTENTS 01 PCR vs Real-time PCR 02 NANOBIOSYS Sample Prep G2-16TU 03 NANOBIOSYS Real-time PCR G2-4 01 PCR vs Real-time PCR What is DNA & What is PCR? NANOBIOSYS 4
More informationGenetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
More information