Signaling interactions of hedgehog and BMP in osteogenesis SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Transcription

1 SUPPLEMENTAL EXPERIMENTAL PROCEDURES Single-cell analysis Single-cell isolation After trypsin treatment, the cell suspension was centrifuged at 1000 rpm for 3 minutes at 4 C. The supernatant was removed and the cell pellet was resuspended in PBS. One hundred microliters of the PBS solution containing several hundreds of cells was placed on the lid of a 96-well plate (Falcon). Under a microscope (Leica, DM IL), a single cell together with 1 μl of PBS was uptaken manually with a capillary tip ( = 190 μm; Drummond Scientific). The cell was transferred into a nonstick PCR tube (Axygen Scientific) containing 1 μl of PBS and cooled on ice. To prevent nonspecific adsorption of mrna into the inner wall, the PCR tube was dip-coated with 1% LIPIDURE-PMB30 beforehand (NOF CORPORATION). Preparation of cdna libraries from a single-cell All the processes were carried out in one tube in order to minimize sample loss. We added 1.1 μl of cell-lysis solution (a mixture of 1 μl of resuspension buffer and 0.1 μl Lysis Enhancer, Invitrogen) to a PCR tube containing a single cell suspended in 2 μl of PBS. The cell was lysed at 75 C for 10 minutes. After the tube was cooled to 4 C, 0.86 μl of DNase solution (0.5 U DNase I in 20 mm Tris-HCl (ph 8.4), 2 mm MgCl2, 50 mm KCl) was added. The solution was kept at room temperature for 10 minutes to degrade genomic DNA. Then DNase was deactivated by adding 1.2 μl of EDTA (2.5 mm, ph 8.0) while heating the solution at 70 C for 5 minutes. After cooling the solution down to 4 C, a bead suspension of 17.6 μl (10 7 oligo(dt) 30-immobilized beads, 568 µm dntp mix and 0.089% Tween20, 8.9 mm Tris-HCl (ph 8.0)) was added to the solution to be mixed. The oligo(dt) 30-immobilized beads were produced by mixing streptavidin-coated beads ( = 1 μm, Dynal, Myone C1) with dual-biotinylated oligo(dt) 30 VN (Integrated DNA Technologies). Each bead had about 5x10 4 oligo(dt) 30 VN probes on its surface. After being heated at 70 C for 5 minutes, the sample solution was cooled down to 4 C in order to hybridize the mrna molecules to the oligo(dt) 30 VN probes. The reverse transcription reaction was carried out by adding 9 μl of RT solution (50 mm Tris-HCl (ph 8.3), 75 M KCl, 3 mm MgCl2, 11 mm DTT, 40U RNase OUT, 200U Super Script III RT, Invitrogen) and shaking the tube at 750 rpm at 50 C for 50 minutes in a microincubator (Taitec, M.BR-022UP). Then the sample solution was heated at 85 C for 1.5 minutes to inactivate the RT enzyme. After cooling the sample solution down to 4 C, 1 μl of RNase solution (1 U RNase H (Invitrogen) in 30 mm Tris-HCl, 0.07 mm DTT, 50 mm KCl, 5 mm MgCl2, and 0.02% Tween20) was added, followed by shaking at 750 rpm at 37 C for 30 minutes. The supernatant was removed from the sample solution with an NdFeB magnet (Hitachi Metals) to obtain cdna immobilized beads in the tube. The cdna-immobilized beads were then washed twice with 50 μl of washing buffer (0.1 % Tween20, 10 mm Tris-HCl (ph 8.0)). After removing the washing buffer, the cdna-immobilized beads were dispersed in 3.8 μl of resuspension buffer (1% PMPC10, 10 mm Tris-HCl (ph 8.0)). Preparation of standard ssdna templates immobilized on beads The dual-biotinylated PCR products were amplified by PCR with cdna prepared from perichondrial cells and the primers listed in Table S1A. The PCR products contained the target 1

2 sequence regions for qpcr. The excess primers in each sample were removed with a QIAquick PCR Purification Kit (QIAGEN). The amount of the dual-biotinylated PCR products was calculated from UV adsorption data on the basis of the DNA sequences and molecular weight. Streptavidin-coated beads ( beads; = 1 μm, Dynal) were suspended in 50 μl of binding buffer (20 mm Tris-HCl (ph 8.0), 0.5-mM EDTA, 1 M NaCl) after being washed with 50 μl of the buffer three times. The dual-biotinylated PCR products for the six genes were diluted with the binding buffer and mixed to make a solution containing 10 6 /μl of each of the product molecules. The beads used for immobilization of the PCR products were prepared by adding 50 μl of the PCR solution to an equal volume of streptavidin-coated beads followed by mixing at 750 rpm at room temperature for an hour. The beads immobilizing the PCR products were washed three times with 100 μl of binding buffer, then three additional times with 100 μl of the washing buffer described above. After removing the buffer, the beads immobilizing the PCR products were suspended in 50 μl of washing buffer. We measured the amounts of DNA in the solution before and after the immobilization by qpcr and estimated the immobilization efficiency to be over 95%. More specifically, the amount of dsdna immobilized on the beads for each gene was estimated to be molecules per 10 7 beads. The beads immobilizing the PCR products were washed twice with 50 μl of washing buffer at 95 C to denature the dsdna to obtain the ssdna templates on the beads. After the beads immobilizing the ssdna were resuspended in 950 μl of q-pcr buffer (1x TaqMan Universal Master Mis, No AmpErase (Invitrogen), 0.013% Tween20, 1.3 mm Tris-HCl (ph 8.0), and 5% formamide), they were held at 95 C for 10 seconds and then subjected to 45 cycles of 95 C for 5 seconds and 60 C for 30 seconds. Through the washing process, DNA non-specifically adsorbed on the beads was completely removed, although 20-25% of the ssdna initially captured on the beads was lost during the washing process. After the supernatant was removed, the beads immobilizing the ssdna were resuspended in 50 μl of the washing buffer. The amount of each ssdna immobilized on the beads was estimated to be about molecules per 10 7 beads by qpcr. A ten-fold dilution series of standard samples was produced by repeatedly diluting the beads immobilizing the ssdna with the washed intact beads. The standard samples contained six different immobilized ssdna fragments at concentrations ranging from 7.5 to molecules per 10 7 beads. Quantitative analysis of cdna in single-cell cdna libraries Expression levels for the six target genes were analyzed sequentially (in the order of Gli1 > Col2a1 > Sp7 > Eef1g > Alpl) with a qpcr sequence detection system (Applied Biosystems ABI PRISM 7500). The qpcr analysis was carried out with a 20 μl solution containing 1 Premix Ex Taq, 1 μm of each Gli1 primer pair, 0.25 μm of Gli1 MGB fluorogenic probe, a cdna library (10 7 beads), 0.5% PMPC10, and 5% formamide. The standard ssdna templates and a single-cell cdna library were analyzed simultaneously by measuring fluorescence during thermal cycling (95 C for 10 seconds followed by 3 cycles of 95 C for 5 seconds and 55 C for 30 seconds, and 37 cycles of 85 C for 5 seconds and 55 C for 30 seconds) to produce amplification plots. In order to reduce the desorption of cdna (ssdna) from beads during thermal cycling, the low-temperature condition was adopted for qpcr (4). The threshold number of cycles (Ct, Rn=0.2) was the number of cycles at which the products reached predetermined amounts selected automatically. The relationship between the number of DNA molecules and Ct was 2

3 obtained using the standard ssdna templates and plotted as standard curves. The number of target molecules in the cdna library was estimated from these curves. After the first analysis for the Gli1 gene, the used 96-well plate was placed on the magnetic-plate to keep the beads in the wells while removing the supernatant quickly. The beads were washed three times with 40 μl of washing buffer before the next analysis for Col2a1. The analyses of the other four target genes by qpcr were performed sequentially (Sp7 > Eef1g > Alpl) using the same standard ssdna temples and cdna libraries and the same 96-well plate. The reaction conditions throughout the experiments were the same as those for the first analysis described above. The sequences of PCR primers and MGB fluorescence probes and the sizes of the products are listed in Table S1B. Primer design and selection of target sequences for qpcr The software packages OLIGO (version 6; TaKaRa Bio) and Primer Express (version 1.5; Applied Biosystems) were used to design the PCR primers and MGB probes so as to avoid duplex and hairpin formations in primers. The target regions for qpcr were selected so as to be relatively close (hopefully within 500 bases) to the polyt termini, which is effective to avoid the so-called 3 bias. Forward primers for qpcr were designed so as to hybridize to the last exon-exon junction, which prevents the undesirable amplification of genomic DNA. Preparation of oligo(dt) 30 VN-beads Streptavidin-coated beads (2x10 9 beads; = 1 μm, Dynal) were suspended in 200 μl of binding buffer after being washed with 200 μl of the buffer three times. Oligo(dT) 30 VN (5 -modification: dual biotin, spacer: C6, Integrated DNA technologies Integrated DNA Technologies) was diluted with binding buffer to make 200 μl of oligo(dt) 30 VN solution (5x10 11 molecules/ μl). The oligo(dt) 30 VN solution was added to an equal volume of streptavidin-coated beads followed by mixing at 750 rpm at room temperature for an hour. After the oligo(dt) 30 VN-immobilized beads were washed three times with 200 μl of binding buffer, the beads were transferred into a new tube. This is because a considerable amount of oligo(dt) 30VN becomes adsorbed on the inner wall of the tube, which disturbs the measurement. Then the beads were washed three times more with 200 μl of the washing buffer. After removing the buffer, the beads were suspended in 200 μl of the washing buffer. Vectors The plasmids expressing His-Gli2 were the generous gift of Dr. H. Sasaki (RIKEN). The plasmids expressing enhanced GFP (pegfpc1) were purchased from Clontech. The plasmids expressing GLI1, GLI3 and GLI3rep, GFP-SOX5, GFP-SOX6, GFP-SOX9 and Short interfering RNA (sirna) for Gli1 (shgli1) were generated as previously described (2, 3). For luciferase analysis, the human COL2A1 regulatory region (positions +285 to relative to the transcriptional start site) was obtained by PCR using human genomic DNA as a template and cloned into pgl3 vectors (Promega). ChIP ChIP was performed with a One-Day ChIP kit (Diagenode) using 5 g of anti-gfp antibody (ab290; Abcam), the non-immune IgG (sc-2027; Santa Cruz Biotechnologies), and 3

4 anti-acetyl-histone H3 antibody (06-599; Upstate) according to the manufacturer s instructions. To shear genomic DNA, a Shearing ChIP kit (Diagenode) was used according to the manufacturer s instructions. PCR was performed after purification of DNA. The primer sequences were as follows: to in the Col2a1 intron forward: GACTTGTTTGCGTTGGGGGATTGGC; to in the Col2a1 intron reverse: GGGGAGGCTGTGCATTGTGGGA. 4

5 SUPPLEMENTAL TABLE S1 (A) Primers used in amplification of the dual-biotinylated PCR products (B) Primers and probes used for qpcr 5

6 SUPPLEMENTAL FIGURE LEGENDS Supplemental Figure. S1. Effects of the manipulation of Hh and Wnt signaling pathways on bone collar formation in the perichondrium. A. von Kossa staining of representative sections obtained from metatarsals cultured with DMSO, lithium chloride (LiCl; 10 mm), or IWP2 (10 M) for 7 days. Scale bar, 100 m. B. Immunohistochemistry for Osx and von Kossa staining of representative sections obtained from metatarsals cultured with DMSO, SAG (1 M) alone, the combination of SAG and IWP2 (10 M), cyclopamine (Cyc; 5 M) alone, or the combination of Cyc and LiCl (10 mm) for 7 days. Higher magnification of the boxed areas in the left panels is shown in the right panels. Scale bars, 100 m. Supplemental Figure. S2 Effects of the manipulation of Hh and TGF signaling on bone collar formation and osteoblast differentiation. von Kossa staining of representative sections obtained from metatarsals cultured with DMSO, SAG (1 M), recombinant human TGF (rhtgf ; 10 ng/ml), or a combination of these agents for 7 days. Scale bar, 100 m. Supplemental Figure. S3 Effects of the inhibiton of Hh signaling on expressions of Bmp ligands. mrna expressions of Bmp2, Bmp4, Bmp6 and Bmp7 determined by RT-qPCR analysis in primary perichondrial cells. Cells were treated with Cyc (5 M) for 2 days. Data are expressed as the means ± SDs of triplicate wells, and representative data of independent experiments are shown. Supplemental Figure. S4 Involvement of Gli in chondrocyte differentiation and Sox9-dependent Col2a1 transcription. A. mrna expression of chondrocyte marker genes determined by RT-qPCR analysis in the primary perichondrial cells. Cells were transfected with the indicated plasmids and cultured for 48 hours. B. Luciferase analysis using reporter constructs containing a human COL2A1 regulatory region (+285 to +2450) in C3H10T1/2 cells transfected with the indicated plasmids. C. COL2A1 mrna expression determined by RT-qPCR analysis in HEK293 cells. Cells were transfected with the indicated plasmids and cultured for 48 hours. For GLI1, 0.1 or 1 g of plasmids was used. D. Protein expression of overexpressed Gli1 and Sox9 in Huh7 cells. Cells were transfected with the indicated plasmids and cultured for 48 hours. Protein expression was analyzed by immunoblot analysis using anti-myc (GLI1), anti-gfp (SOX9), and anti-actin antibodies. IB, immunoblot; Cytosol, cytosol fraction; Nuclear, nuclear fraction. For A-C, data are expressed as the means ± SDs of triplicate wells, and representative data of independent experiments are shown. Supplemental Figure. S5 Involvement of Gli2 in endochondral ossification. von Kossa staining of the representative sections of metatarsals obtained from the indicated mouse embryos (E17.5). Higher magnification of the boxed areas is shown at right. Scale bars, 100 m. Supplemental Figure. S6 Effects of co-overexpression of Gli1 and Gli2 on BMP-induced chondrocyte differentiation. Col2a1 mrna expression determined by RT-qPCR analysis in C3H10T1/2 cells. After being transfected with the indicated plasmids, cells were incubated for 12 hours, followed by exposure to rhbmp2 (100 ng/ml) for 48 hours. *p < 0.05, data are 6

7 expressed as the means ± SDs of triplicate wells, and representative data of independent experiments are shown. 7

8 Supplemental Fig. S1 A DMSO LiCl IWP2 B Osx von Kossa Cyc LiCl DMSO DMSO SAG IWP2 DMSO DMSO

9 Supplemental Fig. S2 None rhtgf 1 DMSO SAG

10 Supplemental Fig. S3 2 Gli1 Bmp2 Bmp4 Bmp6 Bmp7 1 0 Cyc

11 Supplemental Fig. S4 A Col2a1 Agc1 Chm1 B 0.2 Col2a1- Luc GLI1 - Relative mrna expression Relative mrna expression C COL2A1 SOX5/6/ GLI1 - - D 4 Myc-GLI1 3 GFP-SOX9 IB: Myc 2 IB: GFP 1 IB: Actin 0 RLU SOX9 GLI1 Cytosol Nuclear

12 Supplemental Fig. S5 WT Gli2 -/-

13 Supplemental Fig. S6 Col2a1 * 3 Relative mrna expression rhbmp Gli Gli