HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid
|
|
- Earl Johnston
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTAL MATERIALS AND METHODS Cell culture, transfection and treatments. HeLa cells stably transfected with an empty pcdna3 vector (HeLa Neo) or with a plasmid encoding vmia (HeLa vmia) 1 were cultured in DMEM medium supplemented with 10 % fetal calf serum, 10 mm HEPES and 100 U/ml penicillin/streptomycin at 37 C under 5% CO 2. Growth medium and supplements for cell culture were purchased from Gibco-Invitrogen (Carlsbad, USA). Cells were transfected in 6-well plates at 60% of confluence by means of the Oligofectamine transfection reagent (Invitrogen), following the manufacturer s instructions. The following sirnas were employed to downregulate the mitochondrial phosphate carrier (PiC) and mitofusin 2 (Mfn-2): PiC1, sense 5 - CUGGCGCACAUCACUAUAUdTdT-3 ; PiC2, sense 5 - CCAGGUUAUGCCAACACUUdTdT-3 ; Mfn-2, sense 5 - CGGCAAGACCGACUGAAAUdTdT-3. As a control, an irrelevant sirna was employed (sense 5'-GCCGUAUGCCGGUUAAGUdTdT-3'). 2 To induce cell death, cells were treated with 500 nm staurosporine (Sigma-Aldrich, St. Louis, USA) or with 500 ng/ml α-cd95 monoclonal antibody clone 7C11 (Immunotech, Prague, Czech Republic) plus 100 µg/ml cycloheximide (Sigma-Aldrich), for 6 hours. Immunofluorescence microscopy and cytofluorometry. Immunofluorescence experiments were performed as previously described. 3 Mitochondria were visualized by staining live cells with MitoTracker Orange (Molecular Probes- Invitrogen), following the manufacturer s recommendations, or by using a monoclonal antibody that specifically recognize the respiratory chain complex III core 2 subunit (A11143, Molecular Probes-Invitrogen) revealed with Alexa Fluor 568-coupled secondary antibodies
2 (Molecular Probes-Invitrogen). Acquisition was performed on a Leica DMIR2 inverted fluorescence microscope (camera Leica DFC300FX, acquisition software Leica FW4000). To measure mitochondrial transmembrane potential and cell viability, cells were incubated for 20 min at 37 C with 40 nm 3,3'-dihexyloxacarbocyanine iodide (DiOC 6 (3), from Molecular Probes-Invitrogen) plus 1 µg/ml propidium iodide (PI, from Sigma-Aldrich), immediately followed by cytofluorometric analysis on a FACScan cytofluorometer (Becton Dickinson, San Jose, USA). 4 RT-PCR. Total RNA was isolated by means of the RNeasy Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer s instructions, followed by generation of total cdna with the ImProm-II TM Reverse Transcription System (Promega, Madison, USA). Primer pairs specific for the isoform B of PiC (gene name: slc25a3; accession number NM_ ; forward primer 5 -GTTCTCGTCCGTGGCGCACCTGGCG-3, reverse primer 5 - GGGAACCACAGCAGTGTGTGTCAGACCACAA-3 ) and β-actin (as control, primers G5740 purchased from Promega) were used for semi-quantitative PCR amplification (25 cycles, linear range, PCR Master Mix from Promega). Finally PCR products were separated on 2% agarose gels containing 0.1 µg/ml ethidium bromide (from Sigma-Aldrich) and visualized on a standard UV transilluminator. SUPPLEMENTAL REFERENCES 1. Goldmacher VS et al. A cytomegalovirus-encoded mitochondria-localized inhibitor of apoptosis structurally unrelated to Bcl-2. Proc Natl Acad Sci USA 1999; 96: de La Motte Rouge T et al. A novel epidermal growth factor receptor inhibitor promotes
3 apoptosis in non-small cell lung cancer cells resistant to erlotinib. Cancer Res 2007; 67: Castedo M et al. Quantitation of mitochondrial alterations associated with apoptosis. J Immunol Methods 2002; 265: Criollo A et al. Mitochondrial control of cell death induced by hyperosmotic stress. Apoptosis 2007; 12:3-18
4 A sirna Mfn-2 + UNR sirna Mfn-2 + PiC B p < p < % of cells with fragment ed mitochondria sirna Mfn-2 sirna PiC Suppl. Fig. 1
5 LEGENDS TO SUPPLEMENTAL FIGURES Supplemental Figure 1. A-B. sirna-mediated depletion of PiC prevents mitochondrial fragmentation induced by the knockdown of mitofusin 2 (Mfn-2). A549 cells were transfected with a control, irrelevant sirna (UNR) or with sirnas for the downregulation of Mfn-2 and PiC in the indicated combinations for 48 hours, then labelled with MitoTracker Orange for the evaluation of mitochondrial morphology. Panel A reports representative pictures of cells exhibiting normal () or near-to-normal (sirna Mfn-2 + PiC) mitochondria, in contrast with cells displaying mitochondrial macrofragmentation (sirna Mfn-2 + UNR). Scale bars represent 2 µm. Panel B depicts the percentage of cells with fragmented mitochondria, as assessed in a population of at least 300 cells (mean ± STE; n = 3). Paired Student s t tests were performed to evaluate statistical significance.
Confocal immunofluorescence microscopy
Confocal immunofluorescence microscopy HL-6 and cells were cultured and cytospun onto glass slides. The cells were double immunofluorescence stained for Mt NPM1 and fibrillarin (nucleolar marker). Briefly,
More informationIKK is a therapeutic target in KRAS-induced lung cancer with disrupted p53 activity
IKK is a therapeutic target in KRAS-induced lung cancer with disrupted p5 activity H6 5 5 H58 A59 H6 H58 A59 anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα anti-ikkβ anti-panras anti-gapdh anti-ikkα
More informationSupplementary Information
Supplementary Information Live imaging reveals the dynamics and regulation of mitochondrial nucleoids during the cell cycle in Fucci2-HeLa cells Taeko Sasaki 1, Yoshikatsu Sato 2, Tetsuya Higashiyama 1,2,
More informationPlasmid DNA transfection of SW480 human colorectal cancer cells with the Biontex K2 Transfection System
Plasmid DNA transfection of human colorectal cancer cells with the Biontex K2 Transfection System Stephanie Hehlgans and Franz Rödel, Department of Radiotherapy and Oncology, Goethe- University Frankfurt,
More informationsupplementary information
DOI: 1.138/ncb1839 a b Control 1 2 3 Control 1 2 3 Fbw7 Smad3 1 2 3 4 1 2 3 4 c d IGF-1 IGF-1Rβ IGF-1Rβ-P Control / 1 2 3 4 Real-time RT-PCR Relative quantity (IGF-1/ mrna) 2 1 IGF-1 1 2 3 4 Control /
More informationShort hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
More informationProtocol for induction of expression and cell lysate production
Protocol for induction of expression and cell lysate production AV-04 Doxycyclin induction and cell lysate 1.0 Introduction / Description This method is intended for the treatment of the previously transfected
More informationSureSilencing sirna Array Technology Overview
SureSilencing sirna Array Technology Overview Pathway-Focused sirna-based RNA Interference Topics to be Covered Who is SuperArray? Brief Introduction to RNA Interference Challenges Facing RNA Interference
More informationsirna Transfection Into Primary Neurons Using Fuse-It-siRNA
sirna Transfection Into Primary Neurons Using Fuse-It-siRNA This Application Note describes a protocol for sirna transfection into sensitive, primary cortical neurons using Fuse-It-siRNA. This innovative
More informationSupplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
More informationIsolation, culture, and transfection of primary mammary epithelial organoids
Supplementary Experimental Procedures Isolation, culture, and transfection of primary mammary epithelial organoids Primary mammary epithelial organoids were prepared from 8-week-old CD1 mice (Charles River)
More informationSUPPLEMENTARY INFORMATION FIGURE 1 - 1
SUPPLEMENTARY INFORMATION FIGURE 1-1 SUPPLEMENTARY INFORMATION FIGURE 2-2 SUPPLEMENTARY INFORMATION METHODS GST-Pull-Down. Cultures of E. Coli (BL21) were transformed with pgex (Clontech) and pgex recombinant
More informationPasteurella multocida
BACTOTYPE PCR Amplification Kit Pasteurella multocida Labor Diagnostik Leipzig Manual Technology The product group BACTOTYPE PCR Amplification Kit comprises optimised systems for the identification of
More informationSupplemental Materials and Methods
Supplemental Materials and Methods 125 I-CXCL12 binding assay KG1 cells (2 10 6 ) were preincubated on ice with cold CXCL12 (1.6µg/mL corresponding to 200nM), CXCL11 (1.66µg/mL corresponding to 200nM),
More informationSUPPLEMENTARY MATERIAL AND METHODS
SUPPLEMENTARY MATERIAL AND METHODS Amplification of HEV ORF1, ORF2 and ORF3 genome regions Total RNA was extracted from 200 µl EDTA plasma using Cobas AmpliPrep total nucleic acid isolation kit (Roche,
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationNTM486-04, NTM174-04,
Transfection of transformed human trabecular meshwork TM5, and primary human NTM210-05, NTM486-04, NTM174-04, and NTM153-00 cells with Metafectene Easy Adnan Dibas1A,C, Ming Jiang1A,C, Thomas Yorio1A,C.
More informationConversion of plasmids into Gateway compatible cloning
Conversion of plasmids into Gateway compatible cloning Rafael Martinez 14072011 Overview: 1. Select the right Gateway cassette (A, B or C). 2. Design primers to amplify the right Gateway cassette from
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1137999/dc1 Supporting Online Material for Disrupting the Pairing Between let-7 and Enhances Oncogenic Transformation Christine Mayr, Michael T. Hemann, David P. Bartel*
More informationSupplementary Information
Supplementary Information promotes cancer cell invasion and proliferation by receptor-mediated endocytosis-dependent and -independent mechanisms, respectively Kensaku Shojima, Akira Sato, Hideaki Hanaki,
More informationSupplement Figure 1. Plin5 Plin2 Plin1. KDEL-DSRed. Plin-YFP. Merge
Supplement Figure 1 Plin5 Plin2 Plin1 KDEL-DSRed Plin-YFP Merge Supplement Figure 2 A. Plin5-Ab MitoTracker Merge AML12 B. Plin5-YFP Cytochrome c-cfp merge Supplement Figure 3 Ad.GFP Ad.Plin5 Supplement
More informationSupplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
More informationSupplementary Information
Journal : Nature Biotechnology Supplementary Information Targeted genome engineering in human cells with RNA-guided endonucleases Seung Woo Cho, Sojung Kim, Jong Min Kim, and Jin-Soo Kim* National Creative
More informationTranscriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death
SUPPLEMENTAL DATA Transcriptional Regulation of Pro-apoptotic Protein Kinase C-delta: Implications for Oxidative Stress-induced Neuronal Cell Death Huajun Jin 1, Arthi Kanthasamy 1, Vellareddy Anantharam
More informationFocus Application. Cell Migration. Featured Study: Inhibition of Cell Migration by Gene Silencing. xcelligence System Real-Time Cell Analyzer
xcelligence System Real-Time Cell Analyzer Focus Application Cell Migration Featured Study: Inhibition of Cell Migration by Gene Silencing Markus Greiner and Richard Zimmermann Department of Medical Biochemistry
More informationRNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by. 5 AGACACAAACACCAUUGUCACACUCCACAGC; Rand-2 OMe,
Materials and methods Oligonucleotides and DNA constructs RNA oligonucleotides and 2 -O-methylated oligonucleotides were synthesized by Dharmacon Inc. (Lafayette, CO). The sequences were: 122-2 OMe, 5
More informationRoche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
More informationSupplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
More informationSupplemental Methods:
Supplemental Methods: Cell Culture 84A human mammary epithelial cells (HMEC s) were a kind gift from Martha Stampfer (Lawrence Berkeley Laboratory, Berkeley CA). Cells were maintained in DFCI- medium supplemented
More informationSupplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
More informationaffects the development of newborn neurons Brain Mind Institute and School of Life Sciences, Ecole Polytechnique Fédérale de
Shedding of neurexin 3β ectodomain by ADAM10 releases a soluble fragment that affects the development of newborn neurons Erika Borcel* a, Magda Palczynska* a, Marine Krzisch b, Mitko Dimitrov a, Giorgio
More informationSupporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
More informationSupplemental Information
Supplemental Information Genetic and Functional Studies Implicate HIF1α as a 14q Kidney Cancer Suppressor Gene Chuan Shen, Rameen Beroukhim, Steven E. Schumacher, Jing Zhou, Michelle Chang, Sabina Signoretti,
More informationFundamentals and Applications of Biofilms Analysis, Structure and Physiology of Bacterial Biofilms Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy
1 Fundamentals and Applications of Biofilms Analysis, Structure and Physiology of Bacterial Biofilms Ching-Tsan Huang ( 黃慶璨 ) Office: Agronomy Building, Room 111 Tel: (02) 33664454 E-mail: cthuang@ntu.edu.tw
More informationData Sheet. Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 60618
Data Sheet Hippo Pathway TEAD Reporter MCF7 Cell Line Catalog #: 6618 Background The Hippo pathway regulates cell proliferation and cell death. It is activated by high cell density and cell stress to stop
More informationSupporting Information
Supporting Information Chakrabarty et al. 10.1073/pnas.1018001108 SI Materials and Methods Cell Lines. All cell lines were purchased from the American Type Culture Collection. Media and FBS were purchased
More informationSuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes
WHITE PAPER SuperScript IV Reverse Transcriptase SuperScript IV Reverse Transcriptase as a better alternative to AMV-based enzymes Abstract Reverse transcriptases (RTs) from avian myeloblastosis virus
More informationCreating RAFT 3D Cell Cultures with Different Thicknesses and Different Cell Types
Bioscience Solutions Creating RAFT 3D Cell s with Different Thicknesses and Different Cell Types Sabine Schaepermeier 1, Lubna Hussain 2, Jenny Schroeder 1 1 Lonza Cologne GmbH, Cologne, Germany; 2 Lonza
More informationSupplementary Materials
Supplementary Materials Construction of Synthetic Nucleoli in Human Cells Reveals How a Major Functional Nuclear Domain is Formed and Propagated Through Cell Divisision Authors: Alice Grob, Christine Colleran
More informationNucleofector technology and transient protein production
amaxa xxxxxxxxxxxx Nucleofector technology research Nucleofector technology and transient protein production your link to transfection The Nucleofector technology and transient protein production Transient
More informationCignal Reporter Assay Handbook
January 2011 Cignal Reporter Assay Handbook For cell-based pathway activity assays Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample and
More informationGeneration of ips-derived model cells for analyses of hair shaft differentiation
Supplementary Material Generation of ips-derived model cells for analyses of hair shaft differentiation Takumi Kido, Tomoatsu Horigome, Minori Uda, Naoki Adachi, Yohei Hirai Department of Biomedical Chemistry,
More informationAssay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
More informationSupplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing
Supplementary Information Design of small molecule-responsive micrornas based on structural requirements for Drosha processing Chase L. Beisel, Yvonne Y. Chen, Stephanie J. Culler, Kevin G. Hoff, & Christina
More informationSANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
More informationpdsipher and pdsipher -GFP shrna Vector User s Guide
pdsipher and pdsipher -GFP shrna Vector User s Guide NOTE: PLEASE READ THE ENTIRE PROTOCOL CAREFULLY BEFORE USE Page 1. Introduction... 1 2. Vector Overview... 1 3. Vector Maps 2 4. Materials Provided...
More informationTrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by
Supplemental Information Cell Culture TrkB knockdown cell lines (i.e., BBM1-KD and 361-KD cells) were prepared by transducing BBM1 or 361 cells with a lentivirus encoding shrna for TrkB. Transduction was
More informationBLOCK-iT Transfection Optimization Kit
BLOCK-iT Transfection Optimization Kit Catalog no. 13750-047 Version B 27 June 2007 25-0718 User Manual ii Table of Contents Table of Contents...iii Kit Contents and Storage... v Accessory Products...vi
More informationincluding, but not limited to:
*This Section is part of the original Request for Proposal # P08 080. The Contractor should provide the following eligible Scientific Biomedical Research Equipment, Reagents & Supplies including, but not
More informationCalcium Assay Kit. Technical Data Sheet. Product Information. Description. Storage. Materials not included
BD Technical Data Sheet Calcium Assay Kit Product Information Catalog Number: 640176 Size Reagents for 10 plates Components: Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml 1X Calcium
More informationInvestigating Apoptosis. For more information:
Investigating Apoptosis For more information: www.invitrogen.com/flowcytometry/ Flow Cytometry: It s in our DNA October 2, 2009 2009 Invitrogen Corporation. All Rights Reserved. Proprietary and Confidential.
More informationCell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK)
SUPPLEMENTAL MATERIAL Supplemental Methods Flow cytometry Cell were phenotyped using FITC-conjugated anti-human CD3 (Pharmingen, UK) and anti-human CD68 (Dako, Denmark), anti-human smooth muscle cell α-actin
More informationQuantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer. Application Note. Odilo Mueller. Abstract
Quantitative analysis of PCR fragments with the Agilent 2100 Bioanalyzer Application Note Odilo Mueller Abstract This application note describes how the Agilent Technologies 2100 bioanalyzer can be used
More informationASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
More informationSupplemental Data. Regulating Gene Expression. through RNA Nuclear Retention
Supplemental Data Regulating Gene Expression through RNA Nuclear Retention Kannanganattu V. Prasanth, Supriya G. Prasanth, Zhenyu Xuan, Stephen Hearn, Susan M. Freier, C. Frank Bennett, Michael Q. Zhang,
More informationingenio electroporation kits & solution
ingenio electroporation kits & solution Electroporation x DEFINITION and OPTIMIZATION What is ELECTROPORATION? Electroporation is a physical method of nucleic acid transfer wherein the cells and nucleic
More informationSupplementary Figures and Legends
Supplementary Figures and Legends Figure S1. Tests of the optical alignment and focal properties of the confocal microscope. (A) Images of the optical cross-section of fluorescent microspheres differing
More informationSupplemental Information. The TRAIL-Induced Cancer Secretome. Promotes a Tumor-Supportive Immune. Microenvironment via CCR2
Molecular Cell, Volume 65 Supplemental Information The TRAIL-Induced Cancer Secretome Promotes a Tumor-Supportive Immune Microenvironment via CCR2 Torsten Hartwig, Antonella Montinaro, Silvia von Karstedt,
More informationDNA Laddering Assay Kit
DNA Laddering Assay Kit Item No. 660990 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Precautions 4 If You
More informationHiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
More informationTo isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well
Supplemental Information: Supplemental Methods: Cell culture To isolate single GNS 144 cell clones, cells were plated at a density of 1cell/well in 96 well Primaria plates in GNS media and incubated at
More informationPercent survival. Supplementary fig. S3 A.
Supplementary fig. S3 A. B. 100 Percent survival 80 60 40 20 Ml 0 0 100 C. Fig. S3 Comparison of leukaemia incidence rate in the triple targeted chimaeric mice and germline-transmission translocator mice
More informationUsing Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application
Using Low Input of Poly (A) + RNA and Total RNA for Oligonucleotide Microarrays Application Gene Expression Author Michelle M. Chen Agilent Technologies, Inc. 3500 Deer Creek Road, MS 25U-7 Palo Alto,
More informationAlternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
More informationSupplementary Figure 1. Isolation of GFPHigh cells.
Supplementary Figure 1. Isolation of GFP High cells. (A) Schematic diagram of cell isolation based on Wnt signaling activity. Colorectal cancer (CRC) cell lines were stably transduced with lentivirus encoding
More informationa. Primers were purchased from Display Systems Biotech and are listed numerically to differentiate them
Table 2-1. Random upstream primers used in fluorescence differential display. Upstream primer a Sequence 1 5 GATCATAGCC 2 5 CTGCTTGATG 3 5 GATCCAGTAC 4 5 GATCGCATTG 5 5 AAACTCCGTC 6 5 TGGTAAAGGG 7 5 GATCATGGTC
More informationFunctional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
More informationIntracellular receptors specify complex patterns of gene expression that are cell and gene
SUPPLEMENTAL RESULTS AND DISCUSSION Some HPr-1AR ARE-containing Genes Are Unresponsive to Androgen Intracellular receptors specify complex patterns of gene expression that are cell and gene specific. For
More informationSupporting Information
Supporting Information Liu et al. 10.1073/pnas.0901216106 SI Materials and Methods Reagents. Thioglycolate and LPS from Escherichia coli 0111:B4 were from Sigma-Aldrich. PAM3CSK4 and poly(i:c) were from
More informationFigure S2. Response of mouse ES cells to GSK3 inhibition. Mentioned in discussion
Stem Cell Reports, Volume 1 Supplemental Information Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition Yaoyao Chen, Kathryn Blair, and Austin
More informationFigure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
More informationStandard Operating Procedure
Standard Operating Procedure Title Subtitle NANoREG Work package/task: Owner and co-owner(s) Date finalised Document name Key words: Standard Operating Procedure (SOP) for TaqMan realtime Reverse Transcription
More informationRoche Molecular Biochemicals Technical Note No. LC 9/2000
Roche Molecular Biochemicals Technical Note No. LC 9/2000 LightCycler Optimization Strategy Introduction Purpose of this Note Table of Contents The LightCycler system provides different detection formats
More informationImmunofluorescence Staining Protocol for 3 Well Chamber, removable
Immunofluorescence Staining Protocol for 3 Well Chamber, removable This Application Note presents a simple protocol for the cultivation, fixation, and staining of cells using the 3 Well Chamber, removable.
More informationof Medicine, Zhejiang University, Hangzhou, Zhejiang , China Michigan, 4424B MS-1, 1301 Catherine Street, Ann Arbor, MI 48109, USA.
Supplemental figure legends: Neddylation inhibitor MLN4924 suppresses growth and migration of human gastric cancer cells Huiyin Lan 1,2#, Zaiming Tang 1#, Hongchuan Jin 2, and Yi Sun 1,3,4* 1 Institute
More informationHEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified
Additional methods: HEK293A and C7 cell cultures HEK293A cells were cultured in high glucose (4.500 mg/l) Dulbecco s modified Eagle s medium (DMEM) with GlutaMAX I (Invitrogen, Cergy Pontoise, France),
More informationSummary of Mutagenic Toxicity Test Results for EvaGreen
Summary of Mutagenic Toxicity Test Results for EvaGreen Compiled by Biotium, Inc. from the results of an independent testing service: Litron Laboratories, Inc., Rochester, NY Overview When our scientists
More informationSupplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1
More informationCisne Enterprises, Inc. MELANOMA CANCER TEST
Cisne Enterprises, Inc. MELANOMA CANCER TEST Efficacy Evaluation of Antitumor Activity of Alka Vita - Alkahydroxy in the LOX-GFP Human Melanoma Model Final Report by: Anti-Cancer Lab San Diego California
More informationAn improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
More informationCell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential
Supporting Online Material Materials and methods Cell culture. HeLa cells were cultured as monolayers in Dulbecco s Minimal Essential Medium (Gibco BRL, Invitrogen Corporation, Carlsbad, CA, USA), supplemented
More informationLecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
More informationsirna Overview and Technical Tips
1 sirna Overview and Technical Tips 2 CONTENTS 3 4 5 7 8 10 11 13 14 18 19 20 21 Introduction Applications How Does It Work? Handy Tips Troubleshooting Conclusions Further References Contact Us 3 INTRODUCTION
More informationAmpliScribe T 7 Aminoallyl-RNA Transcription Kit
Cat. No. AA50125 The AmpliScribe T7 Aminoallyl-RNA Transcription Kit enables high-yield production of aminoallyl-labeled RNA. The kit utilizes Epicentre s high yielding AmpliScribe T7-Flash in vitro transcription
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationTransIT -LT1 Transfection Reagent
Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2300 INTRODUCTION TransIT -LT1 Transfection Reagent is a broad spectrum reagent that provides high efficiency plasmid
More informationGeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
More informationApoTrack Cytochrome c Apoptosis ICC Antibody
ab110417 ApoTrack Cytochrome c Apoptosis ICC Antibody Instructions for Use For the Immunocytochemistry analysis of cytochrome c and a mitochondrial marker (Complex Vα) in apoptotic cells and nonapoptotic
More informationSOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
More informationTransfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX
Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA
More informationMicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow
MicroRNA Analysis Paired with Novel Cell Health Assays: A Complete Workflow Brad Hook, Ph.D Manager, NA Scientific Applications 2016 Presentation Outline From cells to RNA a seemingly easy, yet complex
More informationScore winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
More informationTechnical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
More informationContents... vii. List of Figures... xii. List of Tables... xiv. Abbreviatons... xv. Summary... xvii. 1. Introduction In vitro evolution...
vii Contents Contents... vii List of Figures... xii List of Tables... xiv Abbreviatons... xv Summary... xvii 1. Introduction...1 1.1 In vitro evolution... 1 1.2 Phage Display Technology... 3 1.3 Cell surface
More informationSupplementary Figure 1
Supplementary Figure A Name Location Start position End position Oct4P Chr 3 29433673 29435 Annotation Mus musculus predicted gene 572 (Gm572), noncoding RNA RefSeq accession number NR_33594. Oct4P2 Chr
More informationRegulation of cellular differentiation by tissue specific transcription factor
Regulation of cellular differentiation by tissue specific transcription factor T. Endoh, M. Mie, Y. Yanagida, M. Aizawa, E. Kobatake Department of Biological Information, Graduate School of Bioscience
More informationKhaled_Fig. S MITF TYROSINASE R²= MITF PDE4D R²= Variance from mean mrna expression
Khaled_Fig. S Variance from mean mrna expression.8 2 MITF.6 TYROSINASE.4 R²=.73.2.8.6.4.2.8.6.4.2.8.6.4.2 MALME3M SKMEL28 UACC257 MITF PDE4D R²=.63 4.5 5 MITF 3.5 4 PDE4B 2.5 3 R²=.2.5 2.5.8.6.4.2.8.6.4.2
More informationab Mitochondrial Viability Assay
ab129732 Mitochondrial Viability Assay Instructions for Use For measuring mitochondrial/cellular viability in high throughput This product is for research use only and is not intended for diagnostic use.
More informationKostandin V. Pajcini, Stephane Y. Corbel, Julien Sage, Jason H. Pomerantz, and Helen M. Blau
Cell Stem Cell, Volume 7 Supplemental Information Transient Inactivation of Rb and ARF Yields Regenerative Cells from Postmitotic Mammalian Muscle Kostandin V. Pajcini, Stephane Y. Corbel, Julien Sage,
More informationApplication Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces
Application Note sirna dependent gene silencing in HeLa cells cultivated on various cell culture surfaces 1 Introduction 1.1 RNA interference (RNAi) One of the most important advances in biology in the
More information