How to Prepare for your Next Gen-Sequencing Project. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
|
|
- Megan Nicholson
- 5 years ago
- Views:
Transcription
1 How to Prepare for your Next Gen-Sequencing Project Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
2 NGS???? Next Gen Sequencing NGS High Througput Sequencing HTS
3 DNA Technologies & Expression Analysis Cores WHAT WE DO HT Sequencing: Illumina & PacBio Library preparation Illumina microarray (expression analysis, genotyping) Consultations (free - together w. Bioinformatics) Introducing new technologies to the campus Shared equipment (Bioanalyzer, Sonicators, BluePippin,..) Teaching - workshops: RNA-seq library prep, PacBio
4 How to Prepare for your HTS Project Tips for project planning Tips for sample handling/library preps Frequently observed problems Sequencing data QC New technologies and protocols
5 Maher Al Rwahnih UCD Plant Foundation Plant Services No need to be scared of HTS UC Davis Center for Plant Diversity/Herbarium The Herbarium archives contain over 300,000 dried specimens. Search for Grapevine Red Blotch-Associated Virus Virus traces found by PCR
6 HTS Results Next Generation Sequencing generated about 88 million Illumina reads More than 92,000 reads mapped specifically against the GRBaV genome The full genome sequence of this herbarium isolate (Accession No. KP221559) shared 92-99% nucleotide identity with other GenBank isolates. The virus was a member of a mixed infection with GLRaV-2 and GVB. Virus was already present in 1940 Maher Al Rwahnih UCD Plant Foundation Plant Services
7 Studying historic Bean varieties from herbarium samples - GBS (Genotyping-By-Sequencing) - 60 year old herbarium samples Sarah Dohle, Gepts Lab
8 Neanderthal bones single-stranded Adapter Ligation If you can put adapters on it, we can sequence it!
9 High precision - high throughput counting Generation of chimeric molecules
10
11
12 Tradeoffs: Three out of Five ain t bad (read lengths, read depth, read quality, assembly quality, low cost) flxlexblog.wordpress.com
13 Tradeoffs: Sequence All or Parts? DNA: Whole Genome (standard or low coverage: Skim-Seq Reduced Representations RAD-Seq, GBS, RESCAN,.. Exome Capture Amplicon Targeting RNA: Standard RNA-seq 3 -Tag-seq Capture-seq
14 NGS Project Planning Discuss your project (for example consult with us) : Sample preparation, sample numbers, nature of the samples, technologies, budget, statistics, data analysis More than one person is needed to find confounding factors Discuss your project before any sample prep Get the experimental design right before Check out our FAQs and webpages!
15
16 NGS Project Planning Test sample preparations and QC on Bioanalyzer or Gel RNA-seq; ChIP-seq: Prepare more samples than you want to sequence Quantification by sequencing? Minimum 3 replicates; safer are 4 Multiplexing: Why not pool all samples? Estimate expected variation between samples: Appropriate read numbers
17 Randomization nextgenseek.com
18 Sample Requirements Library preps do not fail suddenly Consistency is of the highest importance
19 DNA sample QC Agarose gel electrophoresis Ethidium bromide staining
20 Degraded DNA samples Out of the apoptosis textbook?
21 Degraded DNA samples
22 RNA sample QC 18S (2500b), 28S (4000b)
23
24 RNA integrity > reproducibility Chen et al. 2014
25 Choose appropriate library prep method >90% of total RNA is ribosomal Poly-A enrichment Ribo-depletion (kits or custom?) 3 -Tag Sequencing
26 Wetlab Tips Always use filtered tips and low-bind tubes RNAse and DNAse-free plastics and buffers RNA working solutions in H2O DNA working solutions in TLE (10mM TRIS, 0.1 mm EDTA ;ph= ) Keep master-mixes and samples on ice Spin-down vials before opening Do not vortex enzymes Clean instruments and workspace for RNA work Wear gloves
27 Sample QC Quantification by Fluorometry ( Qubit, SybrGreen) Purity by Nanodrop Integrity by gel electrophoresis or Bioanalyzer
28 Complementary Approaches Illumina Still-imaging of clusters (~1000 clonal molecules) PacBio Movie recordings fluorescence of single molecules Short reads - 2x300 bp Miseq Repeats are mostly not analyzable High output - up to 100 Gb per lane Up to 60 kb, N50 21 kb spans retro elements up to 1,3 Gb per SMRT-cell High accuracy ( < 0.5 %) Error rate 15 % Considerable base composition bias Very affordable De novo assemblies of thousands of scaffolds No base composition bias Costs 5 to 10 times higher Near perfect genome assemblies
29 Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing DNA Methylation ChIP-SEQ 3D Organization Genotyping Small RNA
30 Genome Resequencing Rearrangements De novo genome Sequencing RNA-seq Gene Expression Splice Isoform Abundance SNPs, Indels CNVs Long Read Sequencing PacBio Metageno mics Exome Sequencing DNA Methylation ChIP-SEQ 3D Organization Genotyping Small RNA
31 Fragmentation Mechanical shearing: BioRuptor Covaris Enzymatic: Fragmentase, RNAse3 Chemical: Mg2+, Zn2+ DNA, RNA DNA, RNA RNA
32 Illumina Sequencing Technology Sequencing By Synthesis (SBS) Technology 3 5 DNA ( ug) Library preparation Single Cluster molecule generation array A C T C T G C T G A A G 5 T G C T A C G A T A C C C G A T C G A T Sequencing
33 Sequencing 1.6 Billion Clusters Per Flow Cell 20 Microns 100 Microns 33
34
35
36 What will go wrong? Illumina cluster identification bubbles synthesis errors:
37 What will go wrong? Illumina synthesis errors: Phasing & Pre-Phasing problems
38 The first lines of your 2:N:0:GGAGAACA NNNNNNNNNNNNNNAACTGTAAGGCCAGCCATAGAACGCTCCC GGCTTCACGGACGTCATATAGTCAGGCACGAGGTCGGCGCCGA GTTCGTCACGCTCGTTGACGACCGCCCATACCGCTTGATTTGCG GGGTTGATCGCTAGCGCGGTCGGATTGCGAATGCCCGAGGCATA CGTCCGATGGGCCCCGCTGGCGCGGTCCACTTCCCATACAACC GCGCGTTCCTCTTCCAGCGCCATGCCGCGTT IIIIIHHFHIIIIIIIIGHHHHIHHIIIIEHIIHIHIHIGIIHHDHIIIIIHHHHEEHIHIH CG/EH@GHHIIGIHHIIHHIIIICHGHHIHIIHHIIIIIHIHIIHIGIIIGIEH?H?H HHIGHIIIGHIGHIDHH@AHHIHIH=HI=GHGHHGD
39 HS2500 PE250 - Q20
40 Intensities - HS3K PE100
41 HS3000 PE150
42 HS4000 PE150 currently
43
44
45
46 FASTQC
47 FASTQC - Nextera
48 FASTQC
49 FASTQC
50 FASTQC
51 FASTQC
52 FASTQC
53 FASTQC
54 FASTQC
55 FASTQC
56 Optional: PCR-free libraries PCR-free library: OR if concentration allows Reduction of PCR bias against e.g. GC rich or AT rich regions, especially for metagenomic samples Library enrichment by PCR: Ideal combination: high input and low cycle number; low-bias polymerase
57 Quantitation & QC methods Intercalating dye methods (PicoGreen, Qubit, etc.): Specific to dsdna, accurate at low levels of DNA Great for pooling of indexed libraries to be sequenced in one lane Requires standard curve generation, many accurate pipetting steps Bioanalyzer: Quantitation is good for rough estimate Invaluable for library QC High-sensitivity DNA chip allows quantitation of low DNA levels qpcr Most accurate quantitation method More labor-intensive Must be compared to a control
58 Library QC by Bioanalyzer Predominant species of appropriate MW Minimal primer dimer or adapter dimers Minimal higher MW material
59 Library QC by Bioanalyzer ~ 125 bp Beautiful 100% Adapters Beautiful
60 Library QC RNA-Seq
61 Library QC
62 e.g. Illumina TruSeq kit The libraries are useable PCR overamplification artifacts: PCR Bubbles Difficult to quantify and pool A single cycle of a Reconditioning PCR rescues the library
63 Some NEB RNA-seq libraries
64
65 Recommended RNA input Library prep kit mrna (TruSeq) Directional mrna (TruSeq) Apollo324 library robot (strand specific) Small RNA (TruSeq) Ribo depletion (Epicentre) SMARTer Ultra Low RNA (Clontech) Ovation RNA seq V2, Single Cell RNA seq (NuGen) Starting material 100 ng 4 μg total RNA 1 5 μg total RNA or 50 ng mrna 100 ng mrna 1 μg total RNA 1 5 μg total RNA 100 pg 10 ng 10 ng 100 ng
66 RNA-seq for DGE Differential Gene Expression (DGE) 50 bp single end reads million reads per sample (eukaryotes) 10 mill. reads > 80% of annotated genes 30 mill.. reads > 90% of annotated genes 5-10 million reads per sample (bacteria) ENCODE recommendations????
67 Molecular indexing for precision counts
68 Other RNA-seq Transcriptome assembly: 300 bp paired end plus 100 bp paired end Long non coding RNA studies: 100 bp paired end million reads Splice variant studies: 100 bp paired end million reads
69 RNA-seq: cheap and dirty - 3 Tag-sequencing - Micro-array-like data - Quant-Seq - Brad-Seq (Townsley 2015)
70 3 Tag-RNA sequencing - Sequencing only a tenth of the transcript - 96 samples per HiSeq lane Only if good references are available
71 RNA-seq targeted sequencing: - Capture-seq (Mercer et al. 2014) - Nimblegen and Illumina - Low quality DNA (FFPE) - Lower read numbers 10 million reads - Targeting lowly expressed genes.
72 RNA-seq reproducibility Two big studies multi-center studies (2014) High reproducibility of data given: - same library prep kits, same protocols - same RNA samples - RNA isolation protocols have to be identical - robotic library preps?
73 Standard RNA-Seq library protocol QC of total RNA to assess integrity Removal of rrna (most common) mrna isolation rrna depletion Fragmentation of RNA Reverse transcription and secondstrand cdna synthesis Ligation of adapters PCR Amplification Purify, QC and Quantify
74 Circular RNA Evolutionary conserved Eukaryotes Spliced Some tissues contain more circrna than mrna Interpretation of ribo-depletion RNA-seq data
75 Considerations in choosing an RNA-Seq method Transcript type: - mrna, extent of degradation - small/micro RNA Strandedness: - un-directional ds cdna library - directional library Input RNA amount: ug original total RNA - linear amplification from ng RNA Complexity: - original abundance - cdna normalization for uniformity Boundary of transcripts: - identify 5 and/or 3 ends - poly-adenylation sites - Degradation, cleavage sites
76 Is strand-specific information important? Standard library (non-directional) antisense sense Neu1
77 Strand-specific RNA-seq Standard library (non-directional) Antisense non-coding RNA Sense transcripts Informative for non-coding RNAs and antisense transcripts Essential when NOT using polya selection (mrna) No disadvantage to preserving strand specificity
78 mirna-seq Reducing ligation bias with the BiooScientific Small RNA-Seq Library Prep Kit
79 Illumina NextSeq Up to 500 million clusters Rapid turnaround PE 40 bp reads RNA-Seq
80 THIRD GENERATION DNA SEQUENCING Single Molecule Real Time (SMRT ) sequencing Sequencing of single DNA molecule by single polymerase Very long reads: average reads up to 15 kb, up to 60 kb High error rate (~15%).
81 70 nm aperture Zero Mode Waveguide
82 Damien Pelt
83 What will go wrong? PacBio DNA quality? Large losses during library prep. Polymerase stops at nicks, abasic sites, or DNA adducts. Polymerase dies due to laser exposure.
84 First Sequencing of CGG-repeat Alleles in Human Fragile X Syndrome using PacBio RS Sequencer Paul Hagerman, Biochemistry and Molecular Medicine, SOM. Single-molecule sequencing of pure CGG array, - first for disease-relevant allele. Loomis et al. (2012) Genome Research. - applicable to many other tandem repeat disorders. Direct genomic DNA sequencing of methyl groups, - direct epigenetic sequencing (paper under review). Discovered 100% bias toward methylation of 20 CGGrepeat allele in female, first direct methylated DNA sequencing in human CGG disease. 36 CGG 95 DoD STTR award with PacBio. Basis of R01 applications. C A G T Nucleotide position
85 Iso-Seq Pacbio Sequence full length transcripts no assembly High accuracy (except very long transcripts) More than 95% of genes show alternate splicing On average more than 5 isoforms/gene Precise delineation of transcript isoforms ( PCR artifacts? chimeras?)
86 PacBio Sequel 7 times increase throughput Costs reduced 50%???
87 C 1 Single cell capture 96 to 800 capture sites Microscopic control RNA-seq, Whole genome seq, ATAC-seq
88 Nanodroplet 10X Genomics Single Cell 600 to 6000 cells
89
90 10X Genomics Chromium Whole Genome Sequencing De Novo genome assembly HMW DNA - small amounts (1ng)
91
92 25x linked read coverage
93 60 kb deletion
94
95
96
97
98 Thank you!
99 DNA library construction Fragmented DNA End Repair 5 P OH HO P 5 Blunt End Fragments A Tailing 5 P A A P 5 Single Overhang Fragments T T Adapter Ligation DNA Fragments with Adapter Ends
100 Enrichment of library fragments 5 5 PCR Amplification
101 TruSeq Chemistry: Flow Cell 8 channels Surface of flow cell coated with a lawn of oligo pairs
102 Sequencing 100 Microns 102
103 Patterned Flowcell
104 Hiseq 3000: 478 million nanowells per lane
105
106 Hi-C Lieberman-Aiden 2010
107 Hi-C Lieberman-Aiden 2010
108 Dovetail Sequencing (Putnam 2015)
109 Bisulfite Conversion METHYL-Seq
110 ChIP-Seq Chromatin Immuno Preciptation DNA/Protein interactions e.g. transcription factors
111 DRIP-Seq R-loops: three-stranded structure Genome-wide mapping of RNA-DNA hybrids
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
More informationWet-lab Considerations for Illumina data analysis
Wet-lab Considerations for Illumina data analysis Based on a presentation by Henriette O Geen Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina
More informationGenome Resequencing. Rearrangements. SNPs, Indels CNVs. De novo genome Sequencing. Metagenomics. Exome Sequencing. RNA-seq Gene Expression
Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing
More informationHigh Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center DNA Technologies & Expression Analysis Cores HT Sequencing (Illumina
More informationConsiderations for Illumina library preparation. Henriette O Geen June 20, 2014 UCD Genome Center
Considerations for Illumina library preparation Henriette O Geen June 20, 2014 UCD Genome Center Diversity of applications De novo genome Sequencing ranscriptome Expression Splice Isoform bundance Genotyping
More informationDeep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
More informationExperimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
More informationNext-generation sequencing technologies
Next-generation sequencing technologies NGS applications Illumina sequencing workflow Overview Sequencing by ligation Short-read NGS Sequencing by synthesis Illumina NGS Single-molecule approach Long-read
More informationNovel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
More informationDNA concentration and purity were initially measured by NanoDrop 2000 and verified on Qubit 2.0 Fluorometer.
DNA Preparation and QC Extraction DNA was extracted from whole blood or flash frozen post-mortem tissue using a DNA mini kit (QIAmp #51104 and QIAmp#51404, respectively) following the manufacturer s recommendations.
More informationTranscriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
More informationCM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
More informationWheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
More informationTemplate Preparation FIND MEANING IN COMPLEXITY. Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved.
Template Preparation FIND MEANING IN COMPLEXITY Copyright 2014 by Pacific Biosciences of California, Inc. All rights reserved. PN 100-336-800-02 Specifics of SMRT Sequencing Data Steps of Overview SMRTbell
More informationSO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
More informationNextGen Sequencing Technologies Sequencing overview
Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji
More informationG E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
More information02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday September 15, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationSMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
More informationIntroduction Bioo Scientific
Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior
More informationIntegrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
More informationOverview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
More informationIllumina s Suite of Targeted Resequencing Solutions
Illumina s Suite of Targeted Resequencing Solutions Colin Baron Sr. Product Manager Sequencing Applications 2011 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life,
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Tuesday December 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationHigh Throughput Sequencing Technologies. J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014
High Throughput Sequencing Technologies J Fass UCD Genome Center Bioinformatics Core Monday June 16, 2014 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion
More informationGenomic & RNA Profiling Core Facility
Baylor College of Medicine Genomic & RNA Profiling Core Facility Services Price List Effective July 2018 PLEASE NOTE: All prices listed are for internal Baylor College of Medicine researchers with the
More informationPreparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq)
Preparing normalized cdna libraries for transcriptome sequencing (Illumina HiSeq) Last updated: Oct 28, 2016 Overview First-strand cdna is synthesized using oligo-dt containing primers and an RNA oligo
More informationIntroductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
More informationTREE CODE PRODUCT BROCHURE
TREE CODE PRODUCT BROCHURE Single Molecule, Real-Time (SMRT) Sequencing technology offers: Long read sequencing ~10 Gb with 20 kb average read lengths for WGS ~20 Gb with 40 kb average read length for
More informationHigh Throughput Sequencing Technologies. UCD Genome Center Bioinformatics Core Monday 15 June 2015
High Throughput Sequencing Technologies UCD Genome Center Bioinformatics Core Monday 15 June 2015 Sequencing Explosion www.genome.gov/sequencingcosts http://t.co/ka5cvghdqo Sequencing Explosion 2011 PacBio
More informationBioinformatics Advice on Experimental Design
Bioinformatics Advice on Experimental Design Where do I start? Please refer to the following guide to better plan your experiments for good statistical analysis, best suited for your research needs. Statistics
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationObtain superior NGS library performance with lower input amounts using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina
be INSPIRED drive DISCOVERY stay GENINE TECHNICAL NOTE Directional rrna depletion Obtain superior NGS library performance with lower input amounts using the NEBNext ltra II Directional RNA Library Prep
More informationFunctional Genomics Research Stream. Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq
Functional Genomics Research Stream Research Meeting: November 8, 2011 cdna Library Construction for RNA-Seq Lab Issues Don t leave out boxes of water + ethidium bromide Minimize tip boxes in phenol waste
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
More informationBacterial Iso-Seq Transcript Sequencing Using the SMARTer PCR cdna Synthesis Kit and BluePippin Size-Selection System
Please note: the unsupported protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
More informationNEBNext. Ultra II RNA Library Prep Kit for Illumina
LIBRARY PREPARATION NEBNext Ultra II RNA Library Prep Kit for Illumina Instruction Manual NEB #E7770S/L, #E7775S/L 24/96 reactions Version 1.0 4/17 be INSPIRED drive DISCOVERY stay GENUINE This product
More informationSingle Cell Genomics
Single Cell Genomics Application Cost Platform/Protocol Note 3 mrna-seq Cell capture/rt/library prep $1,990/Sample 10x Genomics Chromium 500-10,000 cells/sample 5 V(D)J + mrna Cell capture/rt/library prep
More informationNEXTFLEX Rapid Directional RNA-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions)
NEXTFLEX Rapid Directional RNA-Seq Kit (For Illumina Platforms) Catalog #NOVA-5138-07 (Kit contains 8 reactions) Bioo Scientific Corp. 2014-2018 V18.07 This product is for research use only. Not for use
More informationRNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen
RNA Sequencing Next gen insight into transcriptomes 05-06-2013, Elio Schijlen Transcriptome complete set of transcripts in a cell, and their quantity, for a specific developmental stage or physiological
More informationwww.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
More informationBi 8 Lecture 4. Ellen Rothenberg 14 January Reading: from Alberts Ch. 8
Bi 8 Lecture 4 DNA approaches: How we know what we know Ellen Rothenberg 14 January 2016 Reading: from Alberts Ch. 8 Central concept: DNA or RNA polymer length as an identifying feature RNA has intrinsically
More informationSample to Insight. Dr. Bhagyashree S. Birla NGS Field Application Scientist
Dr. Bhagyashree S. Birla NGS Field Application Scientist bhagyashree.birla@qiagen.com NGS spans a broad range of applications DNA Applications Human ID Liquid biopsy Biomarker discovery Inherited and somatic
More informationThe Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
More informationEPIGENTEK. EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # P-1051 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiNext DNA Library Preparation Kit (Illumina) Base Catalog # PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE Uses: The EpiNext DNA Library Preparation Kit (Illumina) is suitable for preparing a DNA library
More informationThe Genome Analysis Centre. Building Excellence in Genomics and Computa5onal Bioscience
Building Excellence in Genomics and Computa5onal Bioscience Resequencing approaches Sarah Ayling Crop Genomics and Diversity sarah.ayling@tgac.ac.uk Why re- sequence plants? To iden
More informationIncorporating Molecular ID Technology. Accel-NGS 2S MID Indexing Kits
Incorporating Molecular ID Technology Accel-NGS 2S MID Indexing Kits Molecular Identifiers (MIDs) MIDs are indices used to label unique library molecules MIDs can assess duplicate molecules in sequencing
More informationMatthew Tinning Australian Genome Research Facility. July 2012
Next-Generation Sequencing: an overview of technologies and applications Matthew Tinning Australian Genome Research Facility July 2012 History of Sequencing Where have we been? 1869 Discovery of DNA 1909
More informationGene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
More informationApplications of Next Generation Sequencing in Metagenomics Studies
Applications of Next Generation Sequencing in Metagenomics Studies Francesca Rizzo, PhD Genomix4life Laboratory of Molecular Medicine and Genomics Department of Medicine and Surgery University of Salerno
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationNext Generation Sequencing. Jeroen Van Houdt - Leuven 13/10/2017
Next Generation Sequencing Jeroen Van Houdt - Leuven 13/10/2017 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977 A Maxam and W Gilbert "DNA seq by chemical degradation" F Sanger"DNA
More informationMultiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms
Multiplexed Strand-specific RNA-Seq Library Preparation for Illumina Sequencing Platforms Important Things to know before you start: This protocol generates strand-specific reads, but may lead to slightly
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationStandard Products Nucleic Acid Sample Submission Guideline
Standard Products Nucleic Acid Sample Submission Guideline Document NO.: Version NO.: SOP-SMM-028 A1 Effective Date: 2018-1-3 Document NO.:SOP-SMM-028 Version NO.:A1 Page 1 of 19 CONTETS ABOUT THIS GUIDELINE...
More informationNEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction 4 5 6 6 7 8 DNA Library Preparation Workflow Product Selection Product Details
More informationLecture 7. Next-generation sequencing technologies
Lecture 7 Next-generation sequencing technologies Next-generation sequencing technologies General principles of short-read NGS Construct a library of fragments Generate clonal template populations Massively
More informationObtaining DNA from degraded samples for NGS sequencing
Obtaining DNA from degraded samples for NGS sequencing A brief overview of Alexander (Sasha) Mikheyev s lecture at USC 03/13/14 Presented by Jacqueline Robinson 04/23/2014 NGS is great, but Standard protocols
More informationP HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
More informationAPPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
More informationNEBNext. for Ion Torrent LIBRARY PREPARATION KITS
NEBNext for Ion Torrent LIBRARY PREPARATION KITS NEBNEXT PRODUCTS FOR ION TORRENT Table of Contents 3 General Introduction TOOLS & RESOURCES Visit NEBNext.com to find: T he full list of products available
More informationThe New Genome Analyzer IIx Delivering more data, faster, and easier than ever before. Jeremy Preston, PhD Marketing Manager, Sequencing
The New Genome Analyzer IIx Delivering more data, faster, and easier than ever before Jeremy Preston, PhD Marketing Manager, Sequencing Illumina Genome Analyzer: a Paradigm Shift 2000x gain in efficiency
More informationNEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V15.
NEXTFLEX ChIP-Seq Kit (For Illumina Platforms) Catalog #NOVA-5143-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2015-2018 V15.07 This product is for research use only. Not for use in diagnostic procedures.
More informationProduct Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
More informationRAPID, ROBUST & RELIABLE
Roche Sample Prep Solutions for RNA-Seq Sequence what matters RAPID, ROBUST & RELIABLE Sample P le Samp Quant ifi /QC tion ca As the first step in the NGS workflow continuum, sample prep holds the key
More information10 RXN 50 RXN 500 RXN
SeqPlex Enhanced DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQXE Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification
More informationNEXTFLEX 16S V4 Amplicon-Seq Kit (For Illumina Platforms) Catalog #NOVA (Kit contains 8 reactions) Bioo Scientific Corp V18.
NEXTFLEX 16S V4 Amplicon-Seq Kit 2.0-4 (For Illumina Platforms) Catalog #NOVA-4203-01 (Kit contains 8 reactions) Bioo Scientific Corp. 2018 V18.07 This product is for research use only. Not for use in
More informationTECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
More informationOvercome limitations with RNA-Seq
Buyer s Guide Simple, customized RNA-Seq workflows Evaluating options for next-generation RNA sequencing Overcome limitations with RNA-Seq Next-generation sequencing (NGS) has revolutionized the study
More informationrnaseqcore.vet.cornell.edu
Center for Reproductive Genomics Department of Biomedical Sciences College of Veterinary Medicine Cornell University Jen Grenier jgrenier@cornell.edu Compute power Software/parameters Reference genome
More informationJetSeq DNA Library Preparation Kit. Product Manual
JetSeq DNA Library Preparation Kit Product Manual JetSeq DNA Library Preparation Kit JetSeq DNA Library Preparation Kit TABLE OF CONTENTS 1 Kit contents 04 2 Description 05 3 Storage 06 4 Safety information
More informationWelcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
More informationWhole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
More informationBIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01
BIOO LIFE SCIENCE PRODUCTS NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) Catalog #: 4201-01 (16 reactions) BIOO Scientific Corp. 2013 V13.01 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product
More informationNext-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
More informationJoint RuminOmics/Rumen Microbial Genomics Network Workshop
Joint RuminOmics/Rumen Microbial Genomics Network Workshop Microbiome analysis - Amplicon sequencing Dr. Sinéad Waters Animal and Bioscience Research Department, Teagasc Grange, Ireland Prof. Leluo Guan
More informationNext-generation sequencing technologies
Next-generation sequencing technologies Illumina: Summary https://www.youtube.com/watch?v=fcd6b5hraz8 Illumina platforms: Benchtop sequencers https://www.illumina.com/systems/sequencing-platforms.html
More informationSequencing technologies. Jose Blanca COMAV institute bioinf.comav.upv.es
Sequencing technologies Jose Blanca COMAV institute bioinf.comav.upv.es Outline Sequencing technologies: Sanger 2nd generation sequencing: 3er generation sequencing: 454 Illumina SOLiD Ion Torrent PacBio
More informationNext Generation Sequencing. Tobias Österlund
Next Generation Sequencing Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
More informationTECHNICAL BULLETIN. SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies. Catalog Number SEQX Storage Temperature 20 C
SeqPlex DNA Amplification Kit for use with high throughput sequencing technologies Catalog Number SEQX Storage Temperature 20 C TECHNICAL BULLETIN Product Description The SeqPlex DNA Amplification Kit
More informationIncreased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
More informationSingle Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
More informationMonsterScript Reverse Transcriptase
MonsterScript Reverse Transcriptase Cat. Nos. MSTA5110, and MSTA5124 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com
More informationProcedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis)
Procedure & Checklist - Multiplex Isoform Sequencing (Iso-Seq Analysis) Before You Begin Review the template preparation procedure for Iso-Seq analysis here. The procedure provides instructions for constructing
More informationSurely Better Target Enrichment from Sample to Sequencer
sureselect TARGET ENRICHMENT solutions Surely Better Target Enrichment from Sample to Sequencer Agilent s market leading SureSelect platform provides a complete portfolio of catalog to custom products,
More informationUser Manual. NGS Library qpcr Quantification Kit (Illumina compatible)
NGS Library qpcr Quantification Kit (Illumina compatible) User Manual 384 Oyster Point Blvd, Suite 15 South San Francisco, CA 94080 Phone: 1 (888) MCLAB-88 Fax: 1 (650) 872-0253 www.mclab.com Contents
More informationMolecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
More informationResearch school methods seminar Genomics and Transcriptomics
Research school methods seminar Genomics and Transcriptomics Stephan Klee 19.11.2014 2 3 4 5 Genetics, Genomics what are we talking about? Genetics and Genomics Study of genes Role of genes in inheritence
More informationAdmera Health RUO Services
Admera Health RUO Services Services 1. RNA-Seq... 2 2. Single-cell RNAseq (scrna-seq)... 3 3. Whole Exome Sequencing (WES)... 4 4. Whole Genome Sequencing (WGS)... 5 5. Whole Genome Bisulfite Sequencing
More informationRNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
More informationReading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction
Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain
More informationIllumina Sequencing Overview
Illumina Sequencing Overview Part # 15045845_Rev.C 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cbot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic
More informationComplete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time
Molecular Cloning Laboratories Manual Version 1.2 Product name: MCNext UT DNA Sample Prep Kit Cat #: MCUDS-4, MCUDS-24, MCUDS-96 Description: This protocol explains how to prepare up to 96 pooled indexed
More informationProcedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing
Procedure & Checklist - Preparing SMRTbell Libraries using PacBio Barcoded Universal Primers for Multiplex SMRT Sequencing Before You Begin This document describes methods for generating barcoded PCR products
More informationMolecular Biology and Functional Genomic Core Facility
Molecular Biology and Functional Genomic Core Facility General Presentation Dr Odile Neyret Core Manager Myriam Rondeau Research Assistant Agnès Dumont Research Assistant Institut de recherche clinique
More informationGENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
More informationACCEL-NGS 2S DNA LIBRARY KITS
ACCEL-NGS 2S DNA LIBRARY KITS Accel-NGS 2S DNA Library Kits produce high quality libraries with an all-inclusive, easy-to-use format. The kits contain all reagents necessary to build high complexity libraries
More information