How to Prepare for your Next Gen-Sequencing Project. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

Size: px

Start display at page:

Download "How to Prepare for your Next Gen-Sequencing Project. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center"

Megan Nicholson
5 years ago
Views:

1 How to Prepare for your Next Gen-Sequencing Project Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

2 NGS???? Next Gen Sequencing NGS High Througput Sequencing HTS

3 DNA Technologies & Expression Analysis Cores WHAT WE DO HT Sequencing: Illumina & PacBio Library preparation Illumina microarray (expression analysis, genotyping) Consultations (free - together w. Bioinformatics) Introducing new technologies to the campus Shared equipment (Bioanalyzer, Sonicators, BluePippin,..) Teaching - workshops: RNA-seq library prep, PacBio

4 How to Prepare for your HTS Project Tips for project planning Tips for sample handling/library preps Frequently observed problems Sequencing data QC New technologies and protocols

The Herbarium archives contain over 300,000 dried specimens.

5 Maher Al Rwahnih UCD Plant Foundation Plant Services No need to be scared of HTS UC Davis Center for Plant Diversity/Herbarium The Herbarium archives contain over 300,000 dried specimens. Search for Grapevine Red Blotch-Associated Virus Virus traces found by PCR

6 HTS Results Next Generation Sequencing generated about 88 million Illumina reads More than 92,000 reads mapped specifically against the GRBaV genome The full genome sequence of this herbarium isolate (Accession No. KP221559) shared 92-99% nucleotide identity with other GenBank isolates. The virus was a member of a mixed infection with GLRaV-2 and GVB. Virus was already present in 1940 Maher Al Rwahnih UCD Plant Foundation Plant Services

7 Studying historic Bean varieties from herbarium samples - GBS (Genotyping-By-Sequencing) - 60 year old herbarium samples Sarah Dohle, Gepts Lab

8 Neanderthal bones single-stranded Adapter Ligation If you can put adapters on it, we can sequence it!

9 High precision - high throughput counting Generation of chimeric molecules

12 Tradeoffs: Three out of Five ain t bad (read lengths, read depth, read quality, assembly quality, low cost) flxlexblog.wordpress.com

13 Tradeoffs: Sequence All or Parts? DNA: Whole Genome (standard or low coverage: Skim-Seq Reduced Representations RAD-Seq, GBS, RESCAN,.. Exome Capture Amplicon Targeting RNA: Standard RNA-seq 3 -Tag-seq Capture-seq

14 NGS Project Planning Discuss your project (for example consult with us) : Sample preparation, sample numbers, nature of the samples, technologies, budget, statistics, data analysis More than one person is needed to find confounding factors Discuss your project before any sample prep Get the experimental design right before Check out our FAQs and webpages!

16 NGS Project Planning Test sample preparations and QC on Bioanalyzer or Gel RNA-seq; ChIP-seq: Prepare more samples than you want to sequence Quantification by sequencing? Minimum 3 replicates; safer are 4 Multiplexing: Why not pool all samples? Estimate expected variation between samples: Appropriate read numbers

17 Randomization nextgenseek.com

18 Sample Requirements Library preps do not fail suddenly Consistency is of the highest importance

19 DNA sample QC Agarose gel electrophoresis Ethidium bromide staining

20 Degraded DNA samples Out of the apoptosis textbook?

21 Degraded DNA samples

22 RNA sample QC 18S (2500b), 28S (4000b)

24 RNA integrity > reproducibility Chen et al. 2014

25 Choose appropriate library prep method >90% of total RNA is ribosomal Poly-A enrichment Ribo-depletion (kits or custom?) 3 -Tag Sequencing

26 Wetlab Tips Always use filtered tips and low-bind tubes RNAse and DNAse-free plastics and buffers RNA working solutions in H2O DNA working solutions in TLE (10mM TRIS, 0.1 mm EDTA ;ph= ) Keep master-mixes and samples on ice Spin-down vials before opening Do not vortex enzymes Clean instruments and workspace for RNA work Wear gloves

27 Sample QC Quantification by Fluorometry ( Qubit, SybrGreen) Purity by Nanodrop Integrity by gel electrophoresis or Bioanalyzer

28 Complementary Approaches Illumina Still-imaging of clusters (~1000 clonal molecules) PacBio Movie recordings fluorescence of single molecules Short reads - 2x300 bp Miseq Repeats are mostly not analyzable High output - up to 100 Gb per lane Up to 60 kb, N50 21 kb spans retro elements up to 1,3 Gb per SMRT-cell High accuracy ( < 0.5 %) Error rate 15 % Considerable base composition bias Very affordable De novo assemblies of thousands of scaffolds No base composition bias Costs 5 to 10 times higher Near perfect genome assemblies

29 Genome Resequencing De novo genome Sequencing SNPs, Indels CNVs Rearrangements Metagenomics RNA-seq Gene Expression Splice Isoform Abundance High Throughput Short Read Sequencing: Illumina Exome Sequencing DNA Methylation ChIP-SEQ 3D Organization Genotyping Small RNA

30 Genome Resequencing Rearrangements De novo genome Sequencing RNA-seq Gene Expression Splice Isoform Abundance SNPs, Indels CNVs Long Read Sequencing PacBio Metageno mics Exome Sequencing DNA Methylation ChIP-SEQ 3D Organization Genotyping Small RNA

31 Fragmentation Mechanical shearing: BioRuptor Covaris Enzymatic: Fragmentase, RNAse3 Chemical: Mg2+, Zn2+ DNA, RNA DNA, RNA RNA

0 ug) Library preparation Single Cluster molecule

32 Illumina Sequencing Technology Sequencing By Synthesis (SBS) Technology 3 5 DNA ( ug) Library preparation Single Cluster molecule generation array A C T C T G C T G A A G 5 T G C T A C G A T A C C C G A T C G A T Sequencing

33 Sequencing 1.6 Billion Clusters Per Flow Cell 20 Microns 100 Microns 33

36 What will go wrong? Illumina cluster identification bubbles synthesis errors:

37 What will go wrong? Illumina synthesis errors: Phasing & Pre-Phasing problems

38 The first lines of your 2:N:0:GGAGAACA NNNNNNNNNNNNNNAACTGTAAGGCCAGCCATAGAACGCTCCC GGCTTCACGGACGTCATATAGTCAGGCACGAGGTCGGCGCCGA GTTCGTCACGCTCGTTGACGACCGCCCATACCGCTTGATTTGCG GGGTTGATCGCTAGCGCGGTCGGATTGCGAATGCCCGAGGCATA CGTCCGATGGGCCCCGCTGGCGCGGTCCACTTCCCATACAACC GCGCGTTCCTCTTCCAGCGCCATGCCGCGTT IIIIIHHFHIIIIIIIIGHHHHIHHIIIIEHIIHIHIHIGIIHHDHIIIIIHHHHEEHIHIH CG/EH@GHHIIGIHHIIHHIIIICHGHHIHIIHHIIIIIHIHIIHIGIIIGIEH?H?H HHIGHIIIGHIGHIDHH@AHHIHIH=HI=GHGHHGD

39 HS2500 PE250 - Q20

40 Intensities - HS3K PE100

41 HS3000 PE150

42 HS4000 PE150 currently

46 FASTQC

47 FASTQC - Nextera

48 FASTQC

49 FASTQC

50 FASTQC

51 FASTQC

52 FASTQC

53 FASTQC

54 FASTQC

55 FASTQC

56 Optional: PCR-free libraries PCR-free library: OR if concentration allows Reduction of PCR bias against e.g. GC rich or AT rich regions, especially for metagenomic samples Library enrichment by PCR: Ideal combination: high input and low cycle number; low-bias polymerase

57 Quantitation & QC methods Intercalating dye methods (PicoGreen, Qubit, etc.): Specific to dsdna, accurate at low levels of DNA Great for pooling of indexed libraries to be sequenced in one lane Requires standard curve generation, many accurate pipetting steps Bioanalyzer: Quantitation is good for rough estimate Invaluable for library QC High-sensitivity DNA chip allows quantitation of low DNA levels qpcr Most accurate quantitation method More labor-intensive Must be compared to a control

58 Library QC by Bioanalyzer Predominant species of appropriate MW Minimal primer dimer or adapter dimers Minimal higher MW material

59 Library QC by Bioanalyzer ~ 125 bp Beautiful 100% Adapters Beautiful

60 Library QC RNA-Seq

61 Library QC

62 e.g. Illumina TruSeq kit The libraries are useable PCR overamplification artifacts: PCR Bubbles Difficult to quantify and pool A single cycle of a Reconditioning PCR rescues the library

63 Some NEB RNA-seq libraries

65 Recommended RNA input Library prep kit mrna (TruSeq) Directional mrna (TruSeq) Apollo324 library robot (strand specific) Small RNA (TruSeq) Ribo depletion (Epicentre) SMARTer Ultra Low RNA (Clontech) Ovation RNA seq V2, Single Cell RNA seq (NuGen) Starting material 100 ng 4 μg total RNA 1 5 μg total RNA or 50 ng mrna 100 ng mrna 1 μg total RNA 1 5 μg total RNA 100 pg 10 ng 10 ng 100 ng

66 RNA-seq for DGE Differential Gene Expression (DGE) 50 bp single end reads million reads per sample (eukaryotes) 10 mill. reads > 80% of annotated genes 30 mill.. reads > 90% of annotated genes 5-10 million reads per sample (bacteria) ENCODE recommendations????

67 Molecular indexing for precision counts

68 Other RNA-seq Transcriptome assembly: 300 bp paired end plus 100 bp paired end Long non coding RNA studies: 100 bp paired end million reads Splice variant studies: 100 bp paired end million reads

69 RNA-seq: cheap and dirty - 3 Tag-sequencing - Micro-array-like data - Quant-Seq - Brad-Seq (Townsley 2015)

70 3 Tag-RNA sequencing - Sequencing only a tenth of the transcript - 96 samples per HiSeq lane Only if good references are available

71 RNA-seq targeted sequencing: - Capture-seq (Mercer et al. 2014) - Nimblegen and Illumina - Low quality DNA (FFPE) - Lower read numbers 10 million reads - Targeting lowly expressed genes.

72 RNA-seq reproducibility Two big studies multi-center studies (2014) High reproducibility of data given: - same library prep kits, same protocols - same RNA samples - RNA isolation protocols have to be identical - robotic library preps?

73 Standard RNA-Seq library protocol QC of total RNA to assess integrity Removal of rrna (most common) mrna isolation rrna depletion Fragmentation of RNA Reverse transcription and secondstrand cdna synthesis Ligation of adapters PCR Amplification Purify, QC and Quantify

74 Circular RNA Evolutionary conserved Eukaryotes Spliced Some tissues contain more circrna than mrna Interpretation of ribo-depletion RNA-seq data

75 Considerations in choosing an RNA-Seq method Transcript type: - mrna, extent of degradation - small/micro RNA Strandedness: - un-directional ds cdna library - directional library Input RNA amount: ug original total RNA - linear amplification from ng RNA Complexity: - original abundance - cdna normalization for uniformity Boundary of transcripts: - identify 5 and/or 3 ends - poly-adenylation sites - Degradation, cleavage sites

76 Is strand-specific information important? Standard library (non-directional) antisense sense Neu1

77 Strand-specific RNA-seq Standard library (non-directional) Antisense non-coding RNA Sense transcripts Informative for non-coding RNAs and antisense transcripts Essential when NOT using polya selection (mrna) No disadvantage to preserving strand specificity

78 mirna-seq Reducing ligation bias with the BiooScientific Small RNA-Seq Library Prep Kit

79 Illumina NextSeq Up to 500 million clusters Rapid turnaround PE 40 bp reads RNA-Seq

80 THIRD GENERATION DNA SEQUENCING Single Molecule Real Time (SMRT ) sequencing Sequencing of single DNA molecule by single polymerase Very long reads: average reads up to 15 kb, up to 60 kb High error rate (~15%).

81 70 nm aperture Zero Mode Waveguide

82 Damien Pelt

83 What will go wrong? PacBio DNA quality? Large losses during library prep. Polymerase stops at nicks, abasic sites, or DNA adducts. Polymerase dies due to laser exposure.

First Sequencing of CGG-repeat Alleles in Human Fragile X Syndrome using PacBio RS Sequencer Paul Hagerman,

Single-molecule sequencing of pure CGG array, - first for disease-relevant allele. Loomis et al.

Direct genomic DNA sequencing of methyl groups, - direct epigenetic sequencing (paper under review).

84 First Sequencing of CGG-repeat Alleles in Human Fragile X Syndrome using PacBio RS Sequencer Paul Hagerman, Biochemistry and Molecular Medicine, SOM. Single-molecule sequencing of pure CGG array, - first for disease-relevant allele. Loomis et al. (2012) Genome Research. - applicable to many other tandem repeat disorders. Direct genomic DNA sequencing of methyl groups, - direct epigenetic sequencing (paper under review). Discovered 100% bias toward methylation of 20 CGGrepeat allele in female, first direct methylated DNA sequencing in human CGG disease. 36 CGG 95 DoD STTR award with PacBio. Basis of R01 applications. C A G T Nucleotide position

85 Iso-Seq Pacbio Sequence full length transcripts no assembly High accuracy (except very long transcripts) More than 95% of genes show alternate splicing On average more than 5 isoforms/gene Precise delineation of transcript isoforms ( PCR artifacts? chimeras?)

86 PacBio Sequel 7 times increase throughput Costs reduced 50%???

87 C 1 Single cell capture 96 to 800 capture sites Microscopic control RNA-seq, Whole genome seq, ATAC-seq

88 Nanodroplet 10X Genomics Single Cell 600 to 6000 cells

90 10X Genomics Chromium Whole Genome Sequencing De Novo genome assembly HMW DNA - small amounts (1ng)

92 25x linked read coverage

93 60 kb deletion

98 Thank you!

99 DNA library construction Fragmented DNA End Repair 5 P OH HO P 5 Blunt End Fragments A Tailing 5 P A A P 5 Single Overhang Fragments T T Adapter Ligation DNA Fragments with Adapter Ends

100 Enrichment of library fragments 5 5 PCR Amplification

101 TruSeq Chemistry: Flow Cell 8 channels Surface of flow cell coated with a lawn of oligo pairs

102 Sequencing 100 Microns 102

103 Patterned Flowcell

104 Hiseq 3000: 478 million nanowells per lane

105

106 Hi-C Lieberman-Aiden 2010

107 Hi-C Lieberman-Aiden 2010

108 Dovetail Sequencing (Putnam 2015)

109 Bisulfite Conversion METHYL-Seq

110 ChIP-Seq Chromatin Immuno Preciptation DNA/Protein interactions e.g. transcription factors

111 DRIP-Seq R-loops: three-stranded structure Genome-wide mapping of RNA-DNA hybrids

High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center

High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000