Identification of plasmid- and integron-borne bla IMP-1 and bla IMP-10 in clinical isolates of Serratia marcescens

Size: px

Start display at page:

Download "Identification of plasmid- and integron-borne bla IMP-1 and bla IMP-10 in clinical isolates of Serratia marcescens"

Jasper Fox
5 years ago
Views:

1 Journal of Medical Microbiology (2009), 58, DOI /jmm Identification of plasmid- and integron-borne bla IMP-1 and bla IMP-10 in clinical isolates of Serratia marcescens Zhuting Hu 1 and Wei-Hua Zhao 2 Correspondence Zhuting Hu taketei154@gmail.com 1 Department of Biology, The College of Liberal Arts, International Christian University, Tokyo , Japan 2 Department of Microbiology and Immunology, Showa University School of Medicine, Tokyo , Japan Received 24 September 2008 Accepted 10 October 2008 The emergence of carbapenem-hydrolysing metallo-b-lactamases (MBLs) is a serious threat to the clinical utility of carbapenems. This study identified plasmid- and integron-borne bla IMP-1 and bla IMP-10 in clinical isolates of Serratia marcescens. The bla IMP-1 and bla IMP-10 gene cassettes were carried by a class 1 integron and followed by the aac(69)-iic gene cassette. The bla IMP-1 and bla IMP-10 gene cassettes were preceded by a weak P ant promoter, TGGACA(N) 17 TAAGCT, and an inactive P2 promoter, TTGTTA(N) 14 TACAGT. These genes were easily transferred to Escherichia coli by conjugation and transformation, indicating that they are located on transferable plasmids. Due to the acquisition of bla IMP-1, the susceptibility of E. coli transconjugants to imipenem, meropenem, panipenem and biapenem decreased by 32-, 256-, 64- and 128-fold, respectively. In comparison, after gaining bla IMP-10, the susceptibility of E. coli transconjugants to the four carbapenems decreased by 64-, 2048-, 256- and 64-fold, respectively. Strains harbouring bla IMP-10 showed higher-level resistance to imipenem, meropenem and panipenem than the strains harbouring bla IMP-1, although the nucleotide sequences of the class 1 integrons carrying bla IMP-10 and bla IMP-1 were identical except for a single point mutation. INTRODUCTION Carbapenems are relatively stable agents that act against extended-spectrum b-lactamases produced by Gram-negative rods, and are one of the first-choice antibiotics for the treatment of Serratia marcescens infections (Gilbert et al., 2005). However, the occurrence and spread of genes encoding metallo-b-lactamases (MBLs) including IMP, VIM, SPM and GIM have been reported in a variety of clinical isolates of Enterobacteriaceae from 28 countries (Walsh et al., 2005). The clinical significance of MBLs is further highlighted by their ability to hydrolyse almost all b-lactams except for monobactams, and by the fact that to date there is no clinically available inhibitor (Bush, 1998; Livermore & Woodford, 2000; Nordmann & Poirel, 2002). The bla IMP-1 gene, which encodes IMP-1 MBL, was the first MBL determinant reported, initially in a clinical isolate of S. marcescens from Japan in 1994 (Ito et al., 1995; Osano et al., 1994). To date, the nucleotide sequences of 24 IMP variants have been determined (Lahey Clinic, 2008). Abbreviations: AMK, amikacin; BIPM, biapenem; CAZ, ceftazidime; CS, conserved segment; GEN, gentamicin; IPM, imipenem; MBL, metallo-blactamase; MEPM, meropenem; PAPM, panipenem; SMA, sodium mercaptoacetic acid. bla IMP-10 is a point mutation derivative of bla IMP-1 and has been identified in clinical isolates of Pseudomonas aeruginosa and Alcaligenes xylosoxidans (Iyobe et al., 2002; Zhao et al., 2008). To our knowledge, the bla IMP-10 gene has not been identified among Enterobacteriaceae strains. MBL genes are usually found as gene cassettes in integrons, mostly in class 1 integrons (Shibata et al., 2003). An integron is a mobile DNA element that can capture and carry genes, particularly antibiotic-resistance genes, by site-specific recombination (Bennett, 1999; Hall & Collis, 1995; Stokes & Hall, 1989). Five classes of integron are known to play a role in the dissemination of antibiotic resistance, and class 1 integrons are the most extensively studied (Mazel, 2006). Typical class 1 integrons contain two conserved segments (CSs), the 59- and 39-CS. The 59-CS includes the inti1 gene encoding integrase, the atti site for addition of the inserted gene cassette and a promoter(s). The 39-CS is composed of the qaced1 and sul1 genes, which are responsible for resistance to quaternary ammonium compounds and sulphonamides, respectively. Over 80 different gene cassettes carried by class 1 integrons have been described (Mazel, 2006). Four different P ant and two different P2 promoters have been described (Bunny et al., 1995; Stokes & Hall, 1989) G 2009 SGM Printed in Great Britain 217

2 Z. Hu and W.-H. Zhao and their relative strengths have been compared with that of the Escherichia coli tac promoter (Collis & Hall, 1995; Lévesque et al., 1994). TTGACA(N) 17 TAAACT and TGGACA(N) 17 TAAGCT are described as strong and weak P ant promoters, respectively. Two other promoters, TTGACA(N) 17 TAAGCT and TGGACA(N) 17 TAAACT, are described as hybrid promoters. The P2 promoters have an active version, TTGTTA(N) 17 TACAGT, and an inactive version, TTGTTA(N) 14 TACAGT, in which the 235 and 210 regions are separated by 14 nt, a distance that is not optimal for promoter function. In this study, we identified plasmid- and integron-borne bla IMP-1 and bla IMP-10 in clinical isolates of S. marcescens and compared the carbapenem susceptibilities of the E. coli transconjugants and transformants after acquiring bla IMP-1 and bla IMP-10. METHODS Bacterial strains and reagents. S. marcescens strains S#1, S#2 and S#3 were bla IMP -positive clinical isolates recovered from unrelated inpatients at Showa University Hospital, Tokyo, Japan, in S. marcescens S#4, a susceptible isolate, was used as a control. Competent cells of E. coli strains HB101 and JM109 (Wako Pure Chemical Industries) were used as recipients for conjugation and transformation, respectively. The following reagents were purchased from commercial sources: imipenem (IPM) (US Pharmacopeia); meropenem (MEPM) and biapenem (BIPM) (LKT Laboratories); panipenem (PAPM) (Sankyo Organic Chemicals); gentamicin (GEN) and amikacin (AMK) (Sigma); ceftazidime (CAZ) discs (Becton Dickinson); and sodium mercaptoacetic acid (SMA) discs (Eiken Chemical). Susceptibility testing. The susceptibilities of bacteria to various antibiotics were expressed as MICs, determined by the broth microdilution method according to Clinical and Laboratory Standards Institute guidelines (formerly the National Committee for Clinical Laboratory Standards) (NCCLS, 2000). All experiments were performed at least three times to establish reproducibility. Confirmation of bla IMP expression. Double-disc synergy testing was performed to confirm the expression of bla IMP by using discs containing CAZ, a third-generation cephalosporin, and SMA, a specific inhibitor of MBLs (Arakawa et al., 2000). Bacterial cells ( ) were inoculated onto a Mueller Hinton agar plate (Becton Dickinson) and discs were then set with a distance of 1.5 cm between the CAZ and SMA discs. After incubating the plates at 35 uc for 24 h, zones of inhibition were measured. PFGE. PFGE of SpeI-digested genomic DNA from S. marcescens isolates was carried out using a CHEF-DRIII System (Bio-Rad) according to the manufacturer s directions. The restriction patterns were evaluated according to a standard, as described previously (Tenover et al., 1995). Transfer of resistance determinants. Resistance factors were transferred from S. marcescens to E. coli HB101 by conjugation with a donor : recipient ratio of 1 : 1 in Luria Bertani (LB) broth at 37 uc for 2 h. Transconjugants were selected on LB agar plates containing ampicillin and streptomycin (64 mg ml 21 ). E. coli JM109 was used as the recipient for transformation of purified plasmids from S. marcescens. Plasmid DNA was prepared using a QIAprep Spin Miniprep kit (Qiagen) and transformed into E. coli JM109 by electroporation with a Gene Pulser apparatus (Bio-Rad). The plasmids from S. marcescens S#1, S#2 and S#3 were designated ps#1, ps#2 and ps#3, respectively. Transformants were selected on LB agar plates containing 64 mg ampicillin ml 21 and reisolated with 16 mg cefotaxime ml 21. Transconjugants were designated E. coli HB101-pS#1, -ps#2 and -ps#3, and transformants were designated E. coli JM109-pS#1, -ps#2 and -ps#3, respectively. Identification of resistance gene cassettes and associated integrons by PCR and DNA sequencing. The primers used for detecting resistance gene cassettes and associated integrons are listed in Table 1. Forward primers were coupled with the appropriate reverse primers: inti1-f and imp-r for amplification of the 59-CS and bla IMP genes, and imp-f and sul1-r for amplification of bla IMP genes and the 39-CS. PCR was performed under the following conditions: 30 cycles of denaturation at 95 uc for 40 s, annealing at 58 uc for 60 s and extension at 72 uc for 60 s. The amplicons were purified using a QIAquick PCR purification kit, and sequenced on an Applied Biosystems 3730xl DNA analyser. Sequences were compared with the GenBank database via the BLAST network service. RESULTS Transfer and expression of resistance determinants PCR analysis indicated that the S. marcescens clinical isolates S#1, S#2 and S#3 carry bla IMP genes. By PFGE Table 1. Primers used in this study Primer Sequence (5 A3 ) PCR product (bp) Target gene GenBank accession no. imp-f CTACCGCAGCAGAGTCTTTG 588 bla IMP D50438 imp-r AACCAGTTTTGCCTTACCAT aac(69)-iic-f GCCCAACTCTTGACGAAGTC 309 aac(69)-iic AF aac(69)-iic-r GGTTGCTAGGAGATGGATCG inti1-f ACATGCGTGTAAATCATCGTCG 484 inti1 U49101 inti1-r GGGTCAAGGATCTGGATTTCG qaced1-f GGCTGGCTTTTTCTTGTTATCG 274 qaced1 U49101 qaced1-r TGAGCCCCATACCTACAAAGC sul1-f TGGTGACGGTGTTCGGCATTC 784 sul1 U49101 sul1-r GTTTCCGAGAAGGTGATTGCG 218 Journal of Medical Microbiology 58

3 Plasmid- and integron-borne bla IMP-1 and bla IMP-10 analysis of chromosomal DNA restriction patterns, the three strains were confirmed to be different. The bla IMP genes carried by these strains were easily transferred to E. coli HB101 by conjugation and to E. coli JM109 by electroporation. Expression of MBLs in the E. coli transconjugants and transformants was confirmed by double-disc (CAZ and SMA) synergy testing. An obvious inhibition zone (.12 mm) was observed around the side of the CAZ disc facing the SMA disc, suggesting that the E. coli transconjugants and transformants produced MBL and that the enzymic activity was blocked by the specific inhibitor SMA (data not shown). Structure of integrons carried by the plasmids derived from S. marcescens S#1, S#2 and S#3 To exclude a possible effect of chromosomal DNA in the wild-type S. marcescens S#1, S#2 ands#3, plasmids ps#1, ps#2 andps#3 prepared from E. coli transconjugants were used as templates for PCR amplification. Amplicons of 1729 and 2791 bp were obtained when the primers inti1-f and imp-r, and imp-f and sul1-r were combined, respectively. These two amplicons were sequenced and the resultant sequences were joined to form a DNA fragment of 3933 bp. A BLAST search showed that the 3933 bp DNA fragments from the three plasmids belonged to class 1 integrons, and we designated these In-s1, In-s2 and In-s3. These integrons contained the 59-CS inti1, the 39-CS qaced1 and sul1, and a variable region where two gene cassettes, bla IMP and aac(69)-iic, were inserted (Fig. 1). The bla IMP genes in In-s1 and In-s2 were identical to the bla IMP-1 that was first identified in the S. marcescens AK9373 strain (GenBank accession no. D50438), but was carried by a class 3 integron (Arakawa et al., 1995). The bla IMP gene in In-s3 was a point mutation derivative of bla IMP-1 with a single base replacement of G by T at nt 145 leading to an amino acid alteration of Val 49 APhe, identical to bla IMP-10 found in P. aeruginosa strains (GenBank accession no. AB074433) (Iyobe et al., 2002). The bla IMP-1 and bla IMP-10 gene cassetteswere preceded by a weak P ant promoter, TGGACA(N) 17 TAAGCT, and an inactive P2 promoter, TTGTTA(N) 14 TACAGT, which were located at the 59-end of the integrase 1 gene. The aac(69)-iic cassettes were located downstream of the bla IMP-1 or bla IMP-10 cassette and were identical to the sequence derived from a P. aeruginosa isolate (GenBank accession no. AF162771) (Galani et al., 2005). Comparison of the resistance phenotypes of bla IMP-1 and bla IMP-10 S. marcescens strains S#1, S#2 and S#3 were highly resistant to the carbapenems IPM, MEPM, PAPM and BIPM (MICs of mg ml 21 ) and exhibited intermediate or low resistance to GEN and AMK (MICs of 4 64 mg ml 21 ) (Table 2). E. coli transconjugants and transformants showed a reduced susceptibility to carbapenems. As a result of the acquisition of bla IMP-1, the susceptibility of E. coli transconjugants to IPM, MEPM, PAPM and BIPM decreased by 32-, 256-, 64- and 128-fold, respectively. Notably, after gaining bla IMP-10, the susceptibility of E. coli transconjugants to the four carbapenems decreased by 64-, 2048-, 256- and 64-fold, respectively. The same tendency was also observed when the susceptibilities of E. coli transformants were tested to IPM, MEPM, PAPM and BIPM (Table 2). All E. coli transconjugants and transformants gained the aac(69)-iic gene cassette, which expresses an aminoglycoside 69-N-acetyltransferase capable of acetylating GEN, tobramycin and netilmicin but not AMK. Consistent with the obtained genotype, the transconjugants and transformants showed a reduced susceptibility to GEN, but maintained susceptibility to AMK (Table 2). DISCUSSION The clustering of several resistance genes in integrons favours the concerted acquisition of antibiotic-resistance Fig. 1. Schematic structures of integrons Ins1 and In-s3. The two integrons are located on transferable plasmids from S. marcescens S#1 and S#3. Arrows represent genes and their transcriptional direction. Open circles represent the atti site; filled circles represent the attc sites (e.g. the 59-base element).

4 Z. Hu and W.-H. Zhao Table 2. Phenotypes and genotypes of wild-type S. marcescens, E. coli HB101 and JM109 and their transconjugants and transformants Strain MIC (mg ml 1 ) Genotype Carbapenem Aminoglycoside bla IMP-1 bla IMP-10 aac(6 )-IIc CS of integron 1 IPM MEPM PAPM BIPM GEN AMK inti1 qaced1 sul1 Wild-type S. marcescens S# S# S# S# E. coli HB101 and transconjugants E. coli HB E. coli HB101-pS# E. coli HB101-pS# E. coli HB101-pS# E. coli JM109 and transformants E. coli JM E. coli JM109-pS# E. coli JM109-pS# E. coli JM109-pS# determinants. The bla IMP-1 and bla IMP-10 genes that we studied were inserted in class 1 integrons followed by the aac(69)-iic cassette. The integrons In-s1, In-s2 and In-s3 had the weak promoter P ant, TGGACA(N) 17 TAAGCT, and the inactive promoter P2, TTGTTA(N) 14 TACAGT. Furthermore, the integrons were carried by a transferable plasmid, allowing the rapid spread of multidrug-resistant genes among members of the Enterobacteriaceae in clinical settings. To evaluate the effect of a plasmid-borne bla IMP gene on susceptibility of bacterial cells to carbapenems, E. coli transconjugants and transformants are more suitable models than wild-type strains because factors such as the outer-membrane barrier and efflux system, possibly possessed by wild-type strains, can be excluded. Of note, it was observed that E. coli transconjugants and transformants harbouring bla IMP-10 showed higher levels of resistance to IPM, MEPM and PAPM than the strains harbouring bla IMP-1, although nucleotide sequences of the class 1 integrons carrying bla IMP-10 and bla IMP-1 are identical except for a single point mutation. The mechanism of this phenomenon is unclear. One possible explanation is that IMP-10 MBL is more potent than IMP-1 MBL with respect to hydrolysis of IPM, MEPM and PAPM but not BIPM. In a previously published paper, the kinetic parameters of purified IMP-1 and IMP-10 MBL in hydrolysing IPM, MEPM and other b-lactams were determined (Iyobe et al., 2002). Compared with the rate of hydrolysis (K cat ) of IMP-1 MBL (130 and 13 s 21 for IPM and MEPM, respectively), IMP-10 MBL showed the much higher K cat values of 220 and 64 s 21, respectively. However, no significant differences in the specificity constant (K cat /K m ) were observed between IMP-1 and IMP-10 MBL. Further experiments are therefore needed to clarify the detailed mechanism(s). In conclusion, nucleotide sequences of the class 1 integrons carrying bla IMP-1 and bla IMP-10 are identical except for a single point mutation. Strains harbouring bla IMP-10 showed higher-level resistance to IPM, MEPM and PAPM than strains harbouring bla IMP-1, and the location of the integrons on transferable plasmids makes the intra- and interspecies transfer of the resistance genes very efficient. ACKNOWLEDGEMENTS We thank Dr Makito Kobayashi, Department of Biology, The College of Liberal Arts, International Christian University, for providing valuable suggestions. REFERENCES Arakawa, Y., Murakami, M., Suzuki, K., Ito, H., Wacharotayankun, R., Ohsuka, S., Kato, N. & Ohta, M. (1995). A novel integron-like element carrying the metallo-b-lactamase gene bla IMP. Antimicrob Agents Chemother 39, Arakawa, Y., Shibata, N., Shibayama, K., Kurokawa, H., Yagi, T., Fujiwara, H. & Goto, M. (2000). Convenient test for screening metallob-lactamase-producing Gram-negative bacteria by using thiol compounds. J Clin Microbiol 38, Bennett, P. M. (1999). Integrons and gene cassettes: a genetic construction kit for bacteria. J Antimicrob Chemother 43, 1 4. Bunny, K. L., Hall, R. M. & Stokes, H. W. (1995). New mobile gene cassettes containing an aminoglycoside resistance gene, aaca7, and a chloramphenicol resistance gene, catb3, in an integron in pbwh301. Antimicrob Agents Chemother 39, Journal of Medical Microbiology 58

5 Plasmid- and integron-borne bla IMP-1 and bla IMP-10 Bush, K. (1998). Metallo-b-lactamases: a class apart. Clin Infect Dis 27 (Suppl. 1), S48 S53. Collis, C. M. & Hall, R. M. (1995). Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob Agents Chemother 39, Galani, I., Souli, M., Chryssouli, Z., Orlandou, K. & Giamarellou, H. (2005). Characterization of a new integron containing bla VIM-1 and aac(6 )-IIc in an Enterobacter cloacae clinical isolate from Greece. J Antimicrob Chemother 55, Gilbert, D. N., Moellering, R. C., Eliopoulos, G. M. & Sande, M. A. (2005). The Sanford Guide to Antimicrobial Therapy 2005, 35th edn. Hyde Park, VT: Antimicrobial Therapy. Hall, R. M. & Collis, C. M. (1995). Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol Microbiol 15, Ito, H., Arakawa, Y., Ohsuka, S., Wacharotayankun, R., Kato, N. & Ohta, M. (1995). Plasmid-mediated dissemination of the metallo-blactamase gene bla IMP among clinically isolated strains of Serratia marcescens. Antimicrob Agents Chemother 39, Iyobe, S., Kusadokoro, H., Takahashi, A., Yomoda, S., Okubo, T., Nakamura, A. & O Hara, K. (2002). Detection of a variant metallo-blactamase, IMP-10, from two unrelated strains of Pseudomonas aeruginosa and an Alcaligenes xylosoxidans strain. Antimicrob Agents Chemother 46, Lahey Clinic (2008). Amino acid sequences for TEM, SHV and OXA extended-spectrum and inhibitor resistant b-lactamases. (accessed 24 September 2008). Lévesque, C., Brassard, S., Lapointe, J. & Roy, P. H. (1994). Diversity and relative strength of tandem promoters for the antibioticresistance genes of several integrons. Gene 142, Livermore, D. M. & Woodford, N. (2000). Carbapenemases: a problem in waiting? Curr Opin Microbiol 3, Mazel, D. (2006). Integrons: agents of bacterial evolution. Nat Rev Microbiol 4, NCCLS (2000). Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria that Grow Aerobically, 5th edn. Document M7- A5. Wayne, PA: National Committee for Clinical Laboratory Standards. Nordmann, P. & Poirel, L. (2002). Emerging carbapenemases in Gram-negative aerobes. Clin Microbiol Infect 8, Osano, E., Arakawa, Y., Wacharotayankun, R., Ohta, M., Horii, T., Ito, H., Yoshimura, F. & Kato, N. (1994). Molecular characterization of an enterobacterial metallo b-lactamase found in a clinical isolate of Serratia marcescens that shows imipenem resistance. Antimicrob Agents Chemother 38, Shibata, N., Doi, Y., Yamane, K., Yagi, T., Kurokawa, H., Shibayama, K., Kato, H., Kai, K. & Arakawa, Y. (2003). PCR typing of genetic determinants for metallo-b-lactamases and integrases carried by Gramnegative bacteria isolated in Japan, with focus on the class 3 integron. JClinMicrobiol41, Stokes, H. W. & Hall, R. M. (1989). A novel family of potentially mobile DNA elements encoding site-specific gene-integration functions: integrons. Mol Microbiol 3, Tenover, F. C., Arbeit, R. D., Goering, R. V., Mickelsen, P. A., Murray, B. E., Persing, D. H. & Swaminathan, B. (1995). Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 33, Walsh, T. R., Toleman, M. A., Poirel, L. & Nordmann, P. (2005). Metallo-b-lactamases: the quiet before the storm? Clin Microbiol Rev 18, Zhao, W.-H., Hu, Z.-Q. & Shimamura, T. (2008). Potency of IMP-10 metallo-b-lactamase in hydrolysing various antipseudomonal b- lactams. J Med Microbiol 57,

Emergence and persistence of integron structures harbouring VIM genes in the Children s Memorial Health Institute, Warsaw, Poland,

Journal of Antimicrobial Chemotherapy (2009) 63, 269 273 doi:10.1093/jac/dkn512 Advance Access publication 18 December 2008 Emergence and persistence of integron structures harbouring VIM genes in the