Emergence of Pseudomonas aeruginosa strains producing metallob-lactamases of the IMP-15 and VIM-2 types in Mexico

Transcription

1 ORIGINAL ARTICLE /j x Emergence of Pseudomonas aeruginosa strains producing metallob-lactamases of the IMP-15 and VIM-2 types in Mexico F. Quinones-Falconi 1, M. Galicia-Velasco 1, P. Marchiaro 2, M. A. Mussi 2, V. Ballerini 4, A. J. Vila 3, A. M. Viale 2, K. Bermejo-Morales 1 and A. S. Limansky 2 1) Servicio de Microbiología Clínica, Instituto Nacional de Enfermedades Respiratorias, Mexico City, Mexico, 2) Departamento de Microbiología, 3) Departamento de Química Biológica, Instituto de Biología Molecular y Celular de Rosario (IBR), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario and 4) Hospital Intendente Carrasco, Departamento Bioquímico Municipal, Secretaría de Salud Pública, Municipalidad de Rosario, Rosario, Argentina Abstract Eighty-six carbapenem non-susceptible Pseudomonas aeruginosa isolates collected in the National Institute of Respiratory Diseases of Mexico City were screened for the presence of metallo-b-lactamase (MBL) activity using both E-test strips and a microbiological assay with EDTA-imipenem. Genomic comparisons and sequence analyses conducted with these isolates revealed the presence of bla VIM-2 in two clonally related isolates, and bla IMP-15 in a clonally unrelated isolate. Both genes were found to be carried by class 1 integrons, and bla IMP-15 was additionally present on a broad host-range plasmid. This is the first report of co-existing P. aeruginosa strains producing different MBLs in a Mexican hospital, highlighting the necessity of appropriate surveillance to prevent dissemination of carbapenem resistance. Keywords: Carbapenem resistance, IMP-15, metallo-b-lactamases, Pseudomonas aeruginosa, VIM-2 Original Submission: 23 July 2008; Revised Submission: 23 September 2008; Accepted: 14 October 2008 Editor: R. Canton Article published online: 18 May 2009 Clin Microbiol Infect 2010; 16: Corresponding author and reprint requests: A. S. Limansky, Departamento de Microbiología, Instituto de Biología Molecular y Celular de Rosario (CONICET), Facultad de Ciencias Bioquímicas y Farmacéuticas, Universidad Nacional de Rosario, Suipacha 531, 2000 Rosario, Argentina limansky@ibr.gov.ar Introduction Metallo-b-lactamases (MBLs) represent a major emerging antimicrobial resistance determinant among Pseudomonas aeruginosa strains present in nosocomial infections [1,2]. Special concern is raised by the occurrence of MBL genes within particular genetic structures that also carry other antimicrobial resistance genes, known as integrons, as a result of their wide potential for expression and dissemination [1 3]. Pseudomonas aeruginosa strains harbouring integrons possessing different MBL genes appear to be common in many countries of Asia, Europe and South America [2]. However, the presence in Mexico of MBL-bearing P. aeruginosa has been detected only recently, and includes carbapenem-resistant strains containing either bla IMP-18 or bla IMP-15, both harboured in class 1 integrons [4 6]. These findings represent a worrying scenario that emphasizes the need for regional surveillance studies highlighting both the extent and potential spread of this emerging mechanism of b-lactam resistance [1]. In the present study, we report a 2-year survey of MBLs prevalent among P. aeruginosa clinical isolates in a teaching hospital in Mexico. Materials and Methods Bacterial isolates The present study encompassed a total of 431 consecutive P. aeruginosa isolates collected between 1 January 2004 and 31 December 2005 from patients attending the National Institute of Respiratory Diseases, Mexico City. Among these isolates, 336 (78%) were from clinical samples obtained from inpatients, and the remainder (22%) were obtained from outpatients. Of the 431 isolates, 368 (85.4%) were isolated from samples derived from respiratory sources, 15 (3.5%) were from blood, and 48 Journal Compilation ª2009 European Society of Clinical Microbiology and Infectious Diseases

2 CMI Quinones-Falconi et al. MBL-producing P. aeruginosa in Mexico 127 (11.1%) were from other clinical sources. Each isolate was obtained from a different patient. Bacterial species identification and susceptibility testing All P. aeruginosa isolates were identified by conventional microbiological procedures. Bacterial susceptibility to different antimicrobials, including imipenem, meropenem, amikacin, ciprofloxacin, piperacillin-tazobactam, ticarcillin-clavulanic acid, ceftazidime, cefepime and aztreonam, was evaluated with the Sensititre ARIS system (Trek Diagnostic Systems, East Grinstead, UK). Imipenem and meropenem susceptibility were additionally tested with a standard broth microdilution assay following the guidelines of the CLSI [7]. Pseudomonas aeruginosa isolates producing MBLs were also tested with the latter test employing all antimicrobials mentioned above. Screening of MBL-producing strains MBL producers were detected by two different procedures, E-test MBL strips (AB Biodisk, Solna, Sweden), and the EDTAimipenem (EIM) microbiological assay using cell extracts [8]. For the latter, bacterial colonies were carefully removed from the surface of a fresh overnight culture on a Mueller Hinton agar plate, and transferred to a pre-weighed 1.5-mL microcentrifuge tube until approximately 100 mg of wet cells were collected. The cells were carefully suspended in 1 ml of 50 mm Tris HCl (ph 8), recovered by centrifugation at 1500 g for 10 min, and the bacterial pellet was subjected to ten cycles each consisting of 15 min of freezing at )20 C followed by 10 min of thawing at 37 C. The extract thus obtained was clarified by centrifugation at 6000 g for 10 min, and the supernatant was assayed for MBL activity as described previously [8]. Identification of MBL genes and integrons The presence of bla VIM-like, bla IMP-like, and bla SPM-1 genes was detected by PCR using primers described previously [8], except in the case of bla IMP-like, where the reverse primer used was IMP-19R (Table 1). Association of integrons with TABLE 1. Sequences of primers used in the present study Target gene or Primers region (5 3 ) a Expected PCR product (pb) Reference bla IMP-like IMP1-F GAGCAAGTTATYTGTATTCT 664 Present study IMP19-R TCYMAHGTAMGYTTCAAGAG bla VIM-like VIM-F ATTGGTCTATTTGACCGCGT VIM-R CTACTCAACGACTGAGCGAT bla SPM-1 SPM-F GGCGCGTTTTGTTTGTTG SPM-R CTACAGTCTCATTTCGCCAACG 5 -CS INT1-F GGCATCCAAGCAGCAAG CS INT1-R AAGCAGACTTGACCTGA 19 a Y: C, T; M: A, C; H: A, T, C. MBL genes was investigated by PCR using a given pair of an MBL gene-specific primer and an integron-specific primer (Table 1). All PCR amplicons were sequenced at the Sequencing Facility of the University of Maine (Orono, ME, USA) and the corresponding genes were further identified by database sequence similarity comparisons [9]. Pulsed-field gel electrophoresis (PFGE) Bacterial DNA was prepared as described by Barth et al. [10]. A contour-clamped homogeneous electric field mapper system (CHEF MAPPER; Bio-Rad, Hercules, CA, USA) was used for PFGE to analyse SpeI (Invitrogen, Carlsbad, CA, USA)- digested DNA at a voltage of 6 V/cm at 13 C for 22 h, with pulse times of 1 40 s. Gels were stained with ethidium bromide, photographed and examined by Chemidoc XRS and Quantity One software (Bio-Rad). PFGE patterns were interpreted in accordance with the guidelines of Tenover et al. [11]. Pseudomonas aeruginosa plasmid analysis Plasmid DNA was extracted from MBL-producing P. aeruginosa isolates by the alkaline-lysis method [12], and used to transform electrocompetent Escherichia coli DH5a cells [12]. The transformed bacteria were plated on Luria Bertani agar supplemented with 16 mg/l of ampicillin, and different clones were collected for MBL production using the EIM assay [8]. In addition, MICs of ampicillin, cephalothin, cefoxitin, ceftazidime, cefepime, imipenem, meropenem, aztreonam, gentamicin, amikacin, ciprofloxacin and levofloxacin were determined for transformed E. coli cells using the standard broth microdilution test [7]. The presence of bla IMP-15 in the above E. coli transformants was tested by PCR using the specific primers shown in Table 1. Plasmids were extracted from these bacteria by the alkaline lysis method described above, and further characterized by EcoRI or HindIII digestion followed by electrophoretic agarose gel (0.7%) analysis of the fragments [12]. Hybridization studies Chromosomal or plasmid location of bla VIM-2 genes in P. aeruginosa strain 918 was evaluated by Southern blot analysis as described previously [12] with a 32 P-labelled probe generated by PCR using bla VIM-2 -specific primers (Table 1). Total DNA from this bacterial strain was purified as described previously [12] and further digested with HindIII, EcoRI, BamHI or PstI (Invitrogen) in accordance with the manufacturer s instructions. The resulting fragments were then separated by 0.7% agarose gel electrophoresis and transferred to nylon membranes (Hybond; Amersham Pharmacia Biotech, Piscataway, NJ, USA) for Southern analysis. Plasmid DNA was extracted by the alkaline lysis method [12], digested with the restric-

3 128 Clinical Microbiology and Infection, Volume 16 Number 2, February 2010 CMI tion enzymes indicated above, and treated as above for Southern analysis. Digestion of plasmid samples to remove chromosomal DNA contamination was carried out with ExoIII nuclease (Takara Bio, Inc., Tokyo, Japan) treatment in accordance with previously described procedures [12]. Southern blots were analysed in a Storm Phosphorimager 840 (GE Healthcare, Piscataway, NJ, USA) in accordance with the manufacturer s instructions. Results and Discussion FIG. 1. Pulsed-field gel electrophoresis profiles of SpeI-digested genomic DNA from Pseudomonas aeruginosa strains carrying the MBL genes under investigation. Lane 1, strain 70 carrying bla IMP-15 ; lanes 2 and 3, strains 918 and 4401, respectively, both carrying bla VIM-2.M, Pulse Marker, a mixture of Lambda DNA HindIII fragments, Lambda DNA, and Lambda concatemers covering a kbp range (Krackeler Scientific, Inc., Albany, NY, USA). From a total of 431 P. aeruginosa clinical isolates collected during the 2-year period ( ) of the study, 86 (19.9%) were considered as non-susceptible to imipenem and meropenem on the basis of their MIC values (breakpoint of > 4 mg/l). From these, only three isolates (numbers 70, 918 and 4401; Table 2) tested positive for MBL activity using the EIM assay [8]. Similarly, E-test MBL strip testing indicated the presence of MBLs as judged by the EDTA effect on the corresponding MICs of imipenem; for isolate 70, the MIC was reduced from 96 to 6 mg/l, for isolate 918, the MIC was reduced from 64 to 1 mg/l, and, for isolate 4401, the MIC was reduced from from 32 to 1 mg/l, in the absence vs. the presence of EDTA in each case. Admission dates, clinical characteristics, and outcome for the different patients infected by these strains are shown in Table 2. The presence of bla VIM-like, bla IMP-like and bla SPM-1 in P. aeruginosa strains 70, 918 and 4401 was evaluated by PCR. Further confirmation of the identity of the corresponding genes after DNA sequencing and database sequence similarity comparisons revealed that P. aeruginosa strains 918 and 4401 both carried bla VIM-2, and that P. aeruginosa 70 contained bla IMP-15. The genomic relatedness of the P. aeruginosa strains was evaluated by PFGE of SpeI-digested DNA samples. The restriction patterns thus obtained indicated no genomic difference between bla VIM-2 -containing isolates 918 and 4401 (designated as clone B in Table 2; Fig. 1, lanes 2 and 3), therefore suggesting the dissemination of this clone in the hospital. The restriction profile of the bla IMP-15 -containing P. aeruginosa 70 (designated clone A in Table 2; Fig. 1, lane 1) was clearly different from that of clone B, indicating the presence of two non-related, co-existing P. aeruginosa strains producing different MBLs in this hospital. Because bla VIM and bla IMP genes are mainly found within class 1 integrons [2,3], we subsequently analysed whether the same situation occurred for the bla IMP-15 and bla VIM-2 genes detected in the above P. aeruginosa strains. This was carried out by PCR using 5 -CS as the direct primer (designed after the 5 -conserved segment of class 1 integrons) and either IMP-19R or VIM-R in the case of P. aeruginosa strains 70 or 918 as the corresponding reverse primer, respectively (Table 1). In both cases, one main PCR product TABLE 2. Clinical features of MBL-producing Pseudomonas aeruginosa clinical isolates used in the present study Isolate a Collection date Site of infection Days of hospitalization Previous antibiotics Response to treatment Clinical outcome PFGE pattern MIC (mg/l) AMK CIP CAZ FEP TZP TIC ATM IPM Lung 5 None Favorable Alive A >256 >32 >32 > > Blood 25 Cefepime No response Died B > > Amikacin Lung 91 Cefepime Clindamycin Favorable Alive B 128 > a The three isolates came from three different patients. PGFE, pulsed-field gel electrophoresis; AMK, amikacin; CIP, ciprofloxacin; CAZ, ceftazidime; FEP, cefepime; TZP, piperacillin-tazobactam; TIC, ticarcillin-clavulanic acid; ATM, aztreonam; IPM, imipenem. MIC values were determined by broth microdilution assay [7].

4 CMI Quinones-Falconi et al. MBL-producing P. aeruginosa in Mexico 129 was obtained, and subsequent analyses [9] revealed that, in P. aeruginosa strain 70, bla IMP-15 is present in a class 1 integron preceded by an aminoglycoside acetyltransferase gene (aaca7) located immediately downstream of the conserved 5 -segment of this element. It is noteworthy that this sequence is identical to the 5 region of the In95 class 1 integron recently described in Mexican hospitals, but differs from the equivalent region found in other bla IMP-15 -containing integrons described in other parts of the world, such as Thailand [5]. In the case of P. aeruginosa strain 918, bla VIM-2 is also present in a class 1 integron, representing the first resistance gene present immediately adjacent to the 5 -conserved segment of the element. This is exactly the position found for the equivalent gene in class 1 integrons in other P. aeruginosa strains that have been described in different regions of Latin America [13], but it differs from that in the class 1 integrons characterized in other geographic areas, including Europe, Asia or the USA [3,14,15]. This gene arrangement found in class 1 integrons in Latin America is therefore worthy of note in the light of the fact that VIM-2 was first described only recently in this geographic area [13]. We next analysed the possibility that the above integrons could be harbored by plasmids. For this purpose, P. aeruginosa 70, 918 and 4401 were subjected to the alkaline-lysis method of plasmid extraction [12], and the material thus obtained was subsequently transformed into electrocompetent E. coli DH5a cells. The transformed bacteria were plated onto Luria Bertani nutrient agar containing 16 mg/l of ampicillin, and selected clones were analysed for antimicrobial susceptibility and the presence of plasmids. As shown in Table 3, E. coli cells transformed with plasmids derived from P. aeruginosa 70 (which carries a class 1 TABLE 3. Comparison of MICs of different antimicrobial agents for Escherichia coli DH5a (control cells) and E. coli DH5a (pmx70) Antimicrobial tested MIC (mg/l) Control cells Ampicillin 8 32 Cephalothin 4 32 Cefoxitin 4 32 Ceftazidime Cefepime Imipenem Meropenem Aztreonam Gentamicin 1 1 Amikacin a 2 4 Ciprofloxacin Levofloxacin Escherichia coli (pmx70) a Sequencing analysis indicates that pmx70 bears a class 1 integron containing aaca7 besides bla IMP-15. integron containing aaca7 and bla IMP-15 genes; see above) demonstrated decreased susceptibility to all b-lactams tested (with the exception of aztreonam) and also to amikacin. Indeed, MIC values for the transformed cells (relative to non-transformed bacteria) increased as follows: by 128-fold in the case of ceftazidime, 16-fold for cefepime, 8-fold for cephalothin and cefoxitin, 4-fold for ampicillin and meropenem, and 2-fold for imipenem and amikacin. By contrast, bacterial susceptibility to gentamicin, ciprofloxacin and levofloxacin remained unchanged (Table 3). The overall results indicated that the class 1 integron present in P. aeruginosa 70 is borne on a broad host-range plasmid. In agreement, restriction enzyme analysis revealed the presence in the transformed E. coli cells of a plasmid of a size estimated at c. 30 kbp (Fig. S1). PCR assays with bla IMP -specific primers (see above) further confirmed the presence of bla IMP-15 in this plasmid, which was designated pmx70. The ability of pmx70 to direct expression of bla IMP-15 in E. coli was further tested by the EIM assay using bacterial extracts [8]. Hydrolysis of imipenem and inhibition by EDTA in this assay further confirmed MBL production by pmx70-transformed E. coli cells. Transformation of E. coli cells with plasmids derived from P. aeruginosa strain 918, which carries a class 1 integron containing bla VIM-2 (see above), consistently failed to generate ampicillin-resistant bacteria. We thus evaluated by Southern blot analysis whether the bla VIM-2 gene is located in the chromosome or in plasmids present in this particular strain (Fig. S2). An analysis was conducted on total DNA as well as on plasmids purified from this bacterial strain, both digested with several restriction enzymes using 32 P-labelled bla VIM-2 as a probe. Clear positive signals were observed in samples derived from restriction enzyme treatments on total DNA (lanes 2 5). Moreover, treatment with ExoIII nuclease totally abolished labelling (lane 1), as expected from the presence of the bla VIM-2 gene in linear DNA fragments that result from chromosome shearing during extraction [12]. In agreement, very weak to no signals were observed in plasmid samples that were treated similarly (lanes 6 11). The overall results indicate that bla VIM-2 is located in the chromosome of P. aeruginosa strain 918. Furthermore, they provide experimental support to previous proposals made in other studies [13] that bla VIM-2 genes in P. aeruginosa strains present in Latin America are most likely to be chromosomeborne rather than carried on plasmids. It is also relevant that bi-parental conjugation assays conducted between P. aeruginosa strains 70, 918 or 4401 (serving as DNA donors) and rifampicin-resistant E. coli DH5a as DNA recipient [16] consistently failed to indicate the transfer of ampicillin resistance, thereby reinforcing the above conclusions.

5 130 Clinical Microbiology and Infection, Volume 16 Number 2, February 2010 CMI The emergence of carbapenem resistance is of particular concern in the treatment of P. aeruginosa infections because these antimicrobials constitute the last resort for the treatment of this life-threatening pathogen [17,18]. Reports of acquired MBLs among non-fermentative bacterial pathogens are increasing worldwide, although their prevalence in Latin America is so far limited [2,13]. The present study is the first to uncover the presence of co-existing P. aeruginosa strains producing different MBLs in the National Institute of Respiratory Diseases of Mexico City. The prevalence of these enzymes was 3.5% among carbapenem-non-susceptible P. aeruginosa isolates collected in this institution (3/86 isolates). Among them, bla VIM-2 was present in two clonally related isolates, and the recently described bla IMP-15 was identified in a clonally unrelated isolate. Most importantly, both bla VIM-2 and bla IMP-15 are harboured in these P. aeruginosa strains by class 1 integrons, and bla IMP-15 additionally is present on a broad host-range plasmid; all in all, these comprise worrying scenarios that demand mandatory surveillance to prevent the generalized spread of carbapenem resistance. Acknowledgements Partial results of this study were previously presented at the Congreso Anual de la Asociación Mexicana de Infectología y Microbiología Clínica, Aguascalientes, Mexico (March 2007). Transparency Declaration This work was supported by grants from the Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT, Argentina); Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET); Howard Hughes Medical Institute (HHMI); and Departamento de Salud Pública, Municipalidad de Rosario. A.M.V. and A.J.V. are Staff Members of CONI- CET, M.A.M. is a Fellow of this Institution. A.J.V. is also an International Scholar of HHMI. P.M. and A.L. are Researchers of the National University of Rosario. The authors do not have conflicts of interest to declare. Supporting Information Additional Supporting Information may be found in the online version of this article: Fig. S1. Restriction analysis of pmx70. The plasmid was purified from E. coli DH5a transformed with plasmid DNA extracted from P. aeruginosa strain 70, digested with the enzymes indicated below and the fragments were separated by electrophorosis in 0.7% agarose. Lane 1: HindIII; lane 2: EcoRI; lane 3: non-digested pmx70. The final positions of the corresponding size markers (EcoRI/HindIII-digested k DNA) are indicated at the left margin. All procedures are described in ref [13]. Fig. S2. Location of bla VIM-2 in P. aeruginosa strain 918. A. Agarose gel electrophorosis/ethidium bromide staining. B. Southern hybridization analysis using a 32 P-labeled bla VIM-2 probe. Lane 1: ExoIII nuclease-digested chromosomal DNA; lane 2 to 5: HindIII-EcoRI-BamHI and Pstl digested chromosomal DNA. respectively; lane 6: plasmids extracted from P.aeruginosa strain 918; lane 7: ExoIII nuclease-digested plasmidic DNA; lane 8 to 11: HindIII,EcoRI-,BamHI- and Pstl-digested plasmidic DNA, respectively. The size (in bp) of fragments derived from EcoRI/HindIII-digested k DNA. Indicated in the left margin. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article. References 1. Cornaglia G, Akova M, Amicosante G et al. Metallo-b-lactamases as emerging resistance determinants in Gram-negative pathogens: open issues. Int J Antimicrob Agents 2007; 29: Walsh TR, Toleman MA, Poirel L, Nordmann P. Metallo-b-lactamases: the quiet before the storm? Clin Microbiol Rev 2005; 18: Poirel L, Lambert T, Salih T, Ronco E, Gaillard J-L, Nordmann P. Characterization of class 1 integrons from Pseudomonas aeruginosa that contain the blavim-2 carbapenem-hydrolyzing b-lactamase gene and of two novel aminoglycoside resistance gene cassettes. Antimicrob Agents Chemother 2001; 45: Garza-Ramos U, Tinoco P, Silva-Sanchez J et al. Metallo-beta-lactamase IMP-18 is located in a class 1 integron (In96) in a clinical isolate of Pseudomonas aeruginosa from Mexico. Int J Antimicrob Agents 2008; 31: Garza-Ramos U, Morfin-Otero R, Sader HS et al. Metallo-b-lactamase gene, blaimp-15, in a class 1 integron (In95) from Pseudomonas aeruginosa clinical isolates from a hospital in mexico. Antimicrob Agents Chemother 2008; 52: Craig AM, Morita K, Ribes JA, Deshpande LM, Sader HS, Castanheira M. IMP-15-producing Pseudomonas aeruginosa isolated in a United States medical center: a recent arrival from Mexico. Antimicrob Agents Chemother 2008; 52: Clinical Laboratory Standards Institute. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard M07-A7. Wayne, PA: Clinical and Laboratory Standards Institute, Marchiaro P, Mussi MA, Ballerini V et al. Sensitive EDTA-based microbiological assays for the detection of metallo-b-lactamases in non-fermentative Gram-negative bacteria. J Clin Microbiol 2005; 43: Altschul SF, Madden TL, Schaffer AA et al. Gapped BLAST and PSI- BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997; 25:

6 CMI Quinones-Falconi et al. MBL-producing P. aeruginosa in Mexico Barth AL, Pitt Tyrone L. Auxotrophic variants of Pseudomonas aeruginosa are selected from prototrophic wild-type strains in respiratory infections in patients with cystic fibrosis. J Clin Microbiol 1995; 33: Tenover FC, Arbeit RD, Goering RV et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995; 33: Sambrook J, Fritsch EF, Maniatis T. Molecular cloning. A laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, Mendes RE, Castanheira M, Garcia P et al. First isolation of bla (VIM- 2) in Latin America: report from the SENTRY Antimicrobial Surveillance Program. Antimicrob Agents Chemother 2004; 48: Lolans K, Queenan AM, Bush K, Sahud A, Quinn JP. First nosocomial outbreak of Pseudomonas aeruginosa producing an integron-borne metallo-beta-lactamase (VIM-2) in the United States. Antimicrob Agents Chemother 2005; 49: Toleman MA, Vinodh H, Sekar U, Kamat V, Walsh TR. blavim-2-harboring integrons isolated in India, Russia, and the United States arise from an ancestral class 1 integron predating the formation of the 3 conserved sequence. Antimicrob Agents Chemother 2007; 51: Miller J. Experiments in molecular genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1972: Helfand MS, Bonomo RA. Current challenges in antimicrobial chemotherapy: the impact of extended-spectrum b-lactamases and metallob-lactamases on the treatment of resistant Gram-negative pathogens. Curr Opin Pharmacol 2005; 5: Crowder MW, Spencer J, Vila AJ. Metallo-b-lactamases: novel weaponry for antibiotic resistance in bacteria. Acc Chem Res 2006; 39: Lévesque C, Piché L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother 1995; 39: