BA, BSc, and MSc Degree Examinations
|
|
- Ophelia Bishop
- 5 years ago
- Views:
Transcription
1 Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations Department : BIOLOGY Title of Exam: Protein-protein recognition Time Allowed: 2 hours Marking Scheme: Total marks available for this paper: 100 Sec on A: Short Answer / Problem / Experimental Design ques ons (50 marks) Sec on B: Essay ques on (marked out of 100, weighted 50 marks) The marks available for each ques on are indicated on the paper Instructions: Sec on A: Answer all ques ons in the spaces provided on the examina on paper Sec on B: Answer either ques on A or ques on B. Write your answer on the separate paper provided and a ach it to the back of the ques on paper using the treasury tag provided. Materials supplied: CALCULATOR For marker use only: For office use only: Module total as % DO NOT WRITE ON THIS BOOKLET BEFORE THE EXAM BEGINS DO NOT TURN OVER THIS PAGE UNTIL INSTRUCTED TO DO SO BY AN INVIGILATOR page 1 of 9
2 SECTION A: Short Answer / Problem / Experimental Design questions Answer all questions in the spaces provided Mark total for this section: a) Explain the terms core and rim when referring to residues in protein interfaces and comment on why these definitions are helpful in characterising protein-protein interaction sites. (3 marks) b) Explain the term hydrophobic effect and explain its contribution to protein-protein interactions. 2. a) Two monomeric proteins A and B form a complex with 1 : 1 stoichiometry and a K d of 3.0 x 10 7 M. After mixing 16 μm A with B, it is found that the equilibrium concentration of the free A is 6 μm. Showing your reasoning, calculate the overall concentration of B in the mixture. (5 marks) page 2 of 9
3 b) The Figure below shows structures of SpoIIQ-SpoIIIAH and gp120-cd4-f ab complexes. Comment on the structural characteristics of the protein-protein interfaces and their functional significance. page 3 of 9
4 3. Research on protein A associated with a rare genetic disorder established the following protein-protein linkages: Pair of proteins Linkages A, B gene fusion immunoprecipitation B,C C,D gene co-occurrence negatome database isothermal titration calorimetry surface plasmon resonance cryo-em structure E,A F,A gene neighbourhood gene fusion analytical ultracentrifugation surface plasmon resonance yeast two-hybrid G,A analytical ultracentrifugation gene neighbourhood yeast two-hybrid a) Showing only possible interacting partners, draw a schematic diagram for the network formed by protein A, indicating interactions as shown below: Physical, established in one-to-one experiments Physical, established by proteome-wide analysis Functional interactions (solid line) (dash dot line) (dot line) (6 marks) page 4 of 9
5 b) Rank interacting partners of protein A, starting from the least likely interacting partner and finishing with the most likely. (3 marks) c) Name two linkages of protein A that were established by proteome-wide methods. (2 marks) d) Name two linkages of protein A that were established in vitro. (2 marks) e) Further studies revealed that protein A is a major protein interaction hub, with its N-terminal and C-terminal domains involved in one-to-many and many-to-one types of interaction, respectively. Briefly outline the structural basis for each type of interaction giving an example from lecture material. page 5 of 9
6 4. The table below presents protein binding affinities measured in a series of isothermal titration calorimetry experiments in which different fragments of microtubule plus-end tracking proteins were mixed. a, no binding detected b, the data did not allow a rigorous measurement of affinity but did suggest an affinity in the millimolar range Data taken from Weisbrich et al., (2007) Nat Struct Mol Biol, 14, page 6 of 9
7 The protein constructs used in these experiments and how they relate to full-length EB1, p150glued and CLIP170 are shown schematically below: a) Compare and contrast the information obtained from surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) experiments. b) How does mutation of the acidic tail of EB1 impact binding to p150glued. Use the data in the table and your knowledge of CAP-Gly domains to justify your answer. c) Suggest why ClipZn1 does not interact with p150n while ClipZn2 does (1 mark) page 7 of 9
8 d) What do the effects of mutation of residues 68, 69, 90 and 93 of p150n tell you about the interaction with ClipZn2. (3 marks) e) CLIP170 has been shown to form a closed, inhibited state in which ClipCG1 and ClipCG2 domains interact with the Zn12 region. Predict what might happen if p150glued is added to the closed form of CLIP170. Use the data in the table to justify your answer. (2 marks) f) The EB1c construct forms a homodimer in solution. Explain the binding affinities measured in ITC experiments involving EB1c and ClipCG1, ClipCG2 and ClipCG12. (3 marks) The space above this line should be sufficient for your answer page 8 of 9
9 SECTION B: Essay question Answer one question on the separate paper provided Remember to write your candidate number at the top of the page and indicate whether you have answered question A or B Mark total for this section: 50 EITHER A) Using appropriate examples, explain how solution NMR spectroscopy has illuminated the role of intrinsically disordered binding motifs in protein-protein recognition. OR B) Discuss how early and late compartment-specific gene expression is established in the forespore during sporulation in Bacillus. Refer to the roles of relevant protein-protein complexes, commenting on the techniques used to identify and characterize these complexes, and the supporting evidence for their existence. page 9 of 9
University of York. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular machines. Time Allowed: 2 hours
Examination Candidate Number: Desk Number: University of York BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular machines Time Allowed: 2 hours Marking Scheme: Total
More informationUNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Bacterial pathogenesis Time Allowed: 2 hours Marking Scheme:
More informationModule Code: BIO00025H
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Protein protein recognition Time Allowed: 2 hours Marking Scheme: Total marks available
More informationUNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Human genetics Time Allowed: 2 hours Marking Scheme: Total
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department: BIOLOGY. Title of Exam: Biofuels and biotechnology. Time Allowed: 2 hours
Examination Candidate Number: UNIVERSITY OF YORK Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department: BIOLOGY Title of Exam: Biofuels and biotechnology Time Allowed: 2 hours Marking Scheme:
More informationUNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Plant Biotechnology. Time Allowed: 2 hours
Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Plant Biotechnology Time Allowed: 2 hours Marking Scheme: Total
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Bacterial pathogenesis Time Allowed: 2 hours Marking Scheme: Total marks available
More informationStructure of a novel phosphotyrosine-binding domain in Hakai that targets E-cadherin
Manuscript EMBO-2011-79235 Structure of a novel phosphotyrosine-binding domain in Hakai that targets E-cadherin Manjeet Mukherjee, Soah Yee Chow, Permeen Yusoff, Jayaraman Seetharaman, Cherlyn Ng, Saravanan
More informationBiophysical characterization of proteinprotein
Biophysical characterization of proteinprotein interactions Rob Meijers EMBL Hamburg EMBO Global Exchange Lecture Course Hyderabad 2012 Bottom up look at protein-protein interactions Role of hydrogen bonds
More information(RG9) Molecular Interactions Research Group (MIRG)
(RG9) Molecular Interactions Research Group (MIRG) Aaron P. Yamniuk, John Newitt, Fumio Arisaka, Anthony Giannetti, Preston Hensley, David Myszka, Fred Schwarz, Ed Eisenstein, Michael Doyle ABRF 2013 Palm
More informationLARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology
LARGE-SCALE PROTEIN INTERACTOMICS Karl Frontzek Institute of Neuropathology STUDYING THE INTERACTOME A yeast 2 hybrid (DB: DNA binding domain, AD: activation domain) B tandem affinity purification (dashed
More informationNature Structural & Molecular Biology: doi: /nsmb.3018
Supplementary Figure 1 Validation of genetic complementation assay in Bmal1 / Per2 Luc fibroblasts. (a) Only Bmal1, not Bmal2, rescues circadian rhythms from cells. Cells expressing various Bmal constructs
More informationSupplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain
Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and
More informationName with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization FINAL EXAM (April 27, 2017)
BIOE111: Functional Biomaterial Development and Characterization FINAL EXAM (April 27, 2017) Question 0: Fill in your name and student ID on each page. (1) Question 1: Briefly define the following terms
More informationApplication of label-free technologies in a core facility research. Ewa Folta-Stogniew Yale University
Application of label-free technologies in a core facility research Ewa Folta-Stogniew Yale University Biophysics Resource of Keck Laboratory: Yale School of Medicine Mission: quantitative characterization
More informationProtein-Protein Interactions II
Biochemistry 412 Protein-Protein Interactions II March 28, 2008 Delano (2002) Curr. Opin. Struct. Biol. 12, 14. Some ways that mutations can destabilize protein-protein interactions Delano (2002) Curr.
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available
More informationFig. 1. A schematic illustration of pipeline from gene to drug : integration of virtual and real experiments.
1 Integration of Structure-Based Drug Design and SPR Biosensor Technology in Discovery of New Lead Compounds Alexis S. Ivanov Institute of Biomedical Chemistry RAMS, 10, Pogodinskaya str., Moscow, 119121,
More informationThe World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.
The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration
More informationCharacterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057
Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Reviewing sites: affinity and specificity representation binding
More informationNot The Real Exam Just for Fun! Chemistry 391 Fall 2018
Not The Real Exam Just for Fun! Chemistry 391 Fall 2018 Do not open the exam until ready to begin! Rules of the Game: This is a take-home Exam. The exam is due on Thursday, October 11 th at 9 AM. Otherwise,
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 MOLECULAR BIOLOGY BIO-2B02 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question
More informationBA, BSc, and MSc Degree Examinations
Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Human genetics Time Allowed: 2 hours Marking Scheme: Total marks available for
More informationExperimental Techniques 2
Experimental Techniques 2 High-throughput interaction detection Yeast two-hybrid - pairwise organisms as machines to learn about organisms yeast, worm, fly, human,... low intersection between repeated
More informationMolecular basis for H3K36me3 recognition by the Tudor domain of PHF1
Supplementary information Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1 Catherine A. Musselman 1, Nikita Avvakumov 2, Reiko Watanabe 3, Christopher G. Abraham 4, Marie-Eve Lalonde
More information1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA.
LS1a Fall 06 Problem Set #10 Due Friday 12/15 at noon in your TF s drop box on the 2 nd floor of the Science Center all questions including the (*extra*) one should be turned in 1. In lecture we learned
More information11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11
Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the
More informationPhi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail. Marc C Morais et al., Nature Structural Biology 2003
Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail Marc C Morais et al., Nature Structural Biology 2003 Free scaffold 13+ 10 min 3 min 1 min 40 sec 100 % 0 100 % 0 100 % 0 100 % 0 Partially
More informationComplications Dawn for Kinetochore Regulation by Aurora
Complications Dawn for Kinetochore Regulation by Aurora The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Nannas, Natalie
More informationChapter 14 Regulation of Transcription
Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription
More informationReally high sensitivity mass spectrometry and Discovery and analysis of protein complexes
Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes The PRIME lab and AMS Importance of protein complexes in biology Methods for isolation of protein complexes In
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section
More informationFreire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation
Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation Table S1 Oligonucleotides used in this study Table
More informationBiophysics Core Ewa Folta-Stogniew, Ph.D., M.S.
Biophysics Core Ewa Folta-Stogniew, Ph.D., M.S. Mission: quantitative characterization of interactions between biomolecules using in solution biophysical methods biophysical methods Expands the proteomic
More informationSupplementary Table 1: List of CH3 domain interface residues in the first chain (A) and
Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting
More informationComputational Toxicology. Peter Andras University of Newcastle
Computational Toxicology Peter Andras University of Newcastle peter.andras@ncl.ac.uk Overview Background Aim Cells and proteins Network analysis Computational toxicity prediction Experimental validation
More informationModule Code: BIO00007C
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction
More informationSupplementary information. for the paper:
Supplementary information for the paper: Screening for protein-protein interactions using Förster resonance energy transfer (FRET) and fluorescence lifetime imaging microscopy (FLIM) Anca Margineanu 1*,
More informationProtein expression and purification from Hi5 insect cells is as described (1, 2).
Materials & methods Protein expression and purification Protein expression and purification from Hi5 insect cells is as described (1, 2). The purified complex exhibited a 2:2:2 stoichiometry as determined
More informationChallenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor
Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+
More informationSolution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae
Vol. 14, No. 1-4 175 Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae James D. Baleja, V. Thanabal, Ted Mau, and Gerhard Wagner Department of Biological Chemistry and
More informationECS 234: Genomic Data Integration ECS 234
: Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG
More informationMethods in Biochemistry (KB8002)
Methods in Biochemistry (KB8002) AIM Methods in Biochemistry will introduce students to the fundamental principles behind several basic and more advanced techniques commonly used in biochemical research.
More informationBIOINFORMATICS Introduction
BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea
More informationChapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes
Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein
More informationComputational Methods for Protein Structure Prediction and Fold Recognition... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M.
Contents Computational Methods for Protein Structure Prediction and Fold Recognition........................... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M. Bujnicki 1 Primary Structure Analysis...................
More informationARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide
ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession
More informationProtein-Protein Interactions I
Biochemistry 412 Protein-Protein Interactions I March 23, 2007 Macromolecular Recognition by Proteins Protein folding is a process governed by intramolecular recognition. Protein-protein association is
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we
More informationOpening the gate to DNA replication
Opening the gate to DNA replication Alberto Riera and Christian Speck DNA Replication Group, Institute of Clinical Science, Imperial College, London W1 0NN, UK. * Correspondence: chris.speck@imperial.ac.uk
More informationThe Two-Hybrid System
Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe
More informationTechnical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger SHK Stelle frei Ab 1.9.2015, 2 Jahre, 41h/Monat Verbundprojekt MaptTorNet: Pankreatische endokrine Tumore Insb. statistische Aufbereitung und
More informationEvaluation of Disorder Predictions in CASP5
PROTEINS: Structure, Function, and Genetics 53:561 565 (2003) Evaluation of Disorder Predictions in CASP5 Eugene Melamud 1,2 and John Moult 1 * 1 Center for Advanced Research in Biotechnology, University
More informationUniversity of York Department of Biology B. Sc Stage 2 Degree Examinations
Examination Candidate Number: Desk Number: University of York Department of Biology B. Sc Stage 2 Degree Examinations 2016-17 Evolutionary and Population Genetics Time allowed: 1 hour and 30 minutes Total
More informationProtein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger
Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf
More informationRegulatory Consideration for the Characterization of HOS in Biotechnology Products
Regulatory Consideration for the Characterization of HOS in Biotechnology Products Maria Teresa Gutierrez Lugo, Ph.D. OBP/CDER/FDA 5 th International Symposium on Higher Order Structure of Protein Therapeutics
More informationFind this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.
Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check
More information27041, Week 02. Review of Week 01
27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model
More informationThe use of surface plasmon resonance to guide the choice of nucleic acid oligomers for co-crystallisation with proteins
The use of surface plasmon resonance to guide the choice of nucleic acid oligomers for co-crystallisation with proteins Clare Stevenson John Innes Centre, Norwich, U.K. clare.stevenson@jic.ac.uk RAMC,
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Location of the mab 6F10 epitope in capsids.
Supplementary Figure 1 Location of the mab 6F10 epitope in capsids. The epitope of monoclonal antibody, mab 6F10, was mapped to residues A862 H880 of the HSV-1 major capsid protein VP5 by immunoblotting
More information3'A C G A C C A G T A A A 5'
AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Domain architecture and conformational states of the decapping complex, as revealed by structural studies. (a) Domain organization of Schizosaccharomyces pombe (Sp) and Saccharomyces
More informationGene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis
Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods
More information5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any
More informationAnswers to additional linkage problems.
Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies
More informationPractice Problems 5. Location of LSA-GFP fluorescence
Life Sciences 1a Practice Problems 5 1. Soluble proteins that are normally secreted from the cell into the extracellular environment must go through a series of steps referred to as the secretory pathway.
More informationChapter 15 Gene Technologies and Human Applications
Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect
More informationMICB688L/MOCB639 Advanced Cell Biology Exam II
MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please
More informationMARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305
MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What
More informationMethods in Biochemistry (KB8002)
Methods in Biochemistry (KB8002) AIM Methods in Biochemistry will introduce students to the fundamental principles behind several basic and more advanced techniques commonly used in biochemical research.
More informationExploring Similarities of Conserved Domains/Motifs
Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationMolecular design principles underlying β-strand swapping. in the adhesive dimerization of cadherins
Supplementary information for: Molecular design principles underlying β-strand swapping in the adhesive dimerization of cadherins Jeremie Vendome 1,2,3,5, Shoshana Posy 1,2,3,5,6, Xiangshu Jin, 1,3 Fabiana
More informationTime allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.
UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 FUNDAMENTALS OF MOLECULAR BIOLOGY AND GENETICS BIO-4003A Time allowed: 2 hours Answer ALL questions in Section
More informationAbcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou
Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying
More informationMap-Based Cloning of Qualitative Plant Genes
Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward
More information20.320, notes for 9/13
20.320 Notes Page 1 20.320, notes for 9/13 Thursday, September 13, 2012 9:36 AM Coming Assignments 1st part of design project coming up, assigned 9/14 (tomorrow) and due 9/21. Last time We covered ITC
More informationHIR Central Lab High End Instrument
HIR Central Lab High End Instrument DR KOK GAN CHAN PhD, MSc, LLM(Merit), BSc, LLB, CBiol, MIBiol. High Impact Research Coordinator PhD, MSc, LLM(Merit), BSc, LLB, CBiol, MIBiol High Impact Research Building,
More informationName with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization MIDTERM EXAM (October 7, 2010) 93 TOTAL POINTS
BIOE111: Functional Biomaterial Development and Characterization MIDTERM EXAM (October 7, 2010) 93 TOTAL POINTS Question 0: Fill in your name and student ID on each page. (1) Question 1: What is the role
More informationImproved drug delivery systems: Targeting specific organelles and suborganellar compartments
Improved drug delivery systems: Targeting specific organelles and suborganellar compartments Kostas Tokatlidis Institute of Molecular Biology and Biotechnology (IMBB-FORTH) and University of Crete 1900s
More informationPersonal Exam Code: 1. 16p
Exam, Methods in Molecular Biology, BIOR47, 2012-04-26 Please hand in answers to each question on its paper. Use additional papers if needed. Mark all papers with your code. Your answers should be logical
More informationProtein-Protein Interactions I
Biochemistry 412 Protein-Protein Interactions I March 11, 2008 Macromolecular Recognition by Proteins Protein folding is a process governed by intramolecular recognition. Protein-protein association is
More informationSequence Determinants of a Conformational Switch in a Protein
Sequence Determinants of a Conformational Switch in a Protein Thomas A. Anderson, Matthew H. J. Cordes, and Robert T. Sauer Kyle Skalenko 4/17/09 Introduction Protein folding is guided by the following
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Crystallographic statistics CRM1-SNUPN complex Space group P6 4 22 a=b=250.4, c=190.4 Data collection statistics: CRM1-selenomethionine SNUPN MAD data Peak Inflection Remote Native
More informationFinal exam. Please write your name on the exam and keep an ID card ready.
Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an
More informationChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015
ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA
More informationGene Expression: From Genes to Proteins
The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes
More informationEngineering splicing factors with designed specificities
nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary
More informationStudent name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total
Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase
More informationBurrH: a new modular DNA binding protein for genome engineering
Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,
More informationChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014
ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind
More informationBiology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006
Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Faculty Information: Dr. Nitya Jacob, Office: Room 104, Pierce Hall; Phone: 770-784-8346 Office Hours: T 9:30-10:30
More informationThe Green Fluorescent Protein. w.chem.uwec.edu/chem412_s99/ppt/green.ppt
The Green Fluorescent Protein w.chem.uwec.edu/chem412_s99/ppt/green.ppt www.chem.uwec.edu/chem412_s99/ppt/green.ppt Protein (gene) is from a jellyfish: Aequorea victoria www.chem.uwec.edu/chem412_s99/ppt/green.ppt
More informationSupplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical
Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional
More informationDNA. Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts
DNA Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts base: adenine, cytosine, guanine, thymine sugar: deoxyribose phosphate: will form the phosphate backbone wide narrow DNA binding
More informationDeoxyribonucleic Acid DNA
Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/
More information