BA, BSc, and MSc Degree Examinations

Size: px
Start display at page:

Download "BA, BSc, and MSc Degree Examinations"

Transcription

1 Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations Department : BIOLOGY Title of Exam: Protein-protein recognition Time Allowed: 2 hours Marking Scheme: Total marks available for this paper: 100 Sec on A: Short Answer / Problem / Experimental Design ques ons (50 marks) Sec on B: Essay ques on (marked out of 100, weighted 50 marks) The marks available for each ques on are indicated on the paper Instructions: Sec on A: Answer all ques ons in the spaces provided on the examina on paper Sec on B: Answer either ques on A or ques on B. Write your answer on the separate paper provided and a ach it to the back of the ques on paper using the treasury tag provided. Materials supplied: CALCULATOR For marker use only: For office use only: Module total as % DO NOT WRITE ON THIS BOOKLET BEFORE THE EXAM BEGINS DO NOT TURN OVER THIS PAGE UNTIL INSTRUCTED TO DO SO BY AN INVIGILATOR page 1 of 9

2 SECTION A: Short Answer / Problem / Experimental Design questions Answer all questions in the spaces provided Mark total for this section: a) Explain the terms core and rim when referring to residues in protein interfaces and comment on why these definitions are helpful in characterising protein-protein interaction sites. (3 marks) b) Explain the term hydrophobic effect and explain its contribution to protein-protein interactions. 2. a) Two monomeric proteins A and B form a complex with 1 : 1 stoichiometry and a K d of 3.0 x 10 7 M. After mixing 16 μm A with B, it is found that the equilibrium concentration of the free A is 6 μm. Showing your reasoning, calculate the overall concentration of B in the mixture. (5 marks) page 2 of 9

3 b) The Figure below shows structures of SpoIIQ-SpoIIIAH and gp120-cd4-f ab complexes. Comment on the structural characteristics of the protein-protein interfaces and their functional significance. page 3 of 9

4 3. Research on protein A associated with a rare genetic disorder established the following protein-protein linkages: Pair of proteins Linkages A, B gene fusion immunoprecipitation B,C C,D gene co-occurrence negatome database isothermal titration calorimetry surface plasmon resonance cryo-em structure E,A F,A gene neighbourhood gene fusion analytical ultracentrifugation surface plasmon resonance yeast two-hybrid G,A analytical ultracentrifugation gene neighbourhood yeast two-hybrid a) Showing only possible interacting partners, draw a schematic diagram for the network formed by protein A, indicating interactions as shown below: Physical, established in one-to-one experiments Physical, established by proteome-wide analysis Functional interactions (solid line) (dash dot line) (dot line) (6 marks) page 4 of 9

5 b) Rank interacting partners of protein A, starting from the least likely interacting partner and finishing with the most likely. (3 marks) c) Name two linkages of protein A that were established by proteome-wide methods. (2 marks) d) Name two linkages of protein A that were established in vitro. (2 marks) e) Further studies revealed that protein A is a major protein interaction hub, with its N-terminal and C-terminal domains involved in one-to-many and many-to-one types of interaction, respectively. Briefly outline the structural basis for each type of interaction giving an example from lecture material. page 5 of 9

6 4. The table below presents protein binding affinities measured in a series of isothermal titration calorimetry experiments in which different fragments of microtubule plus-end tracking proteins were mixed. a, no binding detected b, the data did not allow a rigorous measurement of affinity but did suggest an affinity in the millimolar range Data taken from Weisbrich et al., (2007) Nat Struct Mol Biol, 14, page 6 of 9

7 The protein constructs used in these experiments and how they relate to full-length EB1, p150glued and CLIP170 are shown schematically below: a) Compare and contrast the information obtained from surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) experiments. b) How does mutation of the acidic tail of EB1 impact binding to p150glued. Use the data in the table and your knowledge of CAP-Gly domains to justify your answer. c) Suggest why ClipZn1 does not interact with p150n while ClipZn2 does (1 mark) page 7 of 9

8 d) What do the effects of mutation of residues 68, 69, 90 and 93 of p150n tell you about the interaction with ClipZn2. (3 marks) e) CLIP170 has been shown to form a closed, inhibited state in which ClipCG1 and ClipCG2 domains interact with the Zn12 region. Predict what might happen if p150glued is added to the closed form of CLIP170. Use the data in the table to justify your answer. (2 marks) f) The EB1c construct forms a homodimer in solution. Explain the binding affinities measured in ITC experiments involving EB1c and ClipCG1, ClipCG2 and ClipCG12. (3 marks) The space above this line should be sufficient for your answer page 8 of 9

9 SECTION B: Essay question Answer one question on the separate paper provided Remember to write your candidate number at the top of the page and indicate whether you have answered question A or B Mark total for this section: 50 EITHER A) Using appropriate examples, explain how solution NMR spectroscopy has illuminated the role of intrinsically disordered binding motifs in protein-protein recognition. OR B) Discuss how early and late compartment-specific gene expression is established in the forespore during sporulation in Bacillus. Refer to the roles of relevant protein-protein complexes, commenting on the techniques used to identify and characterize these complexes, and the supporting evidence for their existence. page 9 of 9

University of York. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular machines. Time Allowed: 2 hours

University of York. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Molecular machines. Time Allowed: 2 hours Examination Candidate Number: Desk Number: University of York BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Molecular machines Time Allowed: 2 hours Marking Scheme: Total

More information

UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations

UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Bacterial pathogenesis Time Allowed: 2 hours Marking Scheme:

More information

Module Code: BIO00025H

Module Code: BIO00025H Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Protein protein recognition Time Allowed: 2 hours Marking Scheme: Total marks available

More information

UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations

UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Human genetics Time Allowed: 2 hours Marking Scheme: Total

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department: BIOLOGY. Title of Exam: Biofuels and biotechnology. Time Allowed: 2 hours

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department: BIOLOGY. Title of Exam: Biofuels and biotechnology. Time Allowed: 2 hours Examination Candidate Number: UNIVERSITY OF YORK Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department: BIOLOGY Title of Exam: Biofuels and biotechnology Time Allowed: 2 hours Marking Scheme:

More information

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Plant Biotechnology. Time Allowed: 2 hours

UNIVERSITY OF YORK. BA, BSc, and MSc Degree Examinations Department : BIOLOGY. Title of Exam: Plant Biotechnology. Time Allowed: 2 hours Examination Candidate Number: Desk Number: UNIVERSITY OF YORK BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Plant Biotechnology Time Allowed: 2 hours Marking Scheme: Total

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Bacterial pathogenesis Time Allowed: 2 hours Marking Scheme: Total marks available

More information

Structure of a novel phosphotyrosine-binding domain in Hakai that targets E-cadherin

Structure of a novel phosphotyrosine-binding domain in Hakai that targets E-cadherin Manuscript EMBO-2011-79235 Structure of a novel phosphotyrosine-binding domain in Hakai that targets E-cadherin Manjeet Mukherjee, Soah Yee Chow, Permeen Yusoff, Jayaraman Seetharaman, Cherlyn Ng, Saravanan

More information

Biophysical characterization of proteinprotein

Biophysical characterization of proteinprotein Biophysical characterization of proteinprotein interactions Rob Meijers EMBL Hamburg EMBO Global Exchange Lecture Course Hyderabad 2012 Bottom up look at protein-protein interactions Role of hydrogen bonds

More information

(RG9) Molecular Interactions Research Group (MIRG)

(RG9) Molecular Interactions Research Group (MIRG) (RG9) Molecular Interactions Research Group (MIRG) Aaron P. Yamniuk, John Newitt, Fumio Arisaka, Anthony Giannetti, Preston Hensley, David Myszka, Fred Schwarz, Ed Eisenstein, Michael Doyle ABRF 2013 Palm

More information

LARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology

LARGE-SCALE PROTEIN INTERACTOMICS. Karl Frontzek Institute of Neuropathology LARGE-SCALE PROTEIN INTERACTOMICS Karl Frontzek Institute of Neuropathology STUDYING THE INTERACTOME A yeast 2 hybrid (DB: DNA binding domain, AD: activation domain) B tandem affinity purification (dashed

More information

Nature Structural & Molecular Biology: doi: /nsmb.3018

Nature Structural & Molecular Biology: doi: /nsmb.3018 Supplementary Figure 1 Validation of genetic complementation assay in Bmal1 / Per2 Luc fibroblasts. (a) Only Bmal1, not Bmal2, rescues circadian rhythms from cells. Cells expressing various Bmal constructs

More information

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and

More information

Name with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization FINAL EXAM (April 27, 2017)

Name with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization FINAL EXAM (April 27, 2017) BIOE111: Functional Biomaterial Development and Characterization FINAL EXAM (April 27, 2017) Question 0: Fill in your name and student ID on each page. (1) Question 1: Briefly define the following terms

More information

Application of label-free technologies in a core facility research. Ewa Folta-Stogniew Yale University

Application of label-free technologies in a core facility research. Ewa Folta-Stogniew Yale University Application of label-free technologies in a core facility research Ewa Folta-Stogniew Yale University Biophysics Resource of Keck Laboratory: Yale School of Medicine Mission: quantitative characterization

More information

Protein-Protein Interactions II

Protein-Protein Interactions II Biochemistry 412 Protein-Protein Interactions II March 28, 2008 Delano (2002) Curr. Opin. Struct. Biol. 12, 14. Some ways that mutations can destabilize protein-protein interactions Delano (2002) Curr.

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 hour and 30 minutes Marking Scheme: Total marks available

More information

Fig. 1. A schematic illustration of pipeline from gene to drug : integration of virtual and real experiments.

Fig. 1. A schematic illustration of pipeline from gene to drug : integration of virtual and real experiments. 1 Integration of Structure-Based Drug Design and SPR Biosensor Technology in Discovery of New Lead Compounds Alexis S. Ivanov Institute of Biomedical Chemistry RAMS, 10, Pogodinskaya str., Moscow, 119121,

More information

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc.

The World Leader in SPR Technology. Jimmy Page, PhD, Biacore, Inc. The World Leader in SPR Technology Jimmy Page, PhD, Biacore, Inc. Objectives of Biacore Experiments Yes/No Data» Is there binding?» Ligand Fishing Concentration Analysis: How MUCH? Active Concentration

More information

Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057

Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson Pinn 6-057 Characterizing DNA binding sites high throughput approaches Biol4230 Tues, April 24, 2018 Bill Pearson wrp@virginia.edu 4-2818 Pinn 6-057 Reviewing sites: affinity and specificity representation binding

More information

Not The Real Exam Just for Fun! Chemistry 391 Fall 2018

Not The Real Exam Just for Fun! Chemistry 391 Fall 2018 Not The Real Exam Just for Fun! Chemistry 391 Fall 2018 Do not open the exam until ready to begin! Rules of the Game: This is a take-home Exam. The exam is due on Thursday, October 11 th at 9 AM. Otherwise,

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2013-2014 MOLECULAR BIOLOGY BIO-2B02 Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question

More information

BA, BSc, and MSc Degree Examinations

BA, BSc, and MSc Degree Examinations Examination Candidate Number: Desk Number: BA, BSc, and MSc Degree Examinations 2017-8 Department : BIOLOGY Title of Exam: Human genetics Time Allowed: 2 hours Marking Scheme: Total marks available for

More information

Experimental Techniques 2

Experimental Techniques 2 Experimental Techniques 2 High-throughput interaction detection Yeast two-hybrid - pairwise organisms as machines to learn about organisms yeast, worm, fly, human,... low intersection between repeated

More information

Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1

Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1 Supplementary information Molecular basis for H3K36me3 recognition by the Tudor domain of PHF1 Catherine A. Musselman 1, Nikita Avvakumov 2, Reiko Watanabe 3, Christopher G. Abraham 4, Marie-Eve Lalonde

More information

1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA.

1. In lecture we learned about the Lac Repressor. Below is the binding curve for the wild-type Lac repressor binding to lac operator DNA. LS1a Fall 06 Problem Set #10 Due Friday 12/15 at noon in your TF s drop box on the 2 nd floor of the Science Center all questions including the (*extra*) one should be turned in 1. In lecture we learned

More information

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11

11/22/13. Proteomics, functional genomics, and systems biology. Biosciences 741: Genomics Fall, 2013 Week 11 Proteomics, functional genomics, and systems biology Biosciences 741: Genomics Fall, 2013 Week 11 1 Figure 6.1 The future of genomics Functional Genomics The field of functional genomics represents the

More information

Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail. Marc C Morais et al., Nature Structural Biology 2003

Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail. Marc C Morais et al., Nature Structural Biology 2003 Phi29 Scaffold Has a Helix-Loop-Helix Motif and a Disordered Tail Marc C Morais et al., Nature Structural Biology 2003 Free scaffold 13+ 10 min 3 min 1 min 40 sec 100 % 0 100 % 0 100 % 0 100 % 0 Partially

More information

Complications Dawn for Kinetochore Regulation by Aurora

Complications Dawn for Kinetochore Regulation by Aurora Complications Dawn for Kinetochore Regulation by Aurora The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Nannas, Natalie

More information

Chapter 14 Regulation of Transcription

Chapter 14 Regulation of Transcription Chapter 14 Regulation of Transcription Cis-acting sequences Distance-independent cis-acting elements Dissecting regulatory elements Transcription factors Overview transcriptional regulation Transcription

More information

Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes

Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes Really high sensitivity mass spectrometry and Discovery and analysis of protein complexes The PRIME lab and AMS Importance of protein complexes in biology Methods for isolation of protein complexes In

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2017-18 CELL BIOLOGY BIO-5005B Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section

More information

Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation

Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation Freire et al. - Supplemental Material for Trypanosoma brucei translation-initiation factor homolog EIF4E6 is linked to posttranscriptional regulation Table S1 Oligonucleotides used in this study Table

More information

Biophysics Core Ewa Folta-Stogniew, Ph.D., M.S.

Biophysics Core Ewa Folta-Stogniew, Ph.D., M.S. Biophysics Core Ewa Folta-Stogniew, Ph.D., M.S. Mission: quantitative characterization of interactions between biomolecules using in solution biophysical methods biophysical methods Expands the proteomic

More information

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and

Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting

More information

Computational Toxicology. Peter Andras University of Newcastle

Computational Toxicology. Peter Andras University of Newcastle Computational Toxicology Peter Andras University of Newcastle peter.andras@ncl.ac.uk Overview Background Aim Cells and proteins Network analysis Computational toxicity prediction Experimental validation

More information

Module Code: BIO00007C

Module Code: BIO00007C Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Biological networks Ulf Leser: Introduction

More information

Supplementary information. for the paper:

Supplementary information. for the paper: Supplementary information for the paper: Screening for protein-protein interactions using Förster resonance energy transfer (FRET) and fluorescence lifetime imaging microscopy (FLIM) Anca Margineanu 1*,

More information

Protein expression and purification from Hi5 insect cells is as described (1, 2).

Protein expression and purification from Hi5 insect cells is as described (1, 2). Materials & methods Protein expression and purification Protein expression and purification from Hi5 insect cells is as described (1, 2). The purified complex exhibited a 2:2:2 stoichiometry as determined

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae

Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae Vol. 14, No. 1-4 175 Solution Structure of the DNA-binding Domain of GAL4 from Saccharomyces cerevisiae James D. Baleja, V. Thanabal, Ted Mau, and Gerhard Wagner Department of Biological Chemistry and

More information

ECS 234: Genomic Data Integration ECS 234

ECS 234: Genomic Data Integration ECS 234 : Genomic Data Integration Heterogeneous Data Integration DNA Sequence Microarray Proteomics >gi 12004594 gb AF217406.1 Saccharomyces cerevisiae uridine nucleosidase (URH1) gene, complete cds ATGGAATCTGCTGATTTTTTTACCTCACGAAACTTATTAAAACAGATAATTTCCCTCATCTGCAAGGTTG

More information

Methods in Biochemistry (KB8002)

Methods in Biochemistry (KB8002) Methods in Biochemistry (KB8002) AIM Methods in Biochemistry will introduce students to the fundamental principles behind several basic and more advanced techniques commonly used in biochemical research.

More information

BIOINFORMATICS Introduction

BIOINFORMATICS Introduction BIOINFORMATICS Introduction Mark Gerstein, Yale University bioinfo.mbb.yale.edu/mbb452a 1 (c) Mark Gerstein, 1999, Yale, bioinfo.mbb.yale.edu What is Bioinformatics? (Molecular) Bio -informatics One idea

More information

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes

Chapter 17 Lecture. Concepts of Genetics. Tenth Edition. Regulation of Gene Expression in Eukaryotes Chapter 17 Lecture Concepts of Genetics Tenth Edition Regulation of Gene Expression in Eukaryotes Chapter Contents 17.1 Eukaryotic Gene Regulation Can Occur at Any of the Steps Leading from DNA to Protein

More information

Computational Methods for Protein Structure Prediction and Fold Recognition... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M.

Computational Methods for Protein Structure Prediction and Fold Recognition... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M. Contents Computational Methods for Protein Structure Prediction and Fold Recognition........................... 1 I. Cymerman, M. Feder, M. PawŁowski, M.A. Kurowski, J.M. Bujnicki 1 Primary Structure Analysis...................

More information

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession

More information

Protein-Protein Interactions I

Protein-Protein Interactions I Biochemistry 412 Protein-Protein Interactions I March 23, 2007 Macromolecular Recognition by Proteins Protein folding is a process governed by intramolecular recognition. Protein-protein association is

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

More information

Opening the gate to DNA replication

Opening the gate to DNA replication Opening the gate to DNA replication Alberto Riera and Christian Speck DNA Replication Group, Institute of Clinical Science, Imperial College, London W1 0NN, UK. * Correspondence: chris.speck@imperial.ac.uk

More information

The Two-Hybrid System

The Two-Hybrid System Encyclopedic Reference of Genomics and Proteomics in Molecular Medicine The Two-Hybrid System Carolina Vollert & Peter Uetz Institut für Genetik Forschungszentrum Karlsruhe PO Box 3640 D-76021 Karlsruhe

More information

Technical tips Session 4

Technical tips Session 4 Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger SHK Stelle frei Ab 1.9.2015, 2 Jahre, 41h/Monat Verbundprojekt MaptTorNet: Pankreatische endokrine Tumore Insb. statistische Aufbereitung und

More information

Evaluation of Disorder Predictions in CASP5

Evaluation of Disorder Predictions in CASP5 PROTEINS: Structure, Function, and Genetics 53:561 565 (2003) Evaluation of Disorder Predictions in CASP5 Eugene Melamud 1,2 and John Moult 1 * 1 Center for Advanced Research in Biotechnology, University

More information

University of York Department of Biology B. Sc Stage 2 Degree Examinations

University of York Department of Biology B. Sc Stage 2 Degree Examinations Examination Candidate Number: Desk Number: University of York Department of Biology B. Sc Stage 2 Degree Examinations 2016-17 Evolutionary and Population Genetics Time allowed: 1 hour and 30 minutes Total

More information

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger

Protein-Protein-Interaction Networks. Ulf Leser, Samira Jaeger Protein-Protein-Interaction Networks Ulf Leser, Samira Jaeger This Lecture Protein-protein interactions Characteristics Experimental detection methods Databases Protein-protein interaction networks Ulf

More information

Regulatory Consideration for the Characterization of HOS in Biotechnology Products

Regulatory Consideration for the Characterization of HOS in Biotechnology Products Regulatory Consideration for the Characterization of HOS in Biotechnology Products Maria Teresa Gutierrez Lugo, Ph.D. OBP/CDER/FDA 5 th International Symposium on Higher Order Structure of Protein Therapeutics

More information

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site.

Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Find this material useful? You can help our team to keep this site up and bring you even more content consider donating via the link on our site. Still having trouble understanding the material? Check

More information

27041, Week 02. Review of Week 01

27041, Week 02. Review of Week 01 27041, Week 02 Review of Week 01 The human genome sequencing project (HGP) 2 CBS, Department of Systems Biology Systems Biology and emergent properties 3 CBS, Department of Systems Biology Different model

More information

The use of surface plasmon resonance to guide the choice of nucleic acid oligomers for co-crystallisation with proteins

The use of surface plasmon resonance to guide the choice of nucleic acid oligomers for co-crystallisation with proteins The use of surface plasmon resonance to guide the choice of nucleic acid oligomers for co-crystallisation with proteins Clare Stevenson John Innes Centre, Norwich, U.K. clare.stevenson@jic.ac.uk RAMC,

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Location of the mab 6F10 epitope in capsids.

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Location of the mab 6F10 epitope in capsids. Supplementary Figure 1 Location of the mab 6F10 epitope in capsids. The epitope of monoclonal antibody, mab 6F10, was mapped to residues A862 H880 of the HSV-1 major capsid protein VP5 by immunoblotting

More information

3'A C G A C C A G T A A A 5'

3'A C G A C C A G T A A A 5' AP Biology Chapter 14 Reading Guide Gene Expression: From Gene to Protein Overview 1. What is gene expression? Concept 14.1 Genes specify proteins via transcription and translation Basic Principles of

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Domain architecture and conformational states of the decapping complex, as revealed by structural studies. (a) Domain organization of Schizosaccharomyces pombe (Sp) and Saccharomyces

More information

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis

Gene expression analysis. Biosciences 741: Genomics Fall, 2013 Week 5. Gene expression analysis Gene expression analysis Biosciences 741: Genomics Fall, 2013 Week 5 Gene expression analysis From EST clusters to spotted cdna microarrays Long vs. short oligonucleotide microarrays vs. RT-PCR Methods

More information

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?

5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna? Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any

More information

Answers to additional linkage problems.

Answers to additional linkage problems. Spring 2013 Biology 321 Answers to Assignment Set 8 Chapter 4 http://fire.biol.wwu.edu/trent/trent/iga_10e_sm_chapter_04.pdf Answers to additional linkage problems. Problem -1 In this cell, there two copies

More information

Practice Problems 5. Location of LSA-GFP fluorescence

Practice Problems 5. Location of LSA-GFP fluorescence Life Sciences 1a Practice Problems 5 1. Soluble proteins that are normally secreted from the cell into the extracellular environment must go through a series of steps referred to as the secretory pathway.

More information

Chapter 15 Gene Technologies and Human Applications

Chapter 15 Gene Technologies and Human Applications Chapter Outline Chapter 15 Gene Technologies and Human Applications Section 1: The Human Genome KEY IDEAS > Why is the Human Genome Project so important? > How do genomics and gene technologies affect

More information

MICB688L/MOCB639 Advanced Cell Biology Exam II

MICB688L/MOCB639 Advanced Cell Biology Exam II MICB688L/MOCB639 Advanced Cell Biology Exam II May 10, 2001 Name: 1. Briefly describe the four major classes of cell surface receptors and their modes of action (immediate downstream only) (8) 2. Please

More information

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305

MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 MARINE BIOINFORMATICS & NANOBIOTECHNOLOGY - PBBT305 UNIT-1 MARINE GENOMICS AND PROTEOMICS 1. Define genomics? 2. Scope and functional genomics? 3. What is Genetics? 4. Define functional genomics? 5. What

More information

Methods in Biochemistry (KB8002)

Methods in Biochemistry (KB8002) Methods in Biochemistry (KB8002) AIM Methods in Biochemistry will introduce students to the fundamental principles behind several basic and more advanced techniques commonly used in biochemical research.

More information

Exploring Similarities of Conserved Domains/Motifs

Exploring Similarities of Conserved Domains/Motifs Exploring Similarities of Conserved Domains/Motifs Sotiria Palioura Abstract Traditionally, proteins are represented as amino acid sequences. There are, though, other (potentially more exciting) representations;

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Molecular design principles underlying β-strand swapping. in the adhesive dimerization of cadherins

Molecular design principles underlying β-strand swapping. in the adhesive dimerization of cadherins Supplementary information for: Molecular design principles underlying β-strand swapping in the adhesive dimerization of cadherins Jeremie Vendome 1,2,3,5, Shoshana Posy 1,2,3,5,6, Xiangshu Jin, 1,3 Fabiana

More information

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C.

Time allowed: 2 hours Answer ALL questions in Section A, ALL PARTS of the question in Section B and ONE question from Section C. UNIVERSITY OF EAST ANGLIA School of Biological Sciences Main Series UG Examination 2014-2015 FUNDAMENTALS OF MOLECULAR BIOLOGY AND GENETICS BIO-4003A Time allowed: 2 hours Answer ALL questions in Section

More information

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying

More information

Map-Based Cloning of Qualitative Plant Genes

Map-Based Cloning of Qualitative Plant Genes Map-Based Cloning of Qualitative Plant Genes Map-based cloning using the genetic relationship between a gene and a marker as the basis for beginning a search for a gene Chromosome walking moving toward

More information

20.320, notes for 9/13

20.320, notes for 9/13 20.320 Notes Page 1 20.320, notes for 9/13 Thursday, September 13, 2012 9:36 AM Coming Assignments 1st part of design project coming up, assigned 9/14 (tomorrow) and due 9/21. Last time We covered ITC

More information

HIR Central Lab High End Instrument

HIR Central Lab High End Instrument HIR Central Lab High End Instrument DR KOK GAN CHAN PhD, MSc, LLM(Merit), BSc, LLB, CBiol, MIBiol. High Impact Research Coordinator PhD, MSc, LLM(Merit), BSc, LLB, CBiol, MIBiol High Impact Research Building,

More information

Name with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization MIDTERM EXAM (October 7, 2010) 93 TOTAL POINTS

Name with Last Name, First: BIOE111: Functional Biomaterial Development and Characterization MIDTERM EXAM (October 7, 2010) 93 TOTAL POINTS BIOE111: Functional Biomaterial Development and Characterization MIDTERM EXAM (October 7, 2010) 93 TOTAL POINTS Question 0: Fill in your name and student ID on each page. (1) Question 1: What is the role

More information

Improved drug delivery systems: Targeting specific organelles and suborganellar compartments

Improved drug delivery systems: Targeting specific organelles and suborganellar compartments Improved drug delivery systems: Targeting specific organelles and suborganellar compartments Kostas Tokatlidis Institute of Molecular Biology and Biotechnology (IMBB-FORTH) and University of Crete 1900s

More information

Personal Exam Code: 1. 16p

Personal Exam Code: 1. 16p Exam, Methods in Molecular Biology, BIOR47, 2012-04-26 Please hand in answers to each question on its paper. Use additional papers if needed. Mark all papers with your code. Your answers should be logical

More information

Protein-Protein Interactions I

Protein-Protein Interactions I Biochemistry 412 Protein-Protein Interactions I March 11, 2008 Macromolecular Recognition by Proteins Protein folding is a process governed by intramolecular recognition. Protein-protein association is

More information

Sequence Determinants of a Conformational Switch in a Protein

Sequence Determinants of a Conformational Switch in a Protein Sequence Determinants of a Conformational Switch in a Protein Thomas A. Anderson, Matthew H. J. Cordes, and Robert T. Sauer Kyle Skalenko 4/17/09 Introduction Protein folding is guided by the following

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Table 1. Crystallographic statistics CRM1-SNUPN complex Space group P6 4 22 a=b=250.4, c=190.4 Data collection statistics: CRM1-selenomethionine SNUPN MAD data Peak Inflection Remote Native

More information

Final exam. Please write your name on the exam and keep an ID card ready.

Final exam. Please write your name on the exam and keep an ID card ready. Biophysics of Macromolecules Prof. R. Jungmann and Prof. J. Lipfert SS 2017 Final exam Final exam First name: Last name: Student number ( Matrikelnummer ): Please write your name on the exam and keep an

More information

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015

ChIP-Seq Tools. J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 ChIP-Seq Tools J Fass UCD Genome Center Bioinformatics Core Wednesday September 16, 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA or

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday 15 June 2015 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind DNA

More information

Gene Expression: From Genes to Proteins

Gene Expression: From Genes to Proteins The Flow of Genetic Information Gene Expression: From Genes to Proteins Chapter 9 Central Dogma in Molecular Biology molecule Gene 1 Strand to be transcribed Gene 2 Gene 3 strand Codon : Polymerase transcribes

More information

Engineering splicing factors with designed specificities

Engineering splicing factors with designed specificities nature methods Engineering splicing factors with designed specificities Yang Wang, Cheom-Gil Cheong, Traci M Tanaka Hall & Zefeng Wang Supplementary figures and text: Supplementary Figure 1 Supplementary

More information

Student name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total

Student name ID # Second Mid Term Exam, Biology 2020, Spring 2002 Scores Total Second Mid Term Exam, Biology 2020, Spring 2002 Scores 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. Total 1 1. Matching (7 pts). Each answer is used exactly once Helicase

More information

BurrH: a new modular DNA binding protein for genome engineering

BurrH: a new modular DNA binding protein for genome engineering Supplementary information for: BurrH: a new modular protein for genome engineering Alexandre Juillerat, Claudia Bertonati, Gwendoline Dubois, Valérie Guyot, Séverine Thomas, Julien Valton, Marine Beurdeley,

More information

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014

ChIP-Seq Data Analysis. J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 ChIP-Seq Data Analysis J Fass UCD Genome Center Bioinformatics Core Wednesday December 17, 2014 What s the Question? Where do Transcription Factors (TFs) bind genomic DNA 1? (Where do other things bind

More information

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006

Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Biology 142 Advanced Topics in Genetics and Molecular Biology Course Syllabus Spring 2006 Faculty Information: Dr. Nitya Jacob, Office: Room 104, Pierce Hall; Phone: 770-784-8346 Office Hours: T 9:30-10:30

More information

The Green Fluorescent Protein. w.chem.uwec.edu/chem412_s99/ppt/green.ppt

The Green Fluorescent Protein. w.chem.uwec.edu/chem412_s99/ppt/green.ppt The Green Fluorescent Protein w.chem.uwec.edu/chem412_s99/ppt/green.ppt www.chem.uwec.edu/chem412_s99/ppt/green.ppt Protein (gene) is from a jellyfish: Aequorea victoria www.chem.uwec.edu/chem412_s99/ppt/green.ppt

More information

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical

Supplemental Figure 1 Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical Supplemental Figure Human REEP family of proteins can be divided into two distinct subfamilies. Residues (single letter amino acid code) identical in all six REEPs are highlighted in green. Additional

More information

DNA. Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts

DNA. Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts DNA Branden & Tooze, Ch. 7 Deoxyribose nucleic acids are made of three parts base: adenine, cytosine, guanine, thymine sugar: deoxyribose phosphate: will form the phosphate backbone wide narrow DNA binding

More information

Deoxyribonucleic Acid DNA

Deoxyribonucleic Acid DNA Introduction to BioMEMS & Medical Microdevices DNA Microarrays and Lab-on-a-Chip Methods Companion lecture to the textbook: Fundamentals of BioMEMS and Medical Microdevices, by Prof., http://saliterman.umn.edu/

More information