SUPPLEMENTARY INFORMATION
|
|
|
- Aleesha Wilson
- 6 years ago
- Views:
Transcription
1 SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we transfected NIH3T3 cells with HP1α-HA, GFP, GFP-SUMO-1, Myc-Suv39h1, Myc-Suv39h2, Myc-Suv39h2-ΔN82 or Myc- Suv39h1+h2N82 as indicated. We performed anti-ha immunoprecipitation from total extracts. Western blot analysis using anti-gfp and anti-ha antibodies revealed sumoylated HP1α-HA (GFP-SUMO-1-HP1α-HA, box) and unmodified HP1α-HA. Western blot using anti-myc antibodies indicated that the four Myc-tagged proteins coimmunoprecipitated with HP1α-HA. Note that more Myc-Suv39h2-ΔN82 coimmunoprecipitated with HP1α-HA compared to wild type Suv39h2. IgG corresponds to the immunoglobulin light chain. The asterisk indicates unspecific bands. Bottom: We verified the expression levels of all transfected proteins in total cell extracts by Western blot using anti-gfp, anti-ha and anti-myc antibodies.
2 Supplementary Figure 2: Suv39h1 enhances HP1α sumoylation in vivo regardless of its H3K9 KMT activity. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we transfected NIH3T3 cells with HP1α-HA, GFP, GFP-SUMO-1, Myc-Suv39h1, Myc-Suv39h1-ΔN40 or Myc-Suv39h1-H324K as indicated. We performed anti-ha immunoprecipitation from total extracts. Western blot analysis using anti-gfp and anti-ha antibodies revealed sumoylated HP1α-HA (GFP-SUMO-1-HP1α-HA, box) and unmodified HP1α-HA. Western blot using anti-myc antibodies indicated that Myc- Suv39h1 and Myc-Suv39h1-H324K but not with Myc-Suv39h1-ΔN40 coimmunoprecipitated with HP1α-HA. IgG corresponds to the immunoglobulin light chain. Asterisks indicate unspecific bands. Bottom: We verified the expression levels of all transfected proteins in total cell extracts by Western blot using anti-gfp, anti-ha and anti-myc antibodies.
3 Supplementary Figure 3: Suv39h1 enhances HP1α sumoylation in vitro. a. In vitro HP1α sumoylation assay. Top: experimental scheme. Equal amounts (60 ng) of HP1α partners (Suv39h1, KAP1 and p150) were tested for their ability to stimulate purified GST- HP1α sumoylation. Bottom: Analysis of the sumoylation reaction mixture by Western blotting using anti- HP1α antibodies revealed the positions of sumoylated GST-HP1α (SUMO-1-GST-HP1α, box) and unmodified GST-HP1α. Low exposure allows a clear detection of unmodified GST-HP1α but not of SUMO-1- GST-HP1α. High exposure permits detection of SUMO-1- GST-HP1α, but most of the signal is obscured by the high signal of the GST-HP1α below. Therefore, to optimize the detection of SUMO-1-GST-HP1α, we cut the membrane (scissors) above the protein marker 50 kda before the detection step of the Western blotting procedure. We then performed a high exposure on the upper part that enabled the visualization of SUMO-1-GST-HP1α and a low exposure on the lower part that enabled the visualization of unmodified GST-HP1α. b. Assay of Suv39h1 in stimulating HP1α sumoylation in vitro. Western blot analysis was performed as in a. c. Analysis of recombinant GST-Suv39h1, GST-KAP1 and His-p150 used in sumoylation reactions by Imperial Protein staining.
4 Supplementary Figure 4: Suv39h1 binds directly to Ubc9. a. GST pull down assay. We incubated total extract of NIH3T3 cells expressing Myc-Suv39h1 with GST-Ubc9 or GST beads. We monitored the presence of Suv39h1 in the input (I, 10%), unbound (U) and bound (B) fractions by Western blot using anti-myc antibodies. Memcode staining of the membrane revealed the similar amounts of GST-Ubc9 and GST used. b. Far-western blot using His-Suv39h1 full-length (WT) or truncated versions as baits and purified recombinant GST-Ubc9 or GST control as preys. We revealed interacting GST-Ubc9 using anti-gst antibodies. Along each construct, interaction (+) or absence of interaction (-) with Ubc9 is indicated. Note that the domain alone failed to bind to Ubc9, suggesting that flanking amino acids might be required in this assay either for the interaction between Suv39h1 and Ubc9 or for the proper folding of the truncated form necessary for the interaction with Ubc9. c. Far-western blot as above. We found that the Ubc9 interaction domain on Suv39h1 could be refined to aa
5 Supplementary Figure 5: Suv39h1 binds directly to SUMO-1. a. In vitro Suv39h1 sumoylation assay with series of truncated versions. Top: experimental scheme. Bottom: Western blot analysis of the sumoylation reaction mixture with anti-gst antibodies revealed sumoylated GST-Suv39h (SUMO-1-GST-Suv39h , box) marked by an asterisk and unmodified GST-Suv39h or GST-Suv39h b. Far-western blot using His-Suv39h1 full-length (WT) or truncated versions as baits and purified recombinant GST- SUMO-1 or GST control as preys. We revealed bound GST-SUMO-1 using anti-gst antibodies. Along each construct, interaction (+) or absence of interaction (-) with SUMO-1 is indicated. c. We analyzed by Imperial Protein staining recombinant GST-Suv39h1 full-length (WT) or truncated versions used in in vitro sumoylation reactions showed in Fig. 2b. Asterisks indicate the recombinant proteins.
6 Supplementary Figure 6: The domain of Suv39h1 promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we transfected NIH3T3 cells with HP1α-HA, GFP, GFP-SUMO-1, Myc-Suv39h1-WT, Suv39h , Suv39h or Suv39h as indicated. We performed anti-ha immunoprecipitation from total extracts. Western blot analysis using anti-gfp and anti-ha antibodies revealed sumoylated HP1α-HA (GFP-SUMO-1-HP1α-HA, box) and unmodified HP1α-HA. Western blot using anti-myc antibodies indicated that Myc-Suv39h1-WT and Myc-Suv39h coimmunoprecipitated with HP1α-HA. IgG corresponds to the immunoglobulin light chain. Asterisks indicate unspecific bands. Bottom: We verified the expression levels of all transfected proteins in total cell extracts by Western blot using anti-gfp, anti-ha and anti-myc antibodies.
7 Supplementary Figure 7. H3K9 KMT catalytically dead Suv39h1-H324K promotes de novo targeting of HP1α to pericentric heterochromatin. a. De novo localization of exogenous HP1α-HA and H3K9me3 in Suv39h double-null cells expressing Myc-Suv39h1-WT, Myc-Suv39h1-ΔN40 or Myc-Suv39h1-H324K analyzed by immunofluorescence using anti-ha (red), anti-h3k9me3 (white) and anti-myc (green) antibodies 5h after transfection. We examined 300 transfected cells and performed quantitative analysis of the percentage of transfected cells with HP1α-HA or endogenous H3K9me3 enriched at pericentric heterochromatin domains (PHC). Error bars on the graph represent SD from three independent experiments. A comparison of transfected protein expression is shown on the Western blot. *p<0.05 (Student s t test). Scale bar, 10 µm. Note that in this assay, we explored whether transfection of Suv39h double-null cells with H3K9 KMT catalytically dead Suv39h1-H324K mutant could promote de novo localization of exogenous HP1α-HA at pericentric heterochromatin. We used as a positive control Myc-Suv39h1-WT that restores the proper localization of both HP1α and H3K9me3 at pericentric domains 1,2,3, and as a negative control Myc-Suv39h1-ΔN40 that cannot interact with HP1α and does not accumulate at pericentric domains. Transfection with HP1α-HA alone does not lead to its accumulation at pericentric heterochromatin 2. In 33% of cells cotransfected with Myc-Suv39h1-WT, HP1α-HA localized at pericentric domains and H3K9me3 accumulation was restored. In contrast, we could not detect pericentric localization of HP1α-HA and H3K9me3 in cells transfected with Myc-Suv39h1-ΔN40. Notably, in about 11% of cells cotransfected with H3K9 KMT catalytically dead Myc-Suv39h1-H324K, we found that HP1α-HA accumulated at pericentric domains, although we did not detect H3K9me3 accumulation at these domains. b. De novo localization of endogenous HP1α and H3K9me3 in Suv39h double-null cells expressing Myc-Suv39h1-WT, Myc-Suv39h1-ΔN40 or Myc-Suv39h1-H324K analyzed by immunofluorescence using anti-hp1α (red), anti-h3k9me3 (red) and anti-myc (green) antibodies 5h after transfection. We performed quantitative analysis of the percentage of transfected cells with endogenous HP1α or H3K9me3 enriched at pericentric heterochromatin domains (PHC). Error bars on the graph represent SD from three independent experiments. A comparison of transfected protein expression is shown on the western blot. ***p<0.001 (Student s t test). Scale bar, 10 µm.
8 Supplementary Figure 8. Myc-Suv39h2-H398K, a H3K9 KMT catalytically dead mutant of Suv39h2, does not promote de novo targeting of HP1α. De novo localization of HP1α-HA and H3K9me3 in Suv39h double-null cells expressing Myc- Suv39h2-WT, Myc-Suv39h2-ΔN117 or Myc-Suv39h2-H398K analyzed by immunofluorescence using anti-ha (red), anti-h3k9me3 (white) and anti-myc (green) antibodies 5h after transfection. We examined 300 transfected cells and performed quantitative analysis of the percentage of transfected cells with HP1α-HA or endogenous H3K9me3 enriched at pericentric heterochromatin domains (PHC). Error bars on the graph represent SD from three independent experiments. A comparison of transfected protein expression is shown on the western blot. The asterisk indicates unspecific bands. Scale bar, 10 µm.
9 Supplementary Figure 9. De novo localization of the Myc-Suv39h1 truncated proteins. a. Experimental scheme. b. De novo localization of Myc-Suv39h1-WT or truncated versions and endogenous HP1α in Suv39h double-null cells analyzed by immunofluorescence using anti-myc (green) and anti- HP1α (red) antibodies 5h after transfection. We performed quantitative analysis of the percentage of transfected cells with the Myc signal or endogenous HP1α enriched at pericentric heterochromatin domains (PHC). Error bars on the graph represent SD from three independent experiments. A comparison of transfected protein expression is shown on the western blots. Scale bar, 10 µm. c. Western blot using anti-suv39h1 antibody to detect Suv39h1 in total extracts prepared from wild type MEFs, Suv39h double-null MEFs, Suv39h double-null MEFs transfected with Myc-Suv39h1 or TALE-Suv39h1-HA. To estimate how expression of endogenous Suv39h1 in wild type MEFs compared to exogenous Suv39h1 tagged either with Myc or TALE and HA in Suv39h double-null MEFs, we adjusted the signal corresponding to exogenous Suv39h1 on the blot to the fraction of transfected cells. In this way, while we cannot exclude variation from cell to cell, we could estimate that on average for transfected cells, exogenous Myc-Suv39h1 expression reaches is 1.5-fold higher than the endogenous normal amount and exogenous TALE- Suv39h1-HA is comparable.
10 Supplementary Figure 10. De novo targeting of HP1α to pericentric heterochromatin in the presence of tethered Suv39h1 or Suv39h2. Analysis over time of the de novo localization of endogenous HP1α following transfection with TALE-Suv39h1-HA or TALE-Suv39h2-HA in Suv39h double-null cells. The percentage of cells with HP1α and H3K9me3 enriched at pericentric heterochromatin domains (PHC) as a function of time after transfection is represented. Error bars indicate SD of three independent experiments (300 transfected cells counted in each condition). A comparison of transfected protein expression is shown on the Western blot.
11 Supplementary Figure 11. Tethering the domain of Suv39h1 to pericentric heterochromatin boosts de novo targeting of HP1α. a. Far-western blot using respectively two amounts of His-Suv39h1 truncated versions as baits and purified recombinant GST-HP1α or GST control as preys. We revealed bound GST-HP1α using anti-gst antibodies. The histogram shows the signal of GST-HP1α relative to His signal (ratio) for the two amounts of His-Suv39h1 truncated versions. 100% is set for the His-Suv39h Error bars represent SD from 2 independent experiments. b. Saturation binding assay (AlphaSreen) using various concentrations (nm) of His-HP1α and 5 nm of GST-Suv39h1 truncated versions. The affinity constant (Kd) was derived from the saturation curves as the His-HP1α concentration at which half saturating signal is reached (arrows). The histogram shows the mean Kd for the interaction between HP1α and Suv39h (1,47 nm) or Suv-39h (1,18 nm). Error bars represent SD from 3 independent experiments. c. Immunoprecipitation of TALE-Suv39h HA, TALE-Suv39h HA and TALE-Suv39h HA. Western blot analysis using anti- HA and anti-hp1α antibodies revealed HA-tagged proteins and endogenous HP1α in total cell extracts and immunoprecipitates. The histogram shows the signal of endogenous HP1α relative to HA signal (ratio). 100% is set for the TALE-Suv39h HA. Error bars represent SD from 3 independent experiments. d. Time course analysis of the de novo localization of endogenous HP1α in Suv39h double-null cells transfected with TALE-Suv39h HA or TALE-Suv39h HA. Top: experimental scheme. Bottom: We performed quantitative analysis of endogenous HP1α (left) and TALE-Suv39h1-HA constructs and (right) enrichment at pericentric heterochromatin domains (PHC) on at least 100 transfected cells for each condition from four independent experiments using the 3D-FIED method. ns: not significant; **p<0.01; ***p<0.001 (Student s t test).
12 Supplementary Figure 12. The Ubc9 binding domain of Suv39h1. a. Phylogenetic comparison of Suv39h1 in the Ubc9 binding domain. This domain in human Suv39h1 corresponds to aa (Supplementary Fig. 4c). It is predicted to fold in a α-helix in line with the structural data of Clr4 4. b. Far-western blot using His-Suv39h WT or mutated versions (KQRmut, RRWmut, EQEmut or KRSmut) as baits and purified recombinant GST-Ubc9 or GST control as preys. We revealed bound GST-Ubc9 using anti-gst antibodies. The histogram shows the signal of GST-Ubc9 relative to His signal (ratio). 100% is set for the His-Suv39h WT. Error bars represent SD from 2 independent experiments.
13 Supplementary Figure 13. Myc-Suv39h1-KQRmut, a mutant unable to bind to Ubc9, does not enhance HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we transfected NIH3T3 cells with HP1α-HA, GFP, GFP-SUMO-1, Myc-Suv39h1-WT, Myc-Suv39h1-KQRmut or Myc-Suv39h1- EQEmut as indicated. We performed anti-ha immunoprecipitation from total extracts. Western blot analysis using anti-gfp and anti-ha antibodies revealed sumoylated HP1α-HA (GFP-SUMO-1- HP1α-HA, box) and unmodified HP1α-HA. Western blot using anti-myc antibodies indicated that the three Myc-tagged proteins coimmunoprecipitated with HP1α-HA. IgG corresponds to the immunoglobulin light chain. Asterisks indicate unspecific bands. Bottom: We verified the expression levels of all transfected proteins in total cell extracts by Western blot using anti-gfp, anti-ha and anti-myc antibodies.
14 Supplementary Figure 14. Tethering Suv39h KQR mutant to pericentric heterochromatin does not promote an efficient de novo targeting of HP1α. Top: experimental scheme. Bottom: De novo localization of endogenous HP1α (red) in Suv39h double-null cells expressing TALE-Suv39h WT, TALE-Suv39h KQRmut, TALE- Suv39h EQEmut or TALE-Suv39h tagged with HA (green) analyzed by immunofluorescence 5h after transfection. We observed that the transfection of TALE-Suv39h KQRmut gives rise to a high mortality of cells compared to the others transfected proteins. A comparison of transfected protein expression is shown on the Western blot. Scale bar, 10 µm.
15 Supplementary Figure 15: Uncropped Western blot corresponding to figure 1b. Box indicates portion of the blot displayed in figure 1b.
16 . Supplementary Figure 16: Uncropped Western blots corresponding to figure 1d. Boxes indicate portions of the blots displayed in figure 1d.
17 Supplementary Figure 17: Uncropped Western blots corresponding to figure 1e. Boxes indicate portions of the blots displayed in figure 1e.
18 Supplementary Figure 18: Uncropped Western blots corresponding to figure 3b. Boxes indicate portions of the blots displayed in figure 3b.
19 Supplementary Figure 19: Uncropped Western blots corresponding to figure 3c. Boxes indicate portions of the blots displayed in figure 3c. Supplementary references 1 Lachner, M., O'Carroll, D., Rea, S., Mechtler, K. & Jenuwein, T. Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature 410, (2001). 2 Maison, C. et al. SUMOylation promotes de novo targeting of HP1alpha to pericentric heterochromatin. Nat Genet 43, (2011). 3 Loyola, A., Bonaldi, T., Roche, D., Imhof, A. & Almouzni, G. PTMs on H3 variants before chromatin assembly potentiate their final epigenetic state. Mol Cell 24, (2006). 4 Min, J., Zhang, X., Cheng, X., Grewal, S. I. & Xu, R. M. Structure of the SET domain histone lysine methyltransferase Clr4. Nat Struct Biol 9, (2002).
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Dynamic Phosphorylation of HP1 Regulates Mitotic Progression in Human Cells Supplementary Figures Supplementary Figure 1. NDR1 interacts with HP1. (a) Immunoprecipitation using
Hossain_Supplemental Figure 1
Hossain_Supplemental Figure 1 GFP-PACT GFP-PACT Motif I GFP-PACT Motif II A. MG132 (1µM) GFP Tubulin GFP-PACT Pericentrin GFP-PACT GFP-PACT Pericentrin Fig. S1. Expression and localization of Orc1 PACT
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or
Figure 1: TDP-43 is subject to lysine acetylation within the RNA-binding domain a) QBI-293 cells were transfected with TDP-43 in the presence or absence of the acetyltransferase CBP and acetylated TDP-43
SUPPLEMENTARY ONLINE MATERIAL
SUPPLEMENTARY ONLINE MATERIAL The SUMO protease SENP7 is a critical component to ensure HP1 enrichment at pericentric heterochromatin Christèle Maison*, Kelly Romeo*, Delphine Bailly, Marion Dubarry, Jean-Pierre
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table.
Supplementary Table 1. The Q-PCR primer sequence is summarized in the following table. Name Sequence (5-3 ) Application Flag-u ggactacaaggacgacgatgac Shared upstream primer for all the amplifications of
GFP CCD2 GFP IP:GFP
D1 D2 1 75 95 148 178 492 GFP CCD1 CCD2 CCD2 GFP D1 D2 GFP D1 D2 Beclin 1 IB:GFP IP:GFP Supplementary Figure 1: Mapping domains required for binding to HEK293T cells are transfected with EGFP-tagged mutant
The microtubule-associated tau protein has intrinsic acetyltransferase activity. Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and
SUPPLEMENTARY INFORMATION: The microtubule-associated tau protein has intrinsic acetyltransferase activity Todd J. Cohen, Dave Friedmann, Andrew W. Hwang, Ronen Marmorstein and Virginia M.Y. Lee Cohen
42 fl organelles = 34.5 fl (1) 3.5X X 0.93 = 78,000 (2)
SUPPLEMENTAL DATA Supplementary Experimental Procedures Fluorescence Microscopy - A Zeiss Axiovert 200M microscope equipped with a Zeiss 100x Plan- Apochromat (1.40 NA) DIC objective and Hamamatsu Orca
The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit
Cell Reports, Volume 5 Supplemental Information The Human Protein PRR14 Tethers Heterochromatin to the Nuclear Lamina During Interphase and Mitotic Exit Andrey Poleshko, Katelyn M. Mansfield, Caroline
Coleman et al., Supplementary Figure 1
Coleman et al., Supplementary Figure 1 BrdU Merge G1 Early S Mid S Supplementary Figure 1. Sequential destruction of CRL4 Cdt2 targets during the G1/S transition. HCT116 cells were synchronized by sequential
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than. SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with
Supplementary Fig. S1. SAMHD1c has a more potent dntpase activity than SAMHD1c. Purified recombinant SAMHD1c and SAMHD1c proteins (with concentration of 800nM) were incubated with 1mM dgtp for the indicated
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc RGLG Hormonal treatment H2O B RGLG µm ABA µm ACC µm GA Time (hours) µm µm MJ µm IA
Supplemental Data. Wu et al. (2). Plant Cell..5/tpc..4. A B Supplemental Figure. Immunoblot analysis verifies the expression of the AD-PP2C and BD-RGLG proteins in the Y2H assay. Total proteins were extracted
Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product.
Supplementary Information Supplementary Figure S1. Immunodetection of full-length XA21 and the XA21 C-terminal cleavage product. Total protein extracted from Kitaake wild type and rice plants carrying
Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon Song, Richard M. Amasino, Bosl Noh, and Yoo-Sun Noh
Developmental Cell, Volume 22 Supplemental Information Control of Seed Germination by Light-Induced Histone Arginine Demethylation Activity Jung-Nam Cho, Jee-Youn Ryu, Young-Min Jeong, Jihye Park, Ji-Joon
Histone Analysis. Histone Analysis
Histone Analysis Histone Analysis innovative tools designed to help unravel the histone code Histone Antibodies Histone Purification Recombinant Histones Histone Modifying Enzymes Histone Modification
pgbkt7 Anti- Myc AH109 strain (KDa) 50
pgbkt7 (KDa) 50 37 Anti- Myc AH109 strain Supplementary Figure 1. Protein expression of CRN and TDR in yeast. To analyse the protein expression of CRNKD and TDRKD, total proteins extracted from yeast culture
supplementary information
DOI: 10.1038/ncb2017 Figure S1 53BP1 sirna results in a heterochromatic DSB repair defect. Panel A: NIH3T3 cells were transfected with murine 53BP1 sirna. 48 hrs later, cells were irradiated with 3 Gy
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System
ChampionChIP Quick, High Throughput Chromatin Immunoprecipitation Assay System Liyan Pang, Ph.D. Application Scientist 1 Topics to be Covered Introduction What is ChIP-qPCR? Challenges Facing Biological
Technical tips Session 5
Technical tips Session 5 Chromatine Immunoprecipitation (ChIP): This is a powerful in vivo method to quantitate interaction of proteins associated with specific regions of the genome. It involves the immunoprecipitation
SUPPLEMENTARY INFORMATION
doi:10.1038/nature09732 Supplementary Figure 1: Depletion of Fbw7 results in elevated Mcl-1 abundance. a, Total thymocytes from 8-wk-old Lck-Cre/Fbw7 +/fl (Control) or Lck-Cre/Fbw7 fl/fl (Fbw7 KO) mice
ASPP1 Fw GGTTGGGAATCCACGTGTTG ASPP1 Rv GCCATATCTTGGAGCTCTGAGAG
Supplemental Materials and Methods Plasmids: the following plasmids were used in the supplementary data: pwzl-myc- Lats2 (Aylon et al, 2006), pretrosuper-vector and pretrosuper-shp53 (generous gift of
* ** ** * IB: p-p90rsk. p90rsk (Ser380) (arbitrary units) (Ser380) p90rsk. IB: p90rsk. Tubulin. IB: Tubulin. Ang II (200 nm) Ang II (200 nm)
I: p-p9rsk I: p9rsk I: C I: p-p9rsk I: p9rsk 5 (ka) 5 5 (min) Ang II ( nm) p-p9rsk (Ser8) p9rsk p-p9rsk (Ser8) p9rsk (h) Mannitol 5 mm -Glucose 5 mm p9rsk (Ser8) (arbitrary units) p-p9rsk (Ser8) (arbitrary
Supplemental Data. Steiner et al. Plant Cell. (2012) /tpc
Supplemental Figure 1. SPY does not interact with free GST. Invitro pull-down assay using E. coli-expressed MBP-SPY and GST, GST-TCP14 and GST-TCP15. MBP-SPY was used as bait and incubated with equal amount
The HP1a CAF1 SetDB1-containing complex provides H3K9me1 for Suv39-mediated K9me3 in pericentric heterochromatin
scientificreport The a CAF1 -containing complex provides H3 for Suv39-mediated me3 in pericentric heterochromatin Alejandra Loyola 1,2,3,HideakiTagami 4w, Tiziana Bonaldi 5,Danièle Roche 2, Jean Pierre
SUPPLEMENTARY INFORMATION
doi:.38/nature899 Supplementary Figure Suzuki et al. a c p7 -/- / WT ratio (+)/(-) p7 -/- / WT ratio Log X 3. Fold change by treatment ( (+)/(-)) Log X.5 3-3. -. b Fold change by treatment ( (+)/(-)) 8
Online Supplementary Information
Online Supplementary Information NLRP4 negatively regulates type I interferon signaling by targeting TBK1 for degradation via E3 ubiquitin ligase DTX4 Jun Cui 1,4,6,7, Yinyin Li 1,5,6,7, Liang Zhu 1, Dan
Supplemental Data. Lee et al. Plant Cell. (2010) /tpc Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2.
Supplemental Figure 1. Protein and Gene Structures of DWA1 and DWA2. (A) Protein structures of DWA1 and DWA2. WD40 region was determined based on the NCBI conserved domain databases (B, C) Schematic representation
Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and
Supplementary Tables Supplementary Table 1: List of CH3 domain interface residues in the first chain (A) and their side chain contacting residues in the second chain (B) a Interface Res. in Contacting
ANTIBODY PERFORMANCE COMPARISON. Histone Modifications
ANTIBODY PERFORMANCE COMPARISON Histone Modifications COVER IMAGE: Methylation of cytosine bases in regions called CpG islands is a hallmark of transcriptionally repressed heterochromatin. These methylated
Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous
Preparation and purification of polyclonal antibodies Polyclonal ARHGAP25 antibody was prepared from rabbit serum after intracutaneous injections of glutathione S-transferase-ARHGAP25-(509-619) (GST-coiled
Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss
SUPPLEMENTARY INFORMATION Parthanatos mediates AIMP2-activated age-dependent dopaminergic neuronal loss Yunjong Lee, Senthilkumar S. Karuppagounder, Joo-Ho Shin, Yun-Il Lee, Han Seok Ko, Debbie Swing,
Supplementary Figure 1. RAD51 and RAD51 paralogs are enriched spontaneously onto
Supplementary Figure legends Supplementary Figure 1. and paralogs are enriched spontaneously onto the S-phase chromatin during DN replication. () Chromatin fractionation was carried out as described in
- NaCr. + NaCr. α H3K4me2 α H3K4me3 α H3K9me3 α H3K27me3 α H3K36me3 H3 H2A-2B H4 H3 H2A-2B H4 H3 H2A-2B H4. α Kcr. (rabbit) α Kac.
+ NaCr NaCr + NaCr NaCr Peptides 10ng 50ng 250ng K α Pan (mouse) Pan (mouse) 10ng 50ng 250ng α Pan (rabbit) C 10ng 50ng 250ng α Pan (mouse) 0 1.25 2.5 5 10 20 40 (mm) NaCr 24h α Pan (rabbit) α K4me2 α
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines
Revision Checklist for Science Signaling Research Manuscripts: Data Requirements and Style Guidelines Further information can be found at: http://stke.sciencemag.org/sites/default/files/researcharticlerevmsinstructions_0.pdf.
SUPPLEMENTARY INFORMATION. Small molecule activation of the TRAIL receptor DR5 in human cancer cells
SUPPLEMENTARY INFORMATION Small molecule activation of the TRAIL receptor DR5 in human cancer cells Gelin Wang 1*, Xiaoming Wang 2, Hong Yu 1, Shuguang Wei 1, Noelle Williams 1, Daniel L. Holmes 1, Randal
This Technical Note describes these characterization studies in more detail.
Technical Note Characterization of SOMAmer Reagents Binding Specificity in the SOMAscan 1.3k Assay Summary Slow Off-Rate Modified Aptamer (SOMAmer) reagents are identified via the SELEX process against
Supplemental Online Material. The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/-
#1074683s 1 Supplemental Online Material Materials and Methods Cell lines and tissue culture The mouse embryonic fibroblast cell line #10 derived from β-arrestin1 -/- -β-arrestin2 -/- knock-out animals
Enhancers mutations that make the original mutant phenotype more extreme. Suppressors mutations that make the original mutant phenotype less extreme
Interactomics and Proteomics 1. Interactomics The field of interactomics is concerned with interactions between genes or proteins. They can be genetic interactions, in which two genes are involved in the
Translation of HTT mrna with expanded CAG repeats is regulated by
Supplementary Information Translation of HTT mrna with expanded CAG repeats is regulated by the MID1-PP2A protein complex Sybille Krauß 1,*, Nadine Griesche 1, Ewa Jastrzebska 2,3, Changwei Chen 4, Désiree
ENCODE RBP Antibody Characterization Guidelines
ENCODE RBP Antibody Characterization Guidelines Approved on November 18, 2016 Background An integral part of the ENCODE Project is to characterize the antibodies used in the experiments. This document
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Description of the observed lymphatic metastases in two different SIX1-induced MCF7 metastasis models (Nude and NOD/SCID). Supplementary Figure 2. MCF7-SIX1
3. Results. 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors
3. Results 3.1 Generation of HEK293 cell clones stably expressing ETA and ETB receptors To investigate the dimerisation of the endothelin receptor subtypes HEK293 cells were stably transfected with plasmids
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Legends for Supplementary Tables. Supplementary Table 1. An excel file containing primary screen data. Worksheet 1, Normalized quantification data from a duplicated screen: valid
Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover
Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and
Aims: -Purification of a specific protein. -Study of protein-protein interactions
Aims: -Purification of a specific protein -Study of protein-protein interactions This is a reliable method for purifying total IgG from crude protein mixtures such as serum. Protein A (linked to resin
ab SUMOylation Assay Kit
ab139470 SUMOylation Assay Kit Instructions for Use For the generation and detection of SUMOylated proteins in vitro. This product is for research use only and is not intended for diagnostic use. Version
Immunofluorescence images of different core histones and different histone exchange assay.
Molecular Cell, Volume 51 Supplemental Information Enhanced Chromatin Dynamics by FACT Promotes Transcriptional Restart after UV-Induced DNA Damage Christoffel Dinant, Giannis Ampatziadis-Michailidis,
(A) Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site.
SUPPLEMENTRY INFORMTION SUPPLEMENTL FIGURES Figure S1. () Schematic illustration of sciatic nerve ligation. P, proximal; D, distal to the ligation site. () Western blot of ligated and unligated sciatic
SANTA CRUZ BIOTECHNOLOGY, INC.
TECHNICAL SERVICE GUIDE: Western Blotting 2. What size bands were expected and what size bands were detected? 3. Was the blot blank or was a dark background or non-specific bands seen? 4. Did this same
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,
Figure S6. Detection of anti-gfp antibodies in anti-dna and normal plasma without competition DNA--9
Supplementary Information Ultrasensitive antibody detection by agglutination-pcr (ADAP) Cheng-ting Tsai 1 *, Peter V. Robinson 1 *, Carole A. Spencer 2 and Carolyn R. Bertozzi 3,4ǂ Department of 1 Chemistry,
Small-Molecule Drug Target Identification/Deconvolution Technologies
Small-Molecule Drug Target Identification/Deconvolution Technologies Case-Studies Shantani Target ID Technology Tool Box Target Deconvolution is not Trivial = A single Tool / Technology May Not necessarily
Supporting Information
Supporting Information Su et al. 10.1073/pnas.1211604110 SI Materials and Methods Cell Culture and Plasmids. Tera-1 and Tera-2 cells (ATCC: HTB- 105/106) were maintained in McCoy s 5A medium with 15% FBS
X2-C/X1-Y X2-C/VCAM-Y. FRET efficiency. Ratio YFP/CFP
FRET efficiency.7.6..4.3.2 X2-C/X1-Y X2-C/VCAM-Y.1 1 2 3 Ratio YFP/CFP Supplemental Data 1. Analysis of / heterodimers in live cells using FRET. FRET saturation curves were obtained using cells transiently
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm
Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,
Department of Biochemistry and Purdue Cancer Center, Purdue University, West Lafayette, Indiana 47907, USA
A charge-based interaction between histone H4 and Dot1 is required for H3K79 methylation and telomere silencing: identification of a new trans-histone pathway Ian M. Fingerman, Hui-Chun Li, and Scott D.
Supplementary Figure Legend
Supplementary Figure Legend Supplementary Figure S1. Effects of MMP-1 silencing on HEp3-hi/diss cell proliferation in 2D and 3D culture conditions. (A) Downregulation of MMP-1 expression in HEp3-hi/diss
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 PCR-genotyping of the three mouse models used in this study and controls for behavioral experiments after semi-chronic Pten inhibition. a-c. DNA from App/Psen1 (a), Pten tg (b) and
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1.
Supplementary Figure 1. Characterization and high expression of Lnc-β-Catm in liver CSCs. (a) Heatmap of differently expressed lncrnas in Liver CSCs (CD13 + CD133 + ) and non-cscs (CD13 - CD133 - ) according
Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1.
Supplemental Online Material: Materials and Methods: All strains were derivatives of SK1 and are listed in Supplemental Table 1. Constructs: pclb2-3ha-cdc5 and pclb2-3ha-cdc2 strains were constructed by
Nature Structural and Molecular Biology: doi: /nsmb.2937
Supplementary Figure 1 Multiple sequence alignment of the CtIP N-terminal domain, purified CtIP protein constructs and details of the 2F o F c electron density map of CtIP-NTD. (a) Multiple sequence alignment,
Supplemental Data Supplementary Figure Legends and Scheme Figure S1.
Supplemental Data Supplementary Figure Legends and Scheme Figure S1. UTK1 inhibits the second EGF-induced wave of lamellipodia formation in TT cells. A and B, EGF-induced lamellipodia formation in TT cells,
Supplemental Data. LMO4 Controls the Balance between Excitatory. and Inhibitory Spinal V2 Interneurons
Neuron, Volume 61 Supplemental Data LMO4 Controls the Balance between Excitatory and Inhibitory Spinal V2 Interneurons Kaumudi Joshi, Seunghee Lee, Bora Lee, Jae W. Lee, and Soo-Kyung Lee Supplemental
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS
IMMUNOPRECIPITATION TROUBLESHOOTING TIPS Creative Diagnostics Abstract Immunoprecipitation (IP) is the technique of precipitating a protein antigen out of solution using an antibody that specifically binds
Figure S1. Figure S2. Figure S3 HB Anti-FSP27 (COOH-terminal peptide) Ab. Anti-GST-FSP27(45-127) Ab.
/ 36B4 mrna ratio Figure S1 * 2. 1.6 1.2.8 *.4 control TNFα BRL49653 Figure S2 Su bw AT p iw Anti- (COOH-terminal peptide) Ab Blot : Anti-GST-(45-127) Ab β-actin Figure S3 HB2 HW AT BA T Figure S4 A TAG
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated
Supplementary Figure 1. TRIM9 does not affect AP-1, NF-AT or ISRE activity. (a,b) At 24h post-transfection with TRIM9 or vector and indicated reporter luciferase constructs, HEK293T cells were stimulated
Activation of a Floral Homeotic Gene in Arabidopsis
Activation of a Floral Homeotic Gene in Arabidopsis By Maximiliam A. Busch, Kirsten Bomblies, and Detlef Weigel Presentation by Lis Garrett and Andrea Stevenson http://ucsdnews.ucsd.edu/archive/graphics/images/image5.jpg
Western-GUARANTEED Antibody Service FAQ
Western-GUARANTEED Antibody Service FAQ Content Q 1: When do I need a Western GUARANTEED Peptide Antibody Package?...2 Q 2: Can GenScript provide a Western blot guaranteed antibody?...2 Q 3: Does GenScript
EPIGENTEK. EpiQuik Chromatin Immunoprecipitation Kit. Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE
EpiQuik Chromatin Immunoprecipitation Kit Base Catalog # P-2002 PLEASE READ THIS ENTIRE USER GUIDE BEFORE USE The EpiQuik Chromatin Immunoprecipitation Kit is suitable for combining the specificity of
A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy
A Dual Pathogenic Mechanism Links Tau Acetylation to Sporadic Tauopathy Hanna Trzeciakiewicz, Jui-Heng Tseng, Connor M. Wander, Victoria Madden, Ashutosh Tripathy, Chao-Xing Yuan, and Todd J. Cohen Supplementary
Lecture 8: Affinity Chromatography-III
Lecture 8: Affinity Chromatography-III Key words: Chromatography; Affinity chromatography; Protein Purification During this lecture, we shall be studying few more examples of affinity chromatography. The
The MAP Kinase Family
The MAP Kinase Family Extracellular stimuli Classical MAP kinases Atypical MAP kinases MAPKKK MLK1/2/3/7; LZK RAF-1/A/B TAK1; TPL2 c-mos MEKK1-4; DLK ASK1/2; MLTK TAO1/2 ASK1 TAK1 MEKK1-4 MEKK2/3 TPL2???
MagSi Beads. Magnetic Silica Beads for Life Science and Biotechnology study
MagSi Beads Magnetic Silica Beads for Life Science and Biotechnology study MagnaMedics Diagnostics B.V. / Rev. 9.2 / 2012 Wide range of products for numerous applications MagnaMedics separation solutions
Nature Immunology: doi: /ni Supplementary Figure 1
Supplementary Figure 1 BALB/c LYVE1-deficient mice exhibited reduced lymphatic trafficking of all DC subsets after oxazolone-induced sensitization. (a) Schematic overview of the mouse skin oxazolone contact
A) B) Ladder. Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical
A) B) Ladder C) r4 r4 Nt- -Ct 78 kda Supplementary Figure 1. Recombinant calpain 14 purification analysis. A) The general domain structure of classical calpains is shown. The protease core consists of
Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana.
SUPPLEMENTARY FIGURES Figure S1. Immunoblotting showing proper expression of tagged R and AVR proteins in N. benthamiana. YFP:, :CFP, HA: and (A) and HA, CFP and YFPtagged and AVR1-CO39 (B) were expressed
Figure S1. sporulation frequency (%) 80. sme2-5. sme2-3. sme2
Figure S1 N WT -5-3 - DSRless mei4 100 ssm4 MS2loop () (kb) 1.0 0.5 sporulation frequency (%) 80 60 40 20 rrna 1 2 3 4 5 6 7 8 0 WT -5-3 -DSRless Figure S1. The DSR motifs in are crucial for its function.
Biochimie II. Assistants Ben Brankatschk Eleonora Torti
Biochimie II Purification de protéines exprimées dans des cellules humaines en culture Daniel Abegg Christophe Berthier Pauline Bonvin abegg6@etu.unige.ch berthie4@etu.unige.ch bonvinp0@etu.unige.ch Assistants
IMMUNOPRECIPITATION (IP)
1 IMMUNOPRECIPITATION (IP) Overview and Technical Tips 2 CONTENTS 3 7 8 9 12 13 17 18 19 20 Introduction Factors Influencing IP General Protocol Modifications Of IP Protocols Troubleshooting Contact Us
Supplemental Data. Sun et al. Plant Cell. (2012) /tpc FLS2 -cmyc -GFP FLS2 -HA. FLS2-FLAG FLS2 -HA BAK1-HA flg22 (10mM)
Supplemental Data. Sun et al. Plant ell. ()..5/tpc..9599 A FLS-FLA FLS -HA BAK-HA flg (mm) - B FLS -cmyc -FP FLS -HA IP antibody cmyc FLA FP cmyc IP ; WB: α-ha IP; WB: α-ha IP: α-fla; WB: α-ha IP ; WB:
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD
Technical Note Detection of post-immunoprecipitation proteins by Western blot using the Quick Western Kit IRDye 680RD Developed for: Aerius, Odyssey Classic, Odyssey CLx and Odyssey Sa Imaging Systems
SUPPLEMENTAL MATERIALS
SUPPLEMENL MERILS Eh-seq: RISPR epitope tagging hip-seq of DN-binding proteins Daniel Savic, E. hristopher Partridge, Kimberly M. Newberry, Sophia. Smith, Sarah K. Meadows, rian S. Roberts, Mark Mackiewicz,
Supplemental Data. Aung et al. (2011). Plant Cell /tpc
35S pro:pmd1-yfp 10 µm Supplemental Figure 1. -terminal YFP fusion of PMD1 (PMD1-YFP, in green) is localized to the cytosol. grobacterium cells harboring 35S pro :PMD1-YFP were infiltrated into tobacco
Supplemental Information for:
Supplemental Information for: Antibody-induced dimerization of FGFR1 promotes receptor endocytosis independently of its kinase activity Łukasz Opaliński*, Aleksandra Sokołowska-Wędzina, Martyna Szczepara,
Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive
Supplemental Data Heme utilization in the Caenorhabditis elegans hypodermal cells is facilitated by hemeresponsive gene-2 Caiyong Chen 1, Tamika K. Samuel 1, Michael Krause 2, Harry A. Dailey 3, and Iqbal
Species predicted to react based on 100% sequence homology: Chicken, Bovine, Dog.
1 of 5 11/1/2013 10:25 PM Product Pathways - Jak/Stat Pathway Phospho-Stat3 (Tyr705) Antibody #9131 Have you tried your application using our XP monoclonal antibodies? Try products: 9145 PhosphoSitePlus
Journal of Cell Science Supplementary Material
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 SUPPLEMENTARY FIGURE LEGENDS Figure S1: Eps8 is localized at focal adhesions and binds directly to FAK (A) Focal
Supplemental Material for Xue et al. List. Supplemental Figure legends. Figure S1. Related to Figure 1. Figure S2. Related to Figure 3
Supplemental Material for Xue et al List Supplemental Figure legends Figure S1. Related to Figure 1 Figure S. Related to Figure 3 Figure S3. Related to Figure 4 Figure S4. Related to Figure 4 Figure S5.
Chemical hijacking of auxin signaling with an engineered auxin-tir1
1 SUPPLEMENTARY INFORMATION Chemical hijacking of auxin signaling with an engineered auxin-tir1 pair Naoyuki Uchida 1,2*, Koji Takahashi 2*, Rie Iwasaki 1, Ryotaro Yamada 2, Masahiko Yoshimura 2, Takaho
Nature Medicine: doi: /nm.4464
Supplementary Fig. 1. Amino acid transporters and substrates used for selectivity screening. (A) Common transporters and amino acid substrates shown. Amino acids designated by one-letter codes. Transporters
Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna
Supplemental Materials and Methods Short hairpin RNA (shrna) against MMP14. Lentiviral plasmids containing shrna (Mission shrna, Sigma) against mouse MMP14 were transfected into HEK293 cells using FuGene6
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2774 Figure S1 TRF2 dosage modulates the tumorigenicity of mouse and human tumor cells. (a) Left: immunoblotting with antibodies directed against the Myc tag of the transduced TRF2 forms
Xfect Protein Transfection Reagent
Xfect Protein Transfection Reagent Mammalian Expression Systems Rapid, high-efficiency, low-toxicity protein transfection Transfect a large amount of active protein Virtually no cytotoxicity, unlike lipofection
Supplementary Material. TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the. ERK1/2 signaling pathway
Supplementary Material TRIB3 inhibits proliferation and promotes osteogenesis in hbmscs by regulating the ERK1/2 signaling pathway Cui Zhang 1, Fan-Fan Hong 1, Cui-Cui Wang 1, Liang Li 1, Jian-Ling Chen
by Neurobasal medium (supplemented with B27, 0.5mM glutamine, and 100 U/mL
Supplementary Materials and methods Neuronal cultures and transfection The hippocampus was dissected from E8 rat embryos, dissociated, and neurons plated onto glass coverslips coated with poly-ornithine
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling
Supplementary information to accompany: A novel role for the DNA repair gene Rad51 in Netrin-1 signalling Glendining KA 1, Markie D 2, Gardner RJM 4, Franz EA 3, Robertson SP 4, Jasoni CL 1 Supplementary
Nuclear Organization and Gene Expression Dr. David L. Spector
NUCLEAR ORGANIZATION AND GENE EXPRESSION David L. Spector, Ph.D. Cold Spring Harbor Laboratory One Bungtown Road Cold Spring Harbor, New York 11724 Visit our website at www.cshl.edu/spectorlab 1 Orphanides
Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA.
Summary of Supplemental Information Figure S1: NUN preparation yields nascent, unadenylated RNA with a different profile from Total RNA. Figure S2: rrna removal procedure is effective for clearing out
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin
Fig. S1. Endocytosis of extracellular cargo does not depend on dia. (A) To visualize endocytosis, fluorescently labelled wheat germ agglutinin (WGA-Alexa555) was injected into the extracellular perivitteline