Minor Introns vs Major Introns
|
|
- Brendan Mills
- 5 years ago
- Views:
Transcription
1 .... Minor Introns vs Major Introns Sebastian Bartschat Bioinformatics, Leipzig October 2009
2 table of content...1 introduction...2 two different types...3 classification of minor introns...4 results
3 reminder non-coding regions, interrupting two exons most genes in higher eukaryotes contain introns intron removal and ligation of 2 consecutive exons is called splicing 2 trans-esterifications carried out by the spliceosome
4 reminder non-coding regions, interrupting two exons most genes in higher eukaryotes contain introns intron removal and ligation of 2 consecutive exons is called splicing 2 trans-esterifications carried out by the spliceosome
5 major introns (U2-dependent) found in all eukaryotes excision is dependent on U2 snrna poly-pyrimidine tract upstream of 3 splice site more degenerate splice site signals GT-AG, AT-AC and GC-AG
6 minor introns (U12-dependent) found in plants and most metazoan taxa no evidence found in simple eukaryotes like S.cerevisiae, C.elegans or protists excision of minor introns is dependent on U12 snrna frequency in vertebrates in the range of % conserved splice site sequences lack of poly-pyrimidine tract GT-AG, AT-AC, other RT-AN (R is purine, N is any nucleotide)
7 comparison Steitz et al. [3]
8 Steitz et al. [3]
9 getting started focusing on T.spiralis and C.elegans using ESTs and BLAST to get possible splice sites
10 getting started focusing on T.spiralis and C.elegans using ESTs and BLAST to get possible splice sites GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTT TGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTT TTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT PWMs to determine the correct splice site frequency matrices were used for classification
11 intron scoring 12 P5 U ss (X ) = px i i, with U either U2 or U12 i=0 P U bps (X ) calculated for each 13nt segment in the range of (-40, -5) upstream of 3 ss
12 intron scoring 12 P5 U ss (X ) = px i i, with U either U2 or U12 i=0 Pbps U (X ) calculated for each 13nt segment in the range of (-40, -5) upstream of 3 ss computation of log-odd ratios ( ) ( P L 5 ss = log U12 5 ss 2 and L bps = log 2 P U2 5 ss P U12 bps P U2 bps transformation into z-scores S 5 ss and S bps by subtracting the sample mean an dividing by the standard deviation )
13 separation often there is no obvious cluster same importance of 5 splice site and branch site usage of a reference set of 27 minor introns [1] minimum values of their 5 ss and branch site scores as appropriate threshold
14 finding homologous introns..1 identifying the T.spiralis genes containing minor introns..2 homology search using BLASTX for detection of C.elegans proteins..3 reconstruction of genomic structure with TBLASTN..4 analysing the introns (with respect to their positions and types)
15 discrimination of introns of T.spiralis 6 4 burge (control) gt-ag type at-ac type gc-ag type branch site score splice site score
16 evolution of introns loss of intron conversion to U2 introns shift of splice sites, including a change of type
17 references C B Burge, R A Padgett, and P A Sharp. Evolutionary fates and origins of u12-type introns. Mol Cell, 2(6):773 85, Dec M Dávila López, M A Rosenblad, and T Samuelsson. Computational screen for spliceosomal rna genes aids in defining the phylogenetic distribution of major and minor spliceosomal components. Nucleic Acids Res, 36(9): , May A A Patel and J A Steitz. Splicing double: insights from the second spliceosome. Nat Rev Mol Cell Biol, 4(12):960 70, Dec N Sheth, X Roca, M L Hastings, T Roeder, A R Krainer, and R Sachidanandam. Comprehensive splice-site analysis using comparative genomics. Nucleic Acids Res, 34(14): , 2006.
18 the end Thank you for your attention!
Using profiles based on hydropathy properties to define essential regions for splicing.
Using profiles based on hydropathy properties to define essential regions for splicing. Anatoly Ivashchenko 1, Galina Boldina 1, Aizhan Turmagambetova 1, Mireille Régnier 2 1 - KazNU named after al-farabi-
More informationGene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
More informationInvited Re vie W. Mechanisms of pre-mrna splicing: classical versus non-classical pathways. Histology and Histo pathology
Histol Histopathol (1998) 13: 585-589 Histology and Histo pathology Invited Re vie W Mechanisms of pre-mrna splicing: classical versus non-classical pathways P.G. Zaphiropoulos Department of Bioscience,
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationIntron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon
JOURNAL OF VIROLOGY, Mar. 1998, p. 1834 1843 Vol. 72, No. 3 0022-538X/98/$04.00 0 Copyright 1998, American Society for Microbiology Intron Definition Is Required for Excision of the Minute Virus of Mice
More informationSequence Based Function Annotation
Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More information9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3
cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationHUMAN GENOME BIOINFORMATICS. Tore Samuelsson, Dec 2009
HUMAN GENOME BIOINFORMATICS Tore Samuelsson, Dec 2009 The sequenced (gray filled) and unsequenced (white) portions of the human genome. Peter F.R. Little Genome Res. 2005; 15: 1759-1766 Human genome organisation
More informationOutline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
More informationSequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing
Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationCreation of a PAM matrix
Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationDistribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis
Nucleic Acids Research, Vol., No. 5 Distribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis Nomi L.Harris and Periannan Senapathy * Laboratory for Computer
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationWednesday, November 22, 17. Exons and Introns
Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More informationThe Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
More informationGene splice sites correlate with nucleosome positions
Gene splice sites correlate with nucleosome positions Simon Kogan and Edward N. Trifonov* Genome Diversity Center, Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel Abstract
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More informationMutation Rates and Sequence Changes
s and Sequence Changes part of Fortgeschrittene Methoden in der Bioinformatik Computational EvoDevo University Leipzig Leipzig, WS 2011/12 From Molecular to Population Genetics molecular level substitution
More informationGenome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
More informationGenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs
Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994
More informationBioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University
Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationInternational Journal of Integrative Biology A journal for biology beyond borders ISSN
Report International Journal of Integrative Biology A journal for biology beyond borders ISSN 0973-8363 Genome architecture - number, size and length distributions of exons and introns in six crown eukaryotic
More informationDNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
More informationGene Prediction 10/21/05
Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationIntroduction to Bioinformatics Online Course: IBT
Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec5: Interpreting your MSA Using Logos Using Logos - Logos are a terrific way to generate
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationFile S1. Program overview and features
File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically
More informationComparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationIdenti cation, characterization and molecular phylogeny of U12-dependent introns in the Arabidopsis thaliana genome
Identi cation, characterization and molecular phylogeny of U12-dependent introns in the Arabidopsis thaliana genome Wei Zhu 1, * and Volker Brendel 1,2 Nucleic Acids Research, 2003, Vol. 31, No. 15 4561±4572
More informationOutline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
More informationGene Expression: Transcription
Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationAnnotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
More informationThe Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More informationTranscription & post transcriptional modification
Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity
More informationCS313 Exercise 1 Cover Page Fall 2017
CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationImproved Splice Site Detection in Genie
Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory MGReese@lbl.gov http://www-hgc.lbl.gov/inf Santa Fe, 1/23/97 Database Homologies
More informationIntroduction to Cellular Biology and Bioinformatics. Farzaneh Salari
Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...
More informationProtein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)
Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical
More informationCONSTRUCTIVE INDUCTION IN BIO-SEQUENCES
Key words bioinformatics, DNA, classification Rafał BIEDRZYCKI, Jarosław ARABAS + CONSTRUCTIVE INDUCTION IN BIO-SEQUENCES This paper is devoted to analysis of DNA sequences. The aim of the analysis is
More informationBranches of Genetics
Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,
More informationComputational gene finding
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More informationIntegrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley
Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler January 29, 2018. Molecular Data I: General introduction; types of molecular data (DNA
More informationBS 50 Genetics and Genomics Week of Oct 24
BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed
More informationBi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,
Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationComputational gene finding. Devika Subramanian Comp 470
Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative
More information132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationRegulation of eukaryotic transcription:
Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:
More informationM1 - Biochemistry. Nucleic Acid Structure II/Transcription I
M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.
More informationGrundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas
ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences
More informationBIOINFORMATICS TO ANALYZE AND COMPARE GENOMES
BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationEukaryotic Gene Structure
Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationDNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences
DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,
More informationGene Prediction Background & Strategy Faction 2 February 22, 2017
Gene Prediction Background & Strategy Faction 2 February 22, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee Introduction
More informationGenome 373: Hidden Markov Models III. Doug Fowler
Genome 373: Hidden Markov Models III Doug Fowler Review from Hidden Markov Models I and II We talked about two decoding algorithms last time. What is meant by decoding? Review from Hidden Markov Models
More informationRelationship of Gene s Types and Introns
Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution
More informationBasic Local Alignment Search Tool
14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationThe 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.
RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationREGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes
REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation
More informationGUCUUCUUAGUAUACAAAGGGAUUGAGGAUGAAAAAGGAAAAUCCUUUUCUCAAACCUCAUUUGUUGGAC GGGACGUCCAGCAACCACUUUGUGUAACCCAAGUAUUCUUUUUAUAUUCAGUGCUGCGAAGGAAAAGGUG
A + AAACAAGAACCAGAAUCCCAGUUUCAAGAAGAAUUAUGAGGAGUUUGGUUUUAUGAUUCUUUAGGGCUUA 0 76 2 CAUGGAAAGUCGAAUAACGCAAGGAAGAAAAGUUUGAAUGGUGUUUAUGAUUUGAUGUUUGCAGUAUACU GUCUUCUUAGUAUACAAAGGGAUUGAGGAUGAAAAAGGAAAAUCCUUUUCUCAAACCUCAUUUGUUGGAC
More informationThe String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.
Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif
More informationBiol 478/595 Intro to Bioinformatics
Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More informationLecture 5: Regulation
Machine Learning in Computational Biology CSC 2431 Lecture 5: Regulation Instructor: Anna Goldenberg Central Dogma of Biology Transcription DNA RNA protein Process of producing RNA from DNA Constitutive
More informationLecture 10. Ab initio gene finding
Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review
More information