Minor Introns vs Major Introns

Size: px
Start display at page:

Download "Minor Introns vs Major Introns"

Transcription

1 .... Minor Introns vs Major Introns Sebastian Bartschat Bioinformatics, Leipzig October 2009

2 table of content...1 introduction...2 two different types...3 classification of minor introns...4 results

3 reminder non-coding regions, interrupting two exons most genes in higher eukaryotes contain introns intron removal and ligation of 2 consecutive exons is called splicing 2 trans-esterifications carried out by the spliceosome

4 reminder non-coding regions, interrupting two exons most genes in higher eukaryotes contain introns intron removal and ligation of 2 consecutive exons is called splicing 2 trans-esterifications carried out by the spliceosome

5 major introns (U2-dependent) found in all eukaryotes excision is dependent on U2 snrna poly-pyrimidine tract upstream of 3 splice site more degenerate splice site signals GT-AG, AT-AC and GC-AG

6 minor introns (U12-dependent) found in plants and most metazoan taxa no evidence found in simple eukaryotes like S.cerevisiae, C.elegans or protists excision of minor introns is dependent on U12 snrna frequency in vertebrates in the range of % conserved splice site sequences lack of poly-pyrimidine tract GT-AG, AT-AC, other RT-AN (R is purine, N is any nucleotide)

7 comparison Steitz et al. [3]

8 Steitz et al. [3]

9 getting started focusing on T.spiralis and C.elegans using ESTs and BLAST to get possible splice sites

10 getting started focusing on T.spiralis and C.elegans using ESTs and BLAST to get possible splice sites GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTT TGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTT TTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT PWMs to determine the correct splice site frequency matrices were used for classification

11 intron scoring 12 P5 U ss (X ) = px i i, with U either U2 or U12 i=0 P U bps (X ) calculated for each 13nt segment in the range of (-40, -5) upstream of 3 ss

12 intron scoring 12 P5 U ss (X ) = px i i, with U either U2 or U12 i=0 Pbps U (X ) calculated for each 13nt segment in the range of (-40, -5) upstream of 3 ss computation of log-odd ratios ( ) ( P L 5 ss = log U12 5 ss 2 and L bps = log 2 P U2 5 ss P U12 bps P U2 bps transformation into z-scores S 5 ss and S bps by subtracting the sample mean an dividing by the standard deviation )

13 separation often there is no obvious cluster same importance of 5 splice site and branch site usage of a reference set of 27 minor introns [1] minimum values of their 5 ss and branch site scores as appropriate threshold

14 finding homologous introns..1 identifying the T.spiralis genes containing minor introns..2 homology search using BLASTX for detection of C.elegans proteins..3 reconstruction of genomic structure with TBLASTN..4 analysing the introns (with respect to their positions and types)

15 discrimination of introns of T.spiralis 6 4 burge (control) gt-ag type at-ac type gc-ag type branch site score splice site score

16 evolution of introns loss of intron conversion to U2 introns shift of splice sites, including a change of type

17 references C B Burge, R A Padgett, and P A Sharp. Evolutionary fates and origins of u12-type introns. Mol Cell, 2(6):773 85, Dec M Dávila López, M A Rosenblad, and T Samuelsson. Computational screen for spliceosomal rna genes aids in defining the phylogenetic distribution of major and minor spliceosomal components. Nucleic Acids Res, 36(9): , May A A Patel and J A Steitz. Splicing double: insights from the second spliceosome. Nat Rev Mol Cell Biol, 4(12):960 70, Dec N Sheth, X Roca, M L Hastings, T Roeder, A R Krainer, and R Sachidanandam. Comprehensive splice-site analysis using comparative genomics. Nucleic Acids Res, 34(14): , 2006.

18 the end Thank you for your attention!

Using profiles based on hydropathy properties to define essential regions for splicing.

Using profiles based on hydropathy properties to define essential regions for splicing. Using profiles based on hydropathy properties to define essential regions for splicing. Anatoly Ivashchenko 1, Galina Boldina 1, Aizhan Turmagambetova 1, Mireille Régnier 2 1 - KazNU named after al-farabi-

More information

Gene Prediction in Eukaryotes

Gene Prediction in Eukaryotes Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene

More information

EECS730: Introduction to Bioinformatics

EECS730: Introduction to Bioinformatics EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt

More information

Invited Re vie W. Mechanisms of pre-mrna splicing: classical versus non-classical pathways. Histology and Histo pathology

Invited Re vie W. Mechanisms of pre-mrna splicing: classical versus non-classical pathways. Histology and Histo pathology Histol Histopathol (1998) 13: 585-589 Histology and Histo pathology Invited Re vie W Mechanisms of pre-mrna splicing: classical versus non-classical pathways P.G. Zaphiropoulos Department of Bioscience,

More information

Lecture 7 Motif Databases and Gene Finding

Lecture 7 Motif Databases and Gene Finding Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC

More information

Gene Identification in silico

Gene Identification in silico Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction

More information

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)

Genome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA

More information

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon

Intron Definition Is Required for Excision of the Minute Virus of Mice Small Intron and Definition of the Upstream Exon JOURNAL OF VIROLOGY, Mar. 1998, p. 1834 1843 Vol. 72, No. 3 0022-538X/98/$04.00 0 Copyright 1998, American Society for Microbiology Intron Definition Is Required for Excision of the Minute Virus of Mice

More information

Sequence Based Function Annotation

Sequence Based Function Annotation Sequence Based Function Annotation Qi Sun Bioinformatics Facility Biotechnology Resource Center Cornell University Sequence Based Function Annotation 1. Given a sequence, how to predict its biological

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Computational gene finding

Computational gene finding Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3

9/19/13. cdna libraries, EST clusters, gene prediction and functional annotation. Biosciences 741: Genomics Fall, 2013 Week 3 cdna libraries, EST clusters, gene prediction and functional annotation Biosciences 741: Genomics Fall, 2013 Week 3 1 2 3 4 5 6 Figure 2.14 Relationship between gene structure, cdna, and EST sequences

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

HUMAN GENOME BIOINFORMATICS. Tore Samuelsson, Dec 2009

HUMAN GENOME BIOINFORMATICS. Tore Samuelsson, Dec 2009 HUMAN GENOME BIOINFORMATICS Tore Samuelsson, Dec 2009 The sequenced (gray filled) and unsequenced (white) portions of the human genome. Peter F.R. Little Genome Res. 2005; 15: 1759-1766 Human genome organisation

More information

Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation

Outline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project

More information

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing

Sequence Analysis. II: Sequence Patterns and Matrices. George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Analysis II: Sequence Patterns and Matrices George Bell, Ph.D. WIBR Bioinformatics and Research Computing Sequence Patterns and Matrices Multiple sequence alignments Sequence patterns Sequence

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

Creation of a PAM matrix

Creation of a PAM matrix Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Distribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis

Distribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis Nucleic Acids Research, Vol., No. 5 Distribution and consensus of branch point signals in eukaryotic genes: a computerized statistical analysis Nomi L.Harris and Periannan Senapathy * Laboratory for Computer

More information

Array-Ready Oligo Set for the Rat Genome Version 3.0

Array-Ready Oligo Set for the Rat Genome Version 3.0 Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.

More information

Wednesday, November 22, 17. Exons and Introns

Wednesday, November 22, 17. Exons and Introns Exons and Introns Introns and Exons Exons: coded regions of DNA that get transcribed and translated into proteins make up 5% of the genome Introns and Exons Introns: non-coded regions of DNA Must be removed

More information

MATH 5610, Computational Biology

MATH 5610, Computational Biology MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class

More information

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot

The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino

More information

Gene splice sites correlate with nucleosome positions

Gene splice sites correlate with nucleosome positions Gene splice sites correlate with nucleosome positions Simon Kogan and Edward N. Trifonov* Genome Diversity Center, Institute of Evolution, University of Haifa, Mount Carmel, Haifa 31905, Israel Abstract

More information

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010

Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact

More information

Chapter 6: Transcription and RNA Processing in Eukaryotes

Chapter 6: Transcription and RNA Processing in Eukaryotes 3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation

More information

Mutation Rates and Sequence Changes

Mutation Rates and Sequence Changes s and Sequence Changes part of Fortgeschrittene Methoden in der Bioinformatik Computational EvoDevo University Leipzig Leipzig, WS 2011/12 From Molecular to Population Genetics molecular level substitution

More information

Genome annotation & EST

Genome annotation & EST Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary

More information

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs

GenBank Growth. In 2003 ~ 31 million sequences ~ 37 billion base pairs Gene Finding GenBank Growth GenBank Growth In 2003 ~ 31 million sequences ~ 37 billion base pairs GenBank: Exponential Growth Growth of GenBank in billions of base pairs from release 3 in April of 1994

More information

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University

Bioinformatics: Sequence Analysis. COMP 571 Luay Nakhleh, Rice University Bioinformatics: Sequence Analysis COMP 571 Luay Nakhleh, Rice University Course Information Instructor: Luay Nakhleh (nakhleh@rice.edu); office hours by appointment (office: DH 3119) TA: Leo Elworth (DH

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

International Journal of Integrative Biology A journal for biology beyond borders ISSN

International Journal of Integrative Biology A journal for biology beyond borders ISSN Report International Journal of Integrative Biology A journal for biology beyond borders ISSN 0973-8363 Genome architecture - number, size and length distributions of exons and introns in six crown eukaryotic

More information

DNA makes RNA makes Proteins. The Central Dogma

DNA makes RNA makes Proteins. The Central Dogma DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION

More information

Gene Prediction 10/21/05

Gene Prediction 10/21/05 Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Introduction to Bioinformatics Online Course: IBT

Introduction to Bioinformatics Online Course: IBT Introduction to Bioinformatics Online Course: IBT Multiple Sequence Alignment Building Multiple Sequence Alignment Lec5: Interpreting your MSA Using Logos Using Logos - Logos are a terrific way to generate

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

File S1. Program overview and features

File S1. Program overview and features File S1 Program overview and features Query list filtering. Further filtering may be applied through user selected query lists (Figure. 2B, Table S3) that restrict the results and/or report specifically

More information

Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.

Comparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs. Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Identi cation, characterization and molecular phylogeny of U12-dependent introns in the Arabidopsis thaliana genome

Identi cation, characterization and molecular phylogeny of U12-dependent introns in the Arabidopsis thaliana genome Identi cation, characterization and molecular phylogeny of U12-dependent introns in the Arabidopsis thaliana genome Wei Zhu 1, * and Volker Brendel 1,2 Nucleic Acids Research, 2003, Vol. 31, No. 15 4561±4572

More information

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions

Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson

More information

Gene Expression: Transcription

Gene Expression: Transcription Gene Expression: Transcription The majority of genes are expressed as the proteins they encode. The process occurs in two steps: Transcription = DNA RNA Translation = RNA protein Taken together, they make

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

Annotating the Genome (H)

Annotating the Genome (H) Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What

More information

The Central Dogma. DNA makes RNA makes Proteins

The Central Dogma. DNA makes RNA makes Proteins The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF

More information

Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.

Annotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six

More information

Transcription & post transcriptional modification

Transcription & post transcriptional modification Transcription & post transcriptional modification Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be transferred from DNA to RNA Similarity

More information

CS313 Exercise 1 Cover Page Fall 2017

CS313 Exercise 1 Cover Page Fall 2017 CS313 Exercise 1 Cover Page Fall 2017 Due by the start of class on Monday, September 18, 2017. Name(s): In the TIME column, please estimate the time you spent on the parts of this exercise. Please try

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

Lesson Overview. Fermentation 13.1 RNA

Lesson Overview. Fermentation 13.1 RNA 13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA

More information

Improved Splice Site Detection in Genie

Improved Splice Site Detection in Genie Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory MGReese@lbl.gov http://www-hgc.lbl.gov/inf Santa Fe, 1/23/97 Database Homologies

More information

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari

Introduction to Cellular Biology and Bioinformatics. Farzaneh Salari Introduction to Cellular Biology and Bioinformatics Farzaneh Salari Outline Bioinformatics Cellular Biology A Bioinformatics Problem What is bioinformatics? Computer Science Statistics Bioinformatics Mathematics...

More information

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl)

Protein Sequence Analysis. BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Protein Sequence Analysis BME 110: CompBio Tools Todd Lowe April 19, 2007 (Slide Presentation: Carol Rohl) Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical

More information

CONSTRUCTIVE INDUCTION IN BIO-SEQUENCES

CONSTRUCTIVE INDUCTION IN BIO-SEQUENCES Key words bioinformatics, DNA, classification Rafał BIEDRZYCKI, Jarosław ARABAS + CONSTRUCTIVE INDUCTION IN BIO-SEQUENCES This paper is devoted to analysis of DNA sequences. The aim of the analysis is

More information

Branches of Genetics

Branches of Genetics Branches of Genetics 1. Transmission genetics Classical genetics or Mendelian genetics 2. Molecular genetics chromosomes, DNA, regulation of gene expression recombinant DNA, biotechnology, bioinformatics,

More information

Computational gene finding

Computational gene finding Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) Lec 1 Lec 2 Lec 3 The biological context Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley

Integrative Biology 200 PRINCIPLES OF PHYLOGENETICS Spring 2018 University of California, Berkeley Integrative Biology 200 "PRINCIPLES OF PHYLOGENETICS" Spring 2018 University of California, Berkeley B.D. Mishler January 29, 2018. Molecular Data I: General introduction; types of molecular data (DNA

More information

BS 50 Genetics and Genomics Week of Oct 24

BS 50 Genetics and Genomics Week of Oct 24 BS 50 Genetics and Genomics Week of Oct 24 Additional Practice Problems for Section Question 1: The following table contains a list of statements that apply to replication, transcription, both, or neither.

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 12 Transcription BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 12 Transcription 2 3 4 5 Are You Getting It?? Which are general characteristics of transcription? (multiple answers) a) An entire DNA molecule is transcribed

More information

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , ,

Bi 8 Lecture 18. Ellen Rothenberg 3 March Read: Alberts et al.: Chapter 6, pp , , Bi 8 Lecture 18 Other RNAs as regulators and RNAs as enzymes Ellen Rothenberg 3 March 2016 Read: Alberts et al.: Chapter 6, pp. 317-324, 346-347, 362-366 RNA is more than a protein coding molecule RNA

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

Computational gene finding. Devika Subramanian Comp 470

Computational gene finding. Devika Subramanian Comp 470 Computational gene finding Devika Subramanian Comp 470 Outline (3 lectures) The biological context Lec 1 Lec 2 Lec 3 Markov models and Hidden Markov models Ab-initio methods for gene finding Comparative

More information

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:

132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading: 132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

Regulation of eukaryotic transcription:

Regulation of eukaryotic transcription: Promoter definition by mass genome annotation data: in silico primer extension EMBNET course Bioinformatics of transcriptional regulation Jan 28 2008 Christoph Schmid Regulation of eukaryotic transcription:

More information

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I

M1 - Biochemistry. Nucleic Acid Structure II/Transcription I M1 - Biochemistry Nucleic Acid Structure II/Transcription I PH Ratz, PhD (Resources: Lehninger et al., 5th ed., Chapters 8, 24 & 26) 1 Nucleic Acid Structure II/Transcription I Learning Objectives: 1.

More information

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:

Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading: Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel

More information

ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas

ORTHOMINE - A dataset of Drosophila core promoters and its analysis. Sumit Middha Advisor: Dr. Peter Cherbas ORTHOMINE - A dataset of Drosophila core promoters and its analysis Sumit Middha Advisor: Dr. Peter Cherbas Introduction Challenges and Motivation D melanogaster Promoter Dataset Expanding promoter sequences

More information

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES

BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES BIOINFORMATICS TO ANALYZE AND COMPARE GENOMES We sequenced and assembled a genome, but this is only a long stretch of ATCG What should we do now? 1. find genes What are the starting and end points for

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

Eukaryotic Gene Structure

Eukaryotic Gene Structure Eukaryotic Gene Structure Terminology Genome entire genetic material of an individual Transcriptome set of transcribed sequences Proteome set of proteins encoded by the genome 2 Gene Basic physical and

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences

DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences DNAFSMiner: A Web-Based Software Toolbox to Recognize Two Types of Functional Sites in DNA Sequences Huiqing Liu Hao Han Jinyan Li Limsoon Wong Institute for Infocomm Research, 21 Heng Mui Keng Terrace,

More information

Gene Prediction Background & Strategy Faction 2 February 22, 2017

Gene Prediction Background & Strategy Faction 2 February 22, 2017 Gene Prediction Background & Strategy Faction 2 February 22, 2017 Group Members: Michelle Kim Khushbu Patel Krithika Xinrui Zhou Chen Lin Sujun Zhao Hannah Hatchell rohini mopuri Jack Cartee Introduction

More information

Genome 373: Hidden Markov Models III. Doug Fowler

Genome 373: Hidden Markov Models III. Doug Fowler Genome 373: Hidden Markov Models III Doug Fowler Review from Hidden Markov Models I and II We talked about two decoding algorithms last time. What is meant by decoding? Review from Hidden Markov Models

More information

Relationship of Gene s Types and Introns

Relationship of Gene s Types and Introns Chi To BME 230 Final Project Relationship of Gene s Types and Introns Abstract: The relationship in gene ontology classification and the modification of the length of introns through out the evolution

More information

Basic Local Alignment Search Tool

Basic Local Alignment Search Tool 14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange.

The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. RNA PROCESSING The 5' cap (red) is added before synthesis of the primary transcript is complete. A non coding sequence following the last exon is shown in orange. Splicing can occur either before or after

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes

REGULATION OF PROTEIN SYNTHESIS. II. Eukaryotes REGULATION OF PROTEIN SYNTHESIS II. Eukaryotes Complexities of eukaryotic gene expression! Several steps needed for synthesis of mrna! Separation in space of transcription and translation! Compartmentation

More information

GUCUUCUUAGUAUACAAAGGGAUUGAGGAUGAAAAAGGAAAAUCCUUUUCUCAAACCUCAUUUGUUGGAC GGGACGUCCAGCAACCACUUUGUGUAACCCAAGUAUUCUUUUUAUAUUCAGUGCUGCGAAGGAAAAGGUG

GUCUUCUUAGUAUACAAAGGGAUUGAGGAUGAAAAAGGAAAAUCCUUUUCUCAAACCUCAUUUGUUGGAC GGGACGUCCAGCAACCACUUUGUGUAACCCAAGUAUUCUUUUUAUAUUCAGUGCUGCGAAGGAAAAGGUG A + AAACAAGAACCAGAAUCCCAGUUUCAAGAAGAAUUAUGAGGAGUUUGGUUUUAUGAUUCUUUAGGGCUUA 0 76 2 CAUGGAAAGUCGAAUAACGCAAGGAAGAAAAGUUUGAAUGGUGUUUAUGAUUUGAUGUUUGCAGUAUACU GUCUUCUUAGUAUACAAAGGGAUUGAGGAUGAAAAAGGAAAAUCCUUUUCUCAAACCUCAUUUGUUGGAC

More information

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem.

The String Alignment Problem. Comparative Sequence Sizes. The String Alignment Problem. The String Alignment Problem. Dec-82 Oct-84 Aug-86 Jun-88 Apr-90 Feb-92 Nov-93 Sep-95 Jul-97 May-99 Mar-01 Jan-03 Nov-04 Sep-06 Jul-08 May-10 Mar-12 Growth of GenBank 160,000,000,000 180,000,000 Introduction to Bioinformatics Iosif

More information

Biol 478/595 Intro to Bioinformatics

Biol 478/595 Intro to Bioinformatics Biol 478/595 Intro to Bioinformatics September M 1 Labor Day 4 W 3 MG Database Searching Ch. 6 5 F 5 MG Database Searching Hw1 6 M 8 MG Scoring Matrices Ch 3 and Ch 4 7 W 10 MG Pairwise Alignment 8 F 12

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

Textbook Reading Guidelines

Textbook Reading Guidelines Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science

More information

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.

Question 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences. Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or

More information

Lecture 5: Regulation

Lecture 5: Regulation Machine Learning in Computational Biology CSC 2431 Lecture 5: Regulation Instructor: Anna Goldenberg Central Dogma of Biology Transcription DNA RNA protein Process of producing RNA from DNA Constitutive

More information

Lecture 10. Ab initio gene finding

Lecture 10. Ab initio gene finding Lecture 10 Ab initio gene finding Uses of probabilistic sequence Segmentation models/hmms Multiple alignment using profile HMMs Prediction of sequence function (gene family models) ** Gene finding ** Review

More information