DNA makes RNA makes Proteins. The Central Dogma

Size: px
Start display at page:

Download "DNA makes RNA makes Proteins. The Central Dogma"

Transcription

1 DNA makes RNA makes Proteins The Central Dogma

2 TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF INITIATION COMPLEX Amino acid trna AMINO ACID ACTIVATION A mrna Growing polypeptide Activated amino acid E P Ribosomal subunits TRANSLATION E A Anticodon Codon Ribosome

3 The Central Dogma DNA makes RNA makes Proteins

4 Transcription DNA --> RNA requires RNA polymerase enzyme three types (in Euk) [IB: you don t need to know the differences] RNAp II makes mrna RNAp extends new RNA in 5-3 (other RNA types in mito, chloro) reads template strand DNA 3 -> 5 adds nucleotides to the 3 end of growing RNA Initiation, Elongation, Termination...

5 Transcription Initiation In euk, initiation factors mediate RNAp binding after RNAp binds: transcription initiation complex How does the RNAp know which strand to copy? RNAp attaches to a promoter region Elongation dbl helix re-bonds upstream of RNAp multiple RNAp mols can operate on same gene at same time Termination RNAp stops at end of terminator

6 Topic 7.2: Transcription and Gene Expression Understandings (overview) 1.Transcription occurs in a 5 to 3 direction 2.Nucleosomes help to regulate transcription in eukaryotes 3.Eukaryotic cells modify mrna after transcription 4.Splicing of mrna increases the number of different proteins an organism can produce 5.Gene expression is regulated by proteins that bind to specific base sequences in DNA 6.The environment of a cell and of an organism has an impact on gene expression

7 Topic 7.2: Transcription and Gene Expression Understandings: 1.Transcription occurs in a 5 to 3 direction nucleoside triphosphates (NTPs) line up opposite their complementary base partner RNA polymerase covalently binds the NTPs (releasing the two additional P) The 5 -phosphate links to the 3 -end of the growing mrna strand THUS: transcription occurs in a 5 3 direction

8 Topic 7.2: Transcription and Gene Expression Understandings: 2.Nucleosomes help to regulate transcription in eukaryotes media: Inheritance, pt 1 & 2 (Radiolab) Methylation Acetylation Adding an acetyl group to the tail neutralizes charge = DNA less tightly coiled and increasing transcription Adding a methyl group to the tail maintains positive charge = DNA more coiled and reducing transcription

9 Topic 7.2: Transcription and Gene Expression Understandings: 3.Eukaryotic cells modify mrna after transcription Three processes: Capping methyl group added to the 5 -end protection against exonucleases ribosome attachment Poly-A tail long chain of adenine nucleotides to the 3 -end helps export from the nucleus splicing introns removed ( intervening introns ) exons fused ( expressed exons")

10 Topic 7.2: Transcription and Gene Expression Understandings: 4.Splicing of mrna increases the number of different proteins an organism can produce

11 Topic 7.2: Transcription and Gene Expression Understandings: 5.Gene expression is regulated by proteins that bind to specific base sequences in DNA Activator proteins bind to enhancer sites Repressor proteins bind to silencer sites

12 Topic 7.2: Transcription and Gene Expression Understandings: 6.The environment of a cell and of an organism has an impact on gene expression

13 Topic 7.2: Transcription and Gene Expression Types of Chromatin: Some DNA = permanently supercoiled, some changes over the life cycle of the cell

14 Topic 7.2: Transcription and Gene Expression Types of Chromatin: Some DNA = permanently supercoiled, some changes over the life cycle of the cell

15 Topic 7.2: Transcription and Gene Expression Understandings: 6.The environment of a cell and of an organism has an impact on gene expression

16 Topic 7.2: Transcription and Gene Expression Skill: Analyze changes in methylation pattern

17 Topic 7.2: Transcription and Gene Expression Skill: Analyze changes in methylation pattern

18 LE 17-7b Elongation RNA polymerase Non-template strand of DNA RNA nucleotides end Direction of transcription ( downstream ) Template strand of DNA Newly made RNA

19 LE 17-7a-1 Promoter Transcription unit Start point DNA RNA polymerase

20 LE 17-7a-2 Promoter Transcription unit Start point RNA polymerase DNA Initiation Unwound DNA RNA transcript Template strand of DNA

21 LE 17-7a-3 Promoter Transcription unit Start point RNA polymerase DNA Initiation 5 Unwound DNA RNA transcript Template strand of DNA Elongation 5 Rewound DNA 5 RNA transcript

22 LE 17-7a-4 Promoter Transcription unit 5 Start point RNA polymerase DNA Initiation 3 Unwound DNA RNA Template strand tran- of DNA script Elongation Rewound DNA RNA transcript Termination Completed RNA transcript

23 RNA editing in prok: transcript is translated directly (except trna, rrna) in euk: modifications in nucleus 5 cap added (modified G) 3 end gets poly-a-tail A-nucleotides

24 RNA editing, cont d in cytoplasm: RNA splicing avg transcript = 10,000bp. Avg prot = 400aa. (8800bp cut!) introns cut out, exons joined cut & splice by: spliceosome = prot + small nuclear ribonucleoproteins (snrnps) ( snurps ) Protein RNA transcript (pre-mrna) Exon 1 Intron Exon 2 snrna snrnps Spliceosome Other proteins Why are introns a good thing? alternative splicing regulatory introns (mirna) Spliceosome components mrna Exon 1 Exon 2 Cut-out intron

25 LE DNA Gene Exon 1 Intron Exon 2 Intron Exon 3 Transcription RNA processing Translation Domain 3 Domain 2 Domain 1 Polypeptide

26 Translation trna is the translator process mediated by ribosome large, small subunits proteins + rrna (most abundant RNA) trna deposits a.a., codon by codon ribosome joins a.a. s into polypeptide 45 different trna s; why not 64? wobble third base in codon doesn t have to match ex: U match with A or G thus: more than one codon can code for same a.a ex: ACA, ACU, ACC, ACG all code for Thr

27 Ribosomes during initiation: start codon attracts initiator trna w/ Met sm subunit attaches to mrna sm subunit moves downstream lg subunit attaches three sites: A: holds trna w/ next a.a for growing chain P: hold trna carrying the growing chain E: ejection seat for trna ribosome = big ribozyme hydrolysis of GTP supplies E continues until stop codon reached

28 Translate this: AUG,GAG,GAA,AUA,GAU,UGA AUG,GUG,GAA,AUA,GAU,UGA AUG,GGG,AAA,UAG,AUU,GA AUG,GCA,GGA,AAU,AGA,UUG,A

29 TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF INITIATION COMPLEX Amino acid trna AMINO ACID ACTIVATION A mrna Growing polypeptide Activated amino acid E P Ribosomal subunits TRANSLATION E A Anticodon Codon Ribosome

30 Ribozymes RNA: more than DNA message H-bond to other nucleic acids form 3-D structure by self-bonding contains functional catalytic groups Ribozymes: def = RNA molecules catalyzing a chem rxn ribozymes catalyze their own cleavage, and even their own synthesis RNA can store, transmit, and duplicate genetic info also regulate gene expression snrna, sirna, mirna RNA nucleotides have been made spontaneously in lab Key to origin of life?

31 The End

32 DNA Review

33 DNA/RNA Review Scientists DNA structure bases nucleotides diagram DNA replication = semi-conservative RNA vs DNA RNA functions (r,t,m) transcription sense strand regulation of transcription promoter causes RNA polymerase to bind prokaryotes: introns introns/exons reverse transcriptase (Ch 18; HIV, cdna & mol bio) translation initiation, elongation, termination

The Central Dogma. DNA makes RNA makes Proteins

The Central Dogma. DNA makes RNA makes Proteins The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF

More information

Transcription is the first stage of gene expression

Transcription is the first stage of gene expression Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the

More information

From Gene to Protein. Chapter 17

From Gene to Protein. Chapter 17 From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.

More information

Review of Protein (one or more polypeptide) A polypeptide is a long chain of..

Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic

More information

Gene Expression: Transcription, Translation, RNAs and the Genetic Code

Gene Expression: Transcription, Translation, RNAs and the Genetic Code Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a

More information

Ch. 10 From DNA to Protein. AP Biology

Ch. 10 From DNA to Protein. AP Biology Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene

More information

CH 17 :From Gene to Protein

CH 17 :From Gene to Protein CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there

More information

DNA Function: Information Transmission

DNA Function: Information Transmission DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living

More information

BIO 311C Spring Lecture 36 Wednesday 28 Apr.

BIO 311C Spring Lecture 36 Wednesday 28 Apr. BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through

More information

I. Gene Expression Figure 1: Central Dogma of Molecular Biology

I. Gene Expression Figure 1: Central Dogma of Molecular Biology I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases

More information

Chapter 12: Molecular Biology of the Gene

Chapter 12: Molecular Biology of the Gene Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,

More information

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code

Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)

More information

The Flow of Genetic Information

The Flow of Genetic Information Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins

More information

Fig Ch 17: From Gene to Protein

Fig Ch 17: From Gene to Protein Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA

More information

Make the protein through the genetic dogma process.

Make the protein through the genetic dogma process. Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino

More information

Chapter 13. From DNA to Protein

Chapter 13. From DNA to Protein Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to

More information

Lecture for Wednesday. Dr. Prince BIOL 1408

Lecture for Wednesday. Dr. Prince BIOL 1408 Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that

More information

Gene function at the level of traits Gene function at the molecular level

Gene function at the level of traits Gene function at the molecular level Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle

More information

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation

FROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded

More information

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall

Biology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related

More information

Transcription steps. Transcription steps. Eukaryote RNA processing

Transcription steps. Transcription steps. Eukaryote RNA processing Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates

More information

Transcription and Post Transcript Modification

Transcription and Post Transcript Modification Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline

More information

RNA : functional role

RNA : functional role RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying

More information

From Gene to Protein

From Gene to Protein Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp

More information

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,

From Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons, From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes

More information

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein

PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made

More information

Chapter 17. From Gene to Protein

Chapter 17. From Gene to Protein Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific

More information

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA

Biotechnology Unit 3: DNA to Proteins. From DNA to RNA From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of

More information

Genes and How They Work. Chapter 15

Genes and How They Work. Chapter 15 Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central

More information

8/21/2014. From Gene to Protein

8/21/2014. From Gene to Protein From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information

More information

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.

DNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks. DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program

More information

Transcription in Eukaryotes

Transcription in Eukaryotes Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the

More information

Protein Synthesis Notes

Protein Synthesis Notes Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription

More information

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1

MOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1 AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS

More information

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.

BIOLOGY - CLUTCH CH.17 - GENE EXPRESSION. !! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide

More information

DNA Replication and Repair

DNA Replication and Repair DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands

More information

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.

Transcription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA. Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally

More information

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code

CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template

More information

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!

Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important! Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic

More information

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS

Text Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION

More information

Ch Molecular Biology of the Gene

Ch Molecular Biology of the Gene Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it

More information

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?

Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian

More information

BEADLE & TATUM EXPERIMENT

BEADLE & TATUM EXPERIMENT FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in

More information

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.

DNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,

More information

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis

BIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 13 Protein Synthesis 2 3 4 5 6 7 8 9 10 Are You Getting It?? Which properties are characteristic of the normal genetic code? (multiple answers) a) A

More information

Videos. Lesson Overview. Fermentation

Videos. Lesson Overview. Fermentation Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast

More information

Transcription Eukaryotic Cells

Transcription Eukaryotic Cells Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes

More information

GENETICS - CLUTCH CH.10 TRANSCRIPTION.

GENETICS - CLUTCH CH.10 TRANSCRIPTION. !! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types

More information

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16

The Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16 Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes

More information

Big Idea 3C Basic Review

Big Idea 3C Basic Review Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end

More information

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.

There are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal. 1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine

More information

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O

NUCLEIC ACID METABOLISM. Omidiwura, B.R.O NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid

More information

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work

The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via

More information

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA

Fermentation. Lesson Overview. Lesson Overview 13.1 RNA 13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to

More information

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide

Nucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These

More information

Protein Synthesis ~Biology AP~

Protein Synthesis ~Biology AP~ Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate

More information

Chapter 12. DNA TRANSCRIPTION and TRANSLATION

Chapter 12. DNA TRANSCRIPTION and TRANSLATION Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making

More information

Transcription and Translation

Transcription and Translation Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated

More information

Transcription. DNA to RNA

Transcription. DNA to RNA Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy

More information

Chapter 17 From Gene to Protein

Chapter 17 From Gene to Protein Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits

More information

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang

Delve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11

More information

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology

Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize

More information

PROTEIN SYNTHESIS. copyright cmassengale

PROTEIN SYNTHESIS. copyright cmassengale PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other

More information

From RNA To Protein

From RNA To Protein From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution

More information

Protein Synthesis. DNA to RNA to Protein

Protein Synthesis. DNA to RNA to Protein Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.

More information

CHapter 14. From DNA to Protein

CHapter 14. From DNA to Protein CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino

More information

Gene Expression Transcription/Translation Protein Synthesis

Gene Expression Transcription/Translation Protein Synthesis Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino

More information

Videos. Bozeman Transcription and Translation: Drawing transcription and translation:

Videos. Bozeman Transcription and Translation:   Drawing transcription and translation: Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain

More information

Chapter 14: From DNA to Protein

Chapter 14: From DNA to Protein Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in

More information

The Structure of RNA. The Central Dogma

The Structure of RNA. The Central Dogma 12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait

More information

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.

Feedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions. Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen

More information

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?

Chapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why? Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from

More information

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.

Hello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6. Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)

More information

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318

SCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic

More information

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013

RNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein

More information

Chapters 31-32: Ribonucleic Acid (RNA)

Chapters 31-32: Ribonucleic Acid (RNA) Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine

More information

Chapter 14: Gene Expression: From Gene to Protein

Chapter 14: Gene Expression: From Gene to Protein Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect

More information

Chapter 17: From Gene to Protein

Chapter 17: From Gene to Protein Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master

More information

Computational Biology I LSM5191 (2003/4)

Computational Biology I LSM5191 (2003/4) Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination

More information

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.

Molecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA. Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions

More information

A. Incorrect! This feature does help with it suitability as genetic material.

A. Incorrect! This feature does help with it suitability as genetic material. College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix

More information

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)

Hershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the

More information

Key Area 1.3: Gene Expression

Key Area 1.3: Gene Expression Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?

More information

Replication, Transcription, and Translation

Replication, Transcription, and Translation Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is

More information

Chapter 2. An Introduction to Genes and Genomes

Chapter 2. An Introduction to Genes and Genomes PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents

More information

Frederick Griffith: Transformation Conclusion: bacteria could give other bacteria heritable traits, even after they were dead.

Frederick Griffith: Transformation Conclusion: bacteria could give other bacteria heritable traits, even after they were dead. Frederick Griffith: Transformation 1928 Conclusion: bacteria could give other bacteria heritable traits, even after they were dead. 1 Avery, McCarty & MacLeod: Griffiths Refined (1944) Refined Griffith's

More information

Winter Quarter Midterm Exam

Winter Quarter Midterm Exam 1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned

More information

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!

Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.

More information

Biology A: Chapter 9 Annotating Notes Protein Synthesis

Biology A: Chapter 9 Annotating Notes Protein Synthesis Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side

More information

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)

Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes

More information

7.2 Protein Synthesis. From DNA to Protein Animation

7.2 Protein Synthesis. From DNA to Protein Animation 7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They

More information

TRANSCRIPTION AND PROCESSING OF RNA

TRANSCRIPTION AND PROCESSING OF RNA TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural

More information

Biology 3201 Genetics Unit #5

Biology 3201 Genetics Unit #5 Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process

More information

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression

Unit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,

More information

Bis2A 12.0 Transcription *

Bis2A 12.0 Transcription * OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License

More information

Chapter 6: Transcription and RNA Processing in Eukaryotes

Chapter 6: Transcription and RNA Processing in Eukaryotes 3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation

More information