DNA makes RNA makes Proteins. The Central Dogma
|
|
- Piers Nichols
- 6 years ago
- Views:
Transcription
1 DNA makes RNA makes Proteins The Central Dogma
2 TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF INITIATION COMPLEX Amino acid trna AMINO ACID ACTIVATION A mrna Growing polypeptide Activated amino acid E P Ribosomal subunits TRANSLATION E A Anticodon Codon Ribosome
3 The Central Dogma DNA makes RNA makes Proteins
4 Transcription DNA --> RNA requires RNA polymerase enzyme three types (in Euk) [IB: you don t need to know the differences] RNAp II makes mrna RNAp extends new RNA in 5-3 (other RNA types in mito, chloro) reads template strand DNA 3 -> 5 adds nucleotides to the 3 end of growing RNA Initiation, Elongation, Termination...
5 Transcription Initiation In euk, initiation factors mediate RNAp binding after RNAp binds: transcription initiation complex How does the RNAp know which strand to copy? RNAp attaches to a promoter region Elongation dbl helix re-bonds upstream of RNAp multiple RNAp mols can operate on same gene at same time Termination RNAp stops at end of terminator
6 Topic 7.2: Transcription and Gene Expression Understandings (overview) 1.Transcription occurs in a 5 to 3 direction 2.Nucleosomes help to regulate transcription in eukaryotes 3.Eukaryotic cells modify mrna after transcription 4.Splicing of mrna increases the number of different proteins an organism can produce 5.Gene expression is regulated by proteins that bind to specific base sequences in DNA 6.The environment of a cell and of an organism has an impact on gene expression
7 Topic 7.2: Transcription and Gene Expression Understandings: 1.Transcription occurs in a 5 to 3 direction nucleoside triphosphates (NTPs) line up opposite their complementary base partner RNA polymerase covalently binds the NTPs (releasing the two additional P) The 5 -phosphate links to the 3 -end of the growing mrna strand THUS: transcription occurs in a 5 3 direction
8 Topic 7.2: Transcription and Gene Expression Understandings: 2.Nucleosomes help to regulate transcription in eukaryotes media: Inheritance, pt 1 & 2 (Radiolab) Methylation Acetylation Adding an acetyl group to the tail neutralizes charge = DNA less tightly coiled and increasing transcription Adding a methyl group to the tail maintains positive charge = DNA more coiled and reducing transcription
9 Topic 7.2: Transcription and Gene Expression Understandings: 3.Eukaryotic cells modify mrna after transcription Three processes: Capping methyl group added to the 5 -end protection against exonucleases ribosome attachment Poly-A tail long chain of adenine nucleotides to the 3 -end helps export from the nucleus splicing introns removed ( intervening introns ) exons fused ( expressed exons")
10 Topic 7.2: Transcription and Gene Expression Understandings: 4.Splicing of mrna increases the number of different proteins an organism can produce
11 Topic 7.2: Transcription and Gene Expression Understandings: 5.Gene expression is regulated by proteins that bind to specific base sequences in DNA Activator proteins bind to enhancer sites Repressor proteins bind to silencer sites
12 Topic 7.2: Transcription and Gene Expression Understandings: 6.The environment of a cell and of an organism has an impact on gene expression
13 Topic 7.2: Transcription and Gene Expression Types of Chromatin: Some DNA = permanently supercoiled, some changes over the life cycle of the cell
14 Topic 7.2: Transcription and Gene Expression Types of Chromatin: Some DNA = permanently supercoiled, some changes over the life cycle of the cell
15 Topic 7.2: Transcription and Gene Expression Understandings: 6.The environment of a cell and of an organism has an impact on gene expression
16 Topic 7.2: Transcription and Gene Expression Skill: Analyze changes in methylation pattern
17 Topic 7.2: Transcription and Gene Expression Skill: Analyze changes in methylation pattern
18 LE 17-7b Elongation RNA polymerase Non-template strand of DNA RNA nucleotides end Direction of transcription ( downstream ) Template strand of DNA Newly made RNA
19 LE 17-7a-1 Promoter Transcription unit Start point DNA RNA polymerase
20 LE 17-7a-2 Promoter Transcription unit Start point RNA polymerase DNA Initiation Unwound DNA RNA transcript Template strand of DNA
21 LE 17-7a-3 Promoter Transcription unit Start point RNA polymerase DNA Initiation 5 Unwound DNA RNA transcript Template strand of DNA Elongation 5 Rewound DNA 5 RNA transcript
22 LE 17-7a-4 Promoter Transcription unit 5 Start point RNA polymerase DNA Initiation 3 Unwound DNA RNA Template strand tran- of DNA script Elongation Rewound DNA RNA transcript Termination Completed RNA transcript
23 RNA editing in prok: transcript is translated directly (except trna, rrna) in euk: modifications in nucleus 5 cap added (modified G) 3 end gets poly-a-tail A-nucleotides
24 RNA editing, cont d in cytoplasm: RNA splicing avg transcript = 10,000bp. Avg prot = 400aa. (8800bp cut!) introns cut out, exons joined cut & splice by: spliceosome = prot + small nuclear ribonucleoproteins (snrnps) ( snurps ) Protein RNA transcript (pre-mrna) Exon 1 Intron Exon 2 snrna snrnps Spliceosome Other proteins Why are introns a good thing? alternative splicing regulatory introns (mirna) Spliceosome components mrna Exon 1 Exon 2 Cut-out intron
25 LE DNA Gene Exon 1 Intron Exon 2 Intron Exon 3 Transcription RNA processing Translation Domain 3 Domain 2 Domain 1 Polypeptide
26 Translation trna is the translator process mediated by ribosome large, small subunits proteins + rrna (most abundant RNA) trna deposits a.a., codon by codon ribosome joins a.a. s into polypeptide 45 different trna s; why not 64? wobble third base in codon doesn t have to match ex: U match with A or G thus: more than one codon can code for same a.a ex: ACA, ACU, ACC, ACG all code for Thr
27 Ribosomes during initiation: start codon attracts initiator trna w/ Met sm subunit attaches to mrna sm subunit moves downstream lg subunit attaches three sites: A: holds trna w/ next a.a for growing chain P: hold trna carrying the growing chain E: ejection seat for trna ribosome = big ribozyme hydrolysis of GTP supplies E continues until stop codon reached
28 Translate this: AUG,GAG,GAA,AUA,GAU,UGA AUG,GUG,GAA,AUA,GAU,UGA AUG,GGG,AAA,UAG,AUU,GA AUG,GCA,GGA,AAU,AGA,UUG,A
29 TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF INITIATION COMPLEX Amino acid trna AMINO ACID ACTIVATION A mrna Growing polypeptide Activated amino acid E P Ribosomal subunits TRANSLATION E A Anticodon Codon Ribosome
30 Ribozymes RNA: more than DNA message H-bond to other nucleic acids form 3-D structure by self-bonding contains functional catalytic groups Ribozymes: def = RNA molecules catalyzing a chem rxn ribozymes catalyze their own cleavage, and even their own synthesis RNA can store, transmit, and duplicate genetic info also regulate gene expression snrna, sirna, mirna RNA nucleotides have been made spontaneously in lab Key to origin of life?
31 The End
32 DNA Review
33 DNA/RNA Review Scientists DNA structure bases nucleotides diagram DNA replication = semi-conservative RNA vs DNA RNA functions (r,t,m) transcription sense strand regulation of transcription promoter causes RNA polymerase to bind prokaryotes: introns introns/exons reverse transcriptase (Ch 18; HIV, cdna & mol bio) translation initiation, elongation, termination
The Central Dogma. DNA makes RNA makes Proteins
The Central Dogma DNA makes RNA makes Proteins TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION OF
More informationTranscription is the first stage of gene expression
Transcription is the first stage of gene expression RNA synthesis is catalyzed by RNA polymerase, which pries the DNA strands apart and hooks together the RNA nucleotides The RNA is complementary to the
More informationFrom Gene to Protein. Chapter 17
From Gene to Protein Chapter 17 What you need to know: The key terms: gene expression, transcription, and translation. The major events of transcription. How eukaryotic cells modify RNA after transcription.
More informationReview of Protein (one or more polypeptide) A polypeptide is a long chain of..
Gene expression Review of Protein (one or more polypeptide) A polypeptide is a long chain of.. In a protein, the sequence of amino acid determines its which determines the protein s A protein with an enzymatic
More informationGene Expression: Transcription, Translation, RNAs and the Genetic Code
Lecture 28-29 Gene Expression: Transcription, Translation, RNAs and the Genetic Code Central dogma of molecular biology During transcription, the information in a DNA sequence (a gene) is copied into a
More informationCh. 10 From DNA to Protein. AP Biology
Ch. 10 From DNA to Protein Protein Synthesis Metabolism and Gene Expression n Inheritance of metabolic diseases suggests that genes coded for enzymes n Diseases (phenotypes) caused by non-functional gene
More informationCH 17 :From Gene to Protein
CH 17 :From Gene to Protein Defining a gene gene gene Defining a gene is problematic because one gene can code for several protein products, some genes code only for RNA, two genes can overlap, and there
More informationDNA Function: Information Transmission
DNA Function: Information Transmission DNA is called the code of life. What does it code for? *the information ( code ) to make proteins! Why are proteins so important? Nearly every function of a living
More informationBIO 311C Spring Lecture 36 Wednesday 28 Apr.
BIO 311C Spring 2010 1 Lecture 36 Wednesday 28 Apr. Synthesis of a Polypeptide Chain 5 direction of ribosome movement along the mrna 3 ribosome mrna NH 2 polypeptide chain direction of mrna movement through
More informationI. Gene Expression Figure 1: Central Dogma of Molecular Biology
I. Gene Expression Figure 1: Central Dogma of Molecular Biology Central Dogma: Gene Expression: RNA Structure RNA nucleotides contain the pentose sugar Ribose instead of deoxyribose. Contain the bases
More informationChapter 12: Molecular Biology of the Gene
Biology Textbook Notes Chapter 12: Molecular Biology of the Gene p. 214-219 The Genetic Material (12.1) - Genetic Material must: 1. Be able to store information that pertains to the development, structure,
More informationMolecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code
Molecular Cell Biology - Problem Drill 08: Transcription, Translation and the Genetic Code Question No. 1 of 10 1. Which of the following statements about how genes function is correct? Question #1 (A)
More informationThe Flow of Genetic Information
Chapter 17 The Flow of Genetic Information The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins and of RNA molecules involved in protein synthesis. Proteins
More informationFig Ch 17: From Gene to Protein
Fig. 17-1 Ch 17: From Gene to Protein Basic Principles of Transcription and Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA
More informationMake the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
More informationChapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
More informationLecture for Wednesday. Dr. Prince BIOL 1408
Lecture for Wednesday Dr. Prince BIOL 1408 THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN Copyright 2009 Pearson Education, Inc. Genes are expressed as proteins A gene is a segment of DNA that
More informationGene function at the level of traits Gene function at the molecular level
Gene expression Gene function at the level of traits Gene function at the molecular level Two levels tied together since the molecular level affects the structure and function of cells which determines
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein One Gene One Enzyme Hypothesis Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria Beadle
More informationFROM GENE TO PROTEIN. One Gene One Enzyme Hypothesis 3/12/2013. Basic Principles of Transcription & Translation
One Gene One Enzyme Hypothesis FROM GENE TO PROTEIN C H A P T E R 1 7 Archibald Garrod 1 st to suggest that genes dictate phenotypes through enzymes that catalyze specific chemical reactions ; alkaptonuria
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 Essential Question What is transcription and translation and how do they take place? 3 of 39 12 3 RNA and Protein Synthesis Genes are coded
More informationBiology. Biology. Slide 1 of 39. End Show. Copyright Pearson Prentice Hall
Biology Biology 1 of 39 12-3 RNA and Protein Synthesis 2 of 39 12 3 RNA and Protein Synthesis Genes are coded DNA instructions that control the production of proteins. Genetic messages can be decoded by
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Describe the structure of DNA. What is its elemental makeup? Name the subunit that makes up DNA. What components make up the DNA molecule? How are the two strands related
More informationTranscription steps. Transcription steps. Eukaryote RNA processing
Transcription steps Initiation at 5 end of gene binding of RNA polymerase to promoter unwinding of DNA Elongation addition of nucleotides to 3 end rules of base pairing requires Mg 2+ energy from NTP substrates
More informationTranscription and Post Transcript Modification
Transcription and Post Transcript Modification You Should Be Able To 1. Describe transcription. 2. Compare and contrast eukaryotic + prokaryotic transcription. 3. Explain mrna processing in eukaryotes.
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein Question? How does DNA control a cell? By controlling Protein Synthesis. Proteins are the link between genotype and phenotype. For tests: Name(s) of experimenters Outline
More informationRNA : functional role
RNA : functional role Hamad Yaseen, PhD MLS Department, FAHS Hamad.ali@hsc.edu.kw RNA mrna rrna trna 1 From DNA to Protein -Outline- From DNA to RNA From RNA to Protein From DNA to RNA Transcription: Copying
More informationFrom Gene to Protein
Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp
More informationFrom Gene to Protein transcription, messenger RNA (mrna) translation, RNA processing triplet code, template strand, codons,
From Gene to Protein I. Transcription and translation are the two main processes linking gene to protein. A. RNA is chemically similar to DNA, except that it contains ribose as its sugar and substitutes
More informationPROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein
PROTEIN SYNTHESIS Flow of Genetic Information The flow of genetic information can be symbolized as: DNA RNA Protein This is also known as: The central dogma of molecular biology Protein Proteins are made
More informationChapter 17. From Gene to Protein
Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific
More informationBiotechnology Unit 3: DNA to Proteins. From DNA to RNA
From DNA to RNA Biotechnology Unit 3: DNA to Proteins I. After the discovery of the structure of DNA, the major question remaining was how does the stored in the 4 letter code of DNA direct the and of
More informationGenes and How They Work. Chapter 15
Genes and How They Work Chapter 15 The Nature of Genes They proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes The central
More information8/21/2014. From Gene to Protein
From Gene to Protein Chapter 17 Objectives Describe the contributions made by Garrod, Beadle, and Tatum to our understanding of the relationship between genes and enzymes Briefly explain how information
More informationDNA REPLICATION. DNA structure. Semiconservative replication. DNA structure. Origin of replication. Replication bubbles and forks.
DNA REPLICATION 5 4 Phosphate 3 DNA structure Nitrogenous base 1 Deoxyribose 2 Nucleotide DNA strand = DNA polynucleotide 2004 Biology Olympiad Preparation Program 2 2004 Biology Olympiad Preparation Program
More informationTranscription in Eukaryotes
Transcription in Eukaryotes Biology I Hayder A Giha Transcription Transcription is a DNA-directed synthesis of RNA, which is the first step in gene expression. Gene expression, is transformation of the
More informationProtein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
More informationMOLECULAR GENETICS PROTEIN SYNTHESIS. Molecular Genetics Activity #2 page 1
AP BIOLOGY MOLECULAR GENETICS ACTIVITY #2 NAME DATE HOUR PROTEIN SYNTHESIS Molecular Genetics Activity #2 page 1 GENETIC CODE PROTEIN SYNTHESIS OVERVIEW Molecular Genetics Activity #2 page 2 PROTEIN SYNTHESIS
More informationBIOLOGY - CLUTCH CH.17 - GENE EXPRESSION.
!! www.clutchprep.com CONCEPT: GENES Beadle and Tatum develop the one gene one enzyme hypothesis through their work with Neurospora (bread mold). This idea was later revised as the one gene one polypeptide
More informationDNA Replication and Repair
DNA Replication and Repair http://hyperphysics.phy-astr.gsu.edu/hbase/organic/imgorg/cendog.gif Overview of DNA Replication SWYK CNs 1, 2, 30 Explain how specific base pairing enables existing DNA strands
More informationTranscription. The sugar molecule found in RNA is ribose, rather than the deoxyribose found in DNA.
Transcription RNA (ribonucleic acid) is a key intermediary between a DNA sequence and a polypeptide. RNA is an informational polynucleotide similar to DNA, but it differs from DNA in three ways: RNA generally
More informationCLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code
CLEP Biology - Problem Drill 11: Transcription, Translation and The Genetic Code No. 1 of 10 1. Three types of RNA comprise the structural and functional core for protein synthesis, serving as a template
More informationThemes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
More informationText Reference, Campbell v.8, chapter 17 PROTEIN SYNTHESIS
AP BIOLOGY Text Reference, Campbell v.8, chapter 17 ACTIVITY 1.22 NAME DATE HOUR PROTEIN SYNTHESIS GENETIC CODE PROTEIN SYNTHESIS OVERVIEW PROTEIN SYNTHESIS TRANSCRIPTION PROTEIN SYNTHESIS TRANSLATION
More informationCh Molecular Biology of the Gene
Ch. 12 - Molecular Biology of the Gene AP BIOLOGY CHAPTER GUIDE 1. In the middle of the unraveling the mysteries of DNA, researchers knew that genetic material must be able to. It must be stable so it
More informationLecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points?
BCH 401G Lecture 37 Andres Lecture Summary: Regulation of transcription. General mechanisms-what are the major regulatory points? RNA processing: Capping, polyadenylation, splicing. Why process mammalian
More informationBEADLE & TATUM EXPERIMENT
FROM DNA TO PROTEINS: gene expression Chapter 14 LECTURE OBJECTIVES What Is the Evidence that Genes Code for Proteins? How Does Information Flow from Genes to Proteins? How Is the Information Content in
More informationDNA. Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses.
Is a molecule that encodes the genetic instructions used in the development and functioning of all known living organisms and many viruses. Genetic information is encoded as a sequence of nucleotides (guanine,
More informationBIOCHEMISTRY REVIEW. Overview of Biomolecules. Chapter 13 Protein Synthesis
BIOCHEMISTRY REVIEW Overview of Biomolecules Chapter 13 Protein Synthesis 2 3 4 5 6 7 8 9 10 Are You Getting It?? Which properties are characteristic of the normal genetic code? (multiple answers) a) A
More informationVideos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
More informationTranscription Eukaryotic Cells
Transcription Eukaryotic Cells Packet #20 1 Introduction Transcription is the process in which genetic information, stored in a strand of DNA (gene), is copied into a strand of RNA. Protein-encoding genes
More informationGENETICS - CLUTCH CH.10 TRANSCRIPTION.
!! www.clutchprep.com CONCEPT: OVERVIEW OF TRANSCRIPTION Transcription is the process of using DNA as a template to RNA RNA polymerase is the enzyme that transcribes DNA - There are many different types
More informationThe Nature of Genes. The Nature of Genes. Genes and How They Work. Chapter 15/16
Genes and How They Work Chapter 15/16 The Nature of Genes Beadle and Tatum proposed the one gene one enzyme hypothesis. Today we know this as the one gene one polypeptide hypothesis. 2 The Nature of Genes
More informationBig Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
More informationThere are four major types of introns. Group I introns, found in some rrna genes, are self-splicing: they can catalyze their own removal.
1 2 Continuous genes - Intron: Many eukaryotic genes contain coding regions called exons and noncoding regions called intervening sequences or introns. The average human gene contains from eight to nine
More informationNUCLEIC ACID METABOLISM. Omidiwura, B.R.O
NUCLEIC ACID METABOLISM Omidiwura, B.R.O Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid
More informationThe Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Nature of Genes. The Genetic Code. Genes and How They Work
Genes and How They Work Chapter 15 Early ideas to explain how genes work came from studying human diseases. Archibald Garrod studied alkaptonuria, 1902 Garrod recognized that the disease is inherited via
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationNucleic acids deoxyribonucleic acid (DNA) ribonucleic acid (RNA) nucleotide
Nucleic Acids Nucleic acids are molecules that store information for cellular growth and reproduction There are two types of nucleic acids: - deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) These
More informationProtein Synthesis ~Biology AP~
Protein Synthesis ~Biology AP~ A Meridian Study Guide by David Guan, Jennifer Zheng [Edited by Lei Gong] Introduction: - DNA and RNA are essential for life because they code for enzymes, which regulate
More informationChapter 12. DNA TRANSCRIPTION and TRANSLATION
Chapter 12 DNA TRANSCRIPTION and TRANSLATION 12-3 RNA and Protein Synthesis WARM UP What are proteins? Where do they come from? From DNA to RNA to Protein DNA in our cells carry the instructions for making
More informationTranscription and Translation
Transcription and Translation Central Dogma of Molecular The flow of information in the cell starts at DNA, which replicates to form more DNA. Information is then transcribed into RNA, and then it is translated
More informationTranscription. DNA to RNA
Transcription from DNA to RNA The Central Dogma of Molecular Biology replication DNA RNA Protein transcription translation Why call it transcription and translation? transcription is such a direct copy
More informationChapter 17 From Gene to Protein
Chapter 17 From Gene to Protein The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits
More informationDelve AP Biology Lecture 7: 10/30/11 Melissa Ko and Anne Huang
Today s Agenda: I. DNA Structure II. DNA Replication III. DNA Proofreading and Repair IV. The Central Dogma V. Transcription VI. Post-transcriptional Modifications Delve AP Biology Lecture 7: 10/30/11
More informationUnit IX Problem 3 Genetics: Basic Concepts in Molecular Biology
Unit IX Problem 3 Genetics: Basic Concepts in Molecular Biology - The central dogma (principle) of molecular biology: Information from DNA are transcribed to mrna which will be further translated to synthesize
More informationPROTEIN SYNTHESIS. copyright cmassengale
PROTEIN SYNTHESIS 1 DNA and Genes 2 Roles of RNA and DNA DNA is the MASTER PLAN RNA is the BLUEPRINT of the Master Plan 3 RNA Differs from DNA RNA has a sugar ribose DNA has a sugar deoxyribose 4 Other
More informationFrom RNA To Protein
From RNA To Protein 22-11-2016 Introduction mrna Processing heterogeneous nuclear RNA (hnrna) RNA that comprises transcripts of nuclear genes made by RNA polymerase II; it has a wide size distribution
More informationProtein Synthesis. DNA to RNA to Protein
Protein Synthesis DNA to RNA to Protein From Genes to Proteins Processing the information contained in DNA into proteins involves a sequence of events known as gene expression and results in protein synthesis.
More informationCHapter 14. From DNA to Protein
CHapter 14 From DNA to Protein How? DNA to RNA to Protein to Trait Types of RNA 1. Messenger RNA: carries protein code or transcript 2. Ribosomal RNA: part of ribosomes 3. Transfer RNA: delivers amino
More informationGene Expression Transcription/Translation Protein Synthesis
Gene Expression Transcription/Translation Protein Synthesis 1. Describe how genetic information is transcribed into sequences of bases in RNA molecules and is finally translated into sequences of amino
More informationVideos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
More informationChapter 14: From DNA to Protein
Chapter 14: From DNA to Protein Steps from DNA to Proteins Same two steps produce all proteins: 1) DNA is transcribed to form RNA Occurs in the nucleus RNA moves into cytoplasm 2) RNA is translated in
More informationThe Structure of RNA. The Central Dogma
12-3 12-3 RNA and Protein Synthesis The Structure of RNA The Central Dogma Phenotype A gene is a SEQUENCE of DNA that codes for a protein (or functional RNA). Phenotype is the individual s observable trait
More informationFeedback D. Incorrect! No, although this is a correct characteristic of RNA, this is not the best response to the questions.
Biochemistry - Problem Drill 23: RNA No. 1 of 10 1. Which of the following statements best describes the structural highlights of RNA? (A) RNA can be single or double stranded. (B) G-C pairs have 3 hydrogen
More informationChapter 17. From Gene to Protein. Slide 1. Slide 2. Slide 3. Gene Expression. Which of the following is the best example of gene expression? Why?
Slide 1 Chapter 17 From Gene to Protein PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from
More informationHello! Outline. Cell Biology: RNA and Protein synthesis. In all living cells, DNA molecules are the storehouses of information. 6.
Cell Biology: RNA and Protein synthesis In all living cells, DNA molecules are the storehouses of information Hello! Outline u 1. Key concepts u 2. Central Dogma u 3. RNA Types u 4. RNA (Ribonucleic Acid)
More informationSCBC203 Gene Expression. Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318
SCBC203 Gene Expression Assoc. Prof. Rutaiwan Tohtong Department of Biochemistry Faculty of Science PR318 Rutaiwan.toh@mahidol.ac.th 1 Gene Expression Gene expression is a process where by the genetic
More informationRNA, & PROTEIN SYNTHESIS. 7 th Grade, Week 4, Day 1 Monday, July 15, 2013
RNA, & PROTEIN SYNTHESIS 7 th Grade, Week 4, Day 1 Monday, July 15, 2013 The Central Dogma RNA vs. DNA Ribonucleic Acid RNA is required for translation of genetic information stored in DNA into protein
More informationChapters 31-32: Ribonucleic Acid (RNA)
Chapters 31-32: Ribonucleic Acid (RNA) Short segments from the transcription, processing and translation sections of each chapter Slide 1 RNA In comparison with DNA RNA utilizes uracil in place of thymine
More informationChapter 14: Gene Expression: From Gene to Protein
Chapter 14: Gene Expression: From Gene to Protein This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect
More informationChapter 17: From Gene to Protein
Name Period This is going to be a very long journey, but it is crucial to your understanding of biology. Work on this chapter a single concept at a time, and expect to spend at least 6 hours to truly master
More informationComputational Biology I LSM5191 (2003/4)
Computational Biology I LSM5191 (2003/4) Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression I Flow of information: DNA to polypeptide DNA Start Exon1 Intron Exon2 Termination
More informationMolecular Genetics. The flow of genetic information from DNA. DNA Replication. Two kinds of nucleic acids in cells: DNA and RNA.
Molecular Genetics DNA Replication Two kinds of nucleic acids in cells: DNA and RNA. DNA function 1: DNA transmits genetic information from parents to offspring. DNA function 2: DNA controls the functions
More informationA. Incorrect! This feature does help with it suitability as genetic material.
College Biology - Problem Drill 08: Gene Structures and Functions No. 1 of 10 1. Which of the statements below is NOT true in explaining why DNA is a suitable genetic material? #01 (A) Its double helix
More informationHershey and Chase. The accumulation of evidence: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928)
Today: Key Experiments in the Discovery of DNA: Griffith s Transformation Experiment (1928) Reviewing Mitosis/ Exploring the Function of Taxol Structure and Function of DNA! What do we learn about the
More informationKey Area 1.3: Gene Expression
Key Area 1.3: Gene Expression RNA There is a second type of nucleic acid in the cell, called RNA. RNA plays a vital role in the production of protein from the code in the DNA. What is gene expression?
More informationReplication, Transcription, and Translation
Replication, Transcription, and Translation Information Flow from DNA to Protein The Central Dogma of Molecular Biology Replication is the copying of DNA in the course of cell division. Transcription is
More informationChapter 2. An Introduction to Genes and Genomes
PowerPoint Lectures for Introduction to Biotechnology, Second Edition William J.Thieman and Michael A.Palladino Chapter 2 An Introduction to Genes and Genomes Lectures by Lara Dowland Chapter Contents
More informationFrederick Griffith: Transformation Conclusion: bacteria could give other bacteria heritable traits, even after they were dead.
Frederick Griffith: Transformation 1928 Conclusion: bacteria could give other bacteria heritable traits, even after they were dead. 1 Avery, McCarty & MacLeod: Griffiths Refined (1944) Refined Griffith's
More informationWinter Quarter Midterm Exam
1. For a science fair project, two students decided to repeat the Hershey and Chase experiment, with modifications. They decided to label the nitrogen of the DNA, rather than the phosphate. They reasoned
More informationExam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
More informationBiology A: Chapter 9 Annotating Notes Protein Synthesis
Name: Pd: Biology A: Chapter 9 Annotating Notes Protein Synthesis -As you read your textbook, please fill out these notes. -Read each paragraph state the big/main idea on the left side. -On the right side
More informationChapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein)
Chapter 12-3 RNA & Protein Synthesis Notes From DNA to Protein (DNA RNA Protein) I. Review A. Cells copy their DNA (in S phase of Interphase)-Why? Prepare for Cell Division (Mitosis & Cytokinesis) Genes
More information7.2 Protein Synthesis. From DNA to Protein Animation
7.2 Protein Synthesis From DNA to Protein Animation Proteins Why are proteins so important? They break down your food They build up muscles They send signals through your brain that control your body They
More informationTRANSCRIPTION AND PROCESSING OF RNA
TRANSCRIPTION AND PROCESSING OF RNA 1. The steps of gene expression. 2. General characterization of transcription: steps, components of transcription apparatus. 3. Transcription of eukaryotic structural
More informationBiology 3201 Genetics Unit #5
Biology 3201 Genetics Unit #5 Protein Synthesis Protein Synthesis Protein synthesis: this is the process whereby instructions from DNA are used to create polypeptides that make up a protein. This process
More informationUnit 1: DNA and the Genome. Sub-Topic (1.3) Gene Expression
Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression Unit 1: DNA and the Genome Sub-Topic (1.3) Gene Expression On completion of this subtopic I will be able to State the meanings of the terms genotype,
More informationBis2A 12.0 Transcription *
OpenStax-CNX module: m56068 1 Bis2A 12.0 Transcription * Mitch Singer Based on Transcription by OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License
More informationChapter 6: Transcription and RNA Processing in Eukaryotes
3. Basic Genetics Plant Molecular Biology Chapter 6: Transcription and RNA Processing in Eukaryotes - Genetic organization in eukaryote - Transcription in eukaryote - - RNA processing in eukaryote - Translation
More information