4. Analysing genes II Isolate mutants*

Transcription

1 .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual s into - cell (eg similarities to other s?) epress 1 2 Plasmid definition Using the mutant to isolate the small (5-100 kb) circular DNA molecule that replicates in bacterial cells independently of bacterial chromosome mutant 1 wild type - - contain antibiotic resistance s - can be modified so they replicate in yeast as well as bacteria identify plasmid which complements phenotype 3 4 Restriction enzymes Restriction enzymes are bacterial endonucleases that cut specific DNA sequences Many (type II) cut within or near the specific sequence Recognition sequence usually 4-8 bp and often palindromic Incisions often staggered giving rise to sticky ends Evolved as bacteriophage defence EcoRI cuts on average 1 in GAATTC 3 3 CTTAAG 5 H-bonding between sticky ends allows cut fragments to associate at low temperatures Eco RI 3'GTACTGCAGTA G AATTC ACGTAGCTGATC 3' CTTAA G TGCATCGACTAG 5' 3'GTACTGCAGTA G CTTAA reduce temperature AATTC G ACGTAGCTGATC 3' TGCATCGACTAG 5' 3'GTACTGCAGTA G OH AATTC ACGTAGCTGATC 3' CTTAA G TGCATCGACTAG 5' OH 5 6

2 DNA ligase DNA ligase joins 5 phosphate & 3 OH of adjacent nucleotides - thus sealing nicks in DNA strand ligases are found in all organisms but phage T4 ligase is used for in vitro recombination Making a library plasmid wild type yeast DNA cleavage and ligation Each colony = plasmid clone, containing a different yeast genome fragment transformation into E.coli with enough colonies recombinant plasmids all yeast sequences will be represented 7 8 Transform library into yeast ade1 mutant ade1 yeast on plasmid CDC2 RAD1 POL2 growth on medium lacking adenine X X X wt mutant ade1 Final steps in purification How can the of individual s be understood? Isolate mutants* classify mutants by complementation analysis prepare total DNA study phenotype of mutants use mutant to isolate transform bacteria selecting for marker on plasmid 11 prepare plasmid DNA (microgram quantities) (eg similarities to other s?) sequence epress 12

3 Dideoy (Sanger) sequencing Dideoy (Sanger) sequencing lllllllllll denature by heating to 95 C we need DNA polymerase (Taq) Template DNA DNA primer dntps and fluorescently-labelled dideoyntps Polymerase etends primer from a defined start When a fluorescent dideoy is incorporated, synthesis is terminated Millions of fragments are synthesised, terminating in the same fluorescent nucleotide media.invitrogen.com.edgesuite.net/ab/applications-technologies/pharma-biotherapeutics/ DNA_sequencing.swf After the synthesis reaction the products are separated by capillary electrophoresis - smaller fragments migrate faster. After separation the fragments are scanned by a laser and the colour of the light emitted indicates the terminating nucleotide. Output from the Zoology ABI sequencer

4 How are the data analysed? Only about bp can be sequenced in one reaction Sequences from different primers are assembled by computer to highlight errors and rate the complete sequence of the Assembly of raw sequence reads is called a contig How are the data analysed? TGTCAATTACGAAGACTGAACTGGACGGTATATTGCCATTGGTGGCCAGAGGTAAAGTTAGAGACATATATGAGGTAGACGCTGGT How can the of individual s be understood? identify where is in sequence, promoter, coding region etc predict amino acid sequence of product compare to database of other sequences to see if similar to previously characterised s epress strategy I mutant strategy 2 genome How can the of individual s be understood? sequence genome Parallel sequencing methods allow rapid genome sequencing identify s by predict likely of s from e.g. illumina (based on dideoy method) purify s of interest by PCR mutate in vivo to determine phenotype epress < 1 for 10 6 bases human genome - 1 day 23 24

5 Illumina sequencing method Bioinformatic analysis of sequence data allows identification of s segment of fission yeast genome Summary - Gene identification strategy I mutant Advantages strategy 2 genome mutant phenotype indicates all s potentially identifiable Disadvantages requires tically amenable epensive, but increasingly less so organism may not identify piecemeal, one mutant screen small s may be difficult to identifies a handful of s detect Questions you should be able to answer from this lecture - show in diagrams how dideoy sequencing works - what is a contig? - eplain how s can be identified without using mutants - what features of restriction enzymes make them useful for in vitro recombination? - what is a plasmid and how does it differ from a chromosome? 29