Supporting Online Material for

Size: px
Start display at page:

Download "Supporting Online Material for"

Transcription

1 Supporting Online Material for RISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, Christophe Fremaux, Hélène Deveau, Melissa Richards, Patrick Boyaval, Sylvain Moineau, Dennis A. Romero, Philippe Horvath* *To whom correspondence should be addressed. This PDF file includes Materials and Methods Figs. S1 to S5 References Published 23 March 2007, Science 315, 1709 (2007) DOI: /science

2 MATERIALS AND METHODS Isolation of phage-resistant mutants and confirmation of CRISPR sequences Streptococcus thermophilus phage-resistant mutants were obtained by challenging the wild-type host strain DGCC7710 (also called RD534) with phage 2972 and/or phage 858 (1). The host strain was grown at 42ºC in 10 ml of M17 broth supplemented with 0.5% lactose (LM17). When the optical density (600 nm) reached 0.3, phages and calcium chloride 10mM were added at a final concentration of 10 7 pfu/ml and 50 mm, respectively. The phage-containing culture was incubated at 42ºC for 24 hours and monitored for lysis. Then, 100 µl of the lysate were inoculated into 10 ml of fresh LM17. The remaining lysate was centrifuged and the pellet was inoculated into another tube containing 10 ml of fresh LM17. These two cultures were incubated at 42ºC for 16 hours. Finally, these cultures were diluted and plated on LM17. Isolated colonies were tested for phage sensitivity as previously described (2). The CRISPR loci of the resistant isolates were verified by sequencing PCR products, and using relevant phage genome information (1). CRISPR spacer engineering Enzymes used to carry out restriction digests and PCR were purchased from Invitrogen and used according to the manufacturer s instructions. PCRs were carried out on an Eppendorf Mastercycler Gradient thermocycler. Gene inactivation and site-specific plasmid insertion via homologous recombination in the S. thermophilus chromosome were carried out by sub-cloning into the pcr2.1-topo system (Invitrogen), by subsequent cloning in the pori system using Escherichia coli as a host, and the constructs were ultimately purified and transformed into S. thermophilus as previously described (3). DNA from mutant WT Φ858 +S1 was used as a template to amplify two distinct PCR fragments using P1 (5'-acaaacaacagagaagtatctcattg-3') and P2 (5'-aacgagtacactcactatttgtacg-3') in one reaction, and P3 (5'-tccactcacgtacaaatagtgagtgtactcgtttttgtattctcaagatttaagtaactgtacagtttgattcaacataaaaag-3') and P4 (5'-ctttccttcatcctcgctttggtt-3') in another reaction. Both PCR products were subsequently used as templates in another PCR reaction using primers P1 and P4 to generate the S1 construct (fig. S4). The S1 construct was sub-cloned into the Invitrogen pcr2.1-topo system. This construct was digested with NotI and HindIII and subsequently cloned into pori at the NotI and HindIII sites, providing the ps1 construct. Integration of ps1 into the CRISPR1 locus of strain WT Φ2972 +S4 occurred via homologous recombination at the 3' end of cas7, to generate WT Φ2972 +S4 ::ps1. The pr construct was generated using the ps1 construct as a template. Specifically, the S1 construct sub-cloned into pcr2.1-topo was digested using BsrGI, which cuts within the CRISPR repeat. Then, the digest was religated and a plasmid containing a single repeat and no spacer was used subsequently for cloning into pori using NotI and HindIII, generating pr. Integration of pr into the chromosome of strain WT Φ858 +S1 at the 3' end of cas7 via homologous recombination generated WT Φ858 +S1 ::pr, a mutant where the CRISPR1 locus is displaced and a unique repeat is inserted in its place. The mutant WT Φ858 +S1 ::pr was subsequently grown in the absence of erythromycin, and antibiotic-sensitive variants were analyzed to find a mutant that had a complete deletion of the CRISPR1 locus. The deletion was derived from homologous recombination occurring at the 3' end of ORF (as opposed to a recombination event occurring at the 3' end of cas7, which would have resulted

3 in restoration of the strain WT Φ858 +S1 ), generating WT Φ858 +S1 CRISPR1, a mutant where the CRISPR1 locus is deleted (fig. S5). Inactivation of cas genes For cas5 inactivation, a 801-bp internal piece of cas5 was amplified by PCR using primers 5'-caaatggatagagaaacgc-3' and 5'-ctgataaggtgttcgttgtcc-3' and sub-cloned into Escherichia coli pcr2.1- TOPO (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pori at the EcoRV and HindIII sites. Integration of this construct into the cas5 gene of strain WT Φ858 +S1 occurred via homologous recombination of the internal piece of the gene, resulting into WT Φ858 +S1 ::pcas5-. Similarly, a 672-bp internal piece of cas7 was amplified by PCR using primers 5'-ggagcagatggaatacaagaaagg-3' and 5'-gagagactaggttgtctcagca-3' and sub-cloned into Escherichia coli pcr2.1-topo (Invitrogen). This construct was digested with EcoRV and HindIII and subsequently cloned into pori at the EcoRV and HindIII sites. Integration of this construct into the cas7 gene of strain WT Φ858 +S1 occurred via homologous recombination of the internal piece of the gene, resulting into WT Φ858 +S1 ::pcas7-.

4 SUPPORTING FIGURES Strain GenBank Accession Lysotype Comment LMD-9 CP A L DGCC7689 EF A L DGCC778 EF A1 BIM of LMD-9 L EF A2 BIM of LMD-9 L DGCC8769 EF A3 BIM of LMD-9 L DGCC1086 EF A L SMQ-301 EF B L DGCC855 EF B1 L DGCC1443 EF B2 L DGCC8234 EF C L DGCC7973 EF C1 L CNRZ703 DQ n.d. L DGCC7796 EF E L DGCC7710 EF F L WTΦ858+S1 (= DGCC7778) EF F1 BIM of DGCC7710 L WTΦ858+S3 EF F2 BIM of DGCC7710 L WTΦ2972+S4 EF F3 BIM of DGCC7710 L WTΦ2972+S5 EF F4 BIM of DGCC7710 L WTΦ2972+S6 EF F5 BIM of DGCC7710 L WTΦ2972+S7 EF F6 BIM of DGCC7710 L WTΦ2972+S8 EF F7 BIM of DGCC7710 L WTΦ858Φ2972+S9S10S11S12 EF F8 BIM of DGCC7710 L WTΦ858Φ2972+S13S14 EF F9 BIM of DGCC7710 L DGCC7699 EF G L DGCC86 EF G1 L DGCC8170 EF G2 L DGCC8168 EF G3 L DGCC48 EF G3 L JIM1518 DQ n.d. L JIM1560 DQ n.d. L JIM1575 DQ n.d. L JIM1588 DQ n.d. L 4035 DQ n.d. L DGCC7790 EF H L DGCC7852 EF H L DGCC7873 EF H L CNRZ385 DQ n.d. L DGCC7809 EF J L DGCC103 EF K L CNRZ1202 DQ n.d. L DQ n.d. L CNRZ1205 DQ n.d. L DGCC7842 EF M L JIM1567 DQ n.d. L JIM76 DQ n.d. L CNRZ1066 CP N L DGCC6297 EF N L DGCC944 EF N L DGCC766 EF N L DGCC7967 EF Q L DGCC938 EF Q1 L CNRZ389 DQ n.d. L LMG18311 CP n.d. L CNRZ1100 DQ n.d. L DGCC7785 EF Q2 L CNRZ388 DQ n.d. L DGCC292 EF Q3 L DGCC47 EF R L DGCC7806 EF R L JIM70 DQ n.d. L DGCC7981 EF R1 L DGCC66 EF R2 L JIM72 DQ n.d. L DGCC7984 EF S L DGCC8191 EF T L DGCC5472 EF T L DGCC3367 EF U L JIM71 DQ n.d. L JIM1584 DQ n.d. L CNRZ302 DQ n.d. L JIM1293 DQ n.d. L CNRZ1575 DQ n.d. L Fig. S1. Graphic representation of CRISPR1 spacers across a variety of S. thermophilus strains. Repeats are not included, only spacers are represented. Each spacer is represented by a combination of one select character in a particular font color, on a particular background color. The color combination allows unique representation of a particular spacer, whereby squares with similar color schemes (combination of character color and background color) represent identical spacers, whereas different color combinations represent distinguishable spacers. Missing spacers are represented by crossed squares. L (blue): CRISPR leader sequence. In the third column, a letter indicates strain lysotype, whereby the lysotype is defined as the spectrum of sensitivity of the strain to a set of phages; lysotypes that show minor differences for specific phages are distinguished by an additional number. n.d.: not determined. BIM: bacteriophage insensitive mutant.

5 S1 CAACACATTCAACAGATTAATGAAGAATAC Φ (+) Φ GAT.GATTTC...T.AC...GA (+) TCCACTCACGTACAAATAGTGAGTGTACTC Φ858...C (-) Φ C (-) S3 TTACGTTTGAAAAGAATATCAAATCAATGA Φ (+) Φ (+) S4 CTCAGTCGTTACTGGTGAACCAGTTTCAAT Φ858...T...T..G.TGG (+) Φ (+) S5 AGTTTCTTTGTCAGACTCTAACACAGCCGC Φ858 G...T (+) Φ (+) S6 GCCCTTCTAATTGGATTACCTTCCGAGGTG Φ (-) Φ (-) S7 AAGCAAGTTGATATATTTCTCTTTCTTTAT Φ (-) Φ (-) S8 CGTTTTCAGTCATTGGTGGTTTGTCAGCG Φ858.T.C...CTCAC.AAA..T...TTTA (-) Φ (-) S9 TTACTAGAGCGTGTCGTTAACCACTTTAAA Φ (+) Φ (+) S10 TTCGTTAAAGTCACCTCGTGCTAGCGTTGC Φ (-) Φ (-) S11 ATAACGGTAGCAAATATAAACCTGTTACTG Φ (+) Φ (+) S12 GAAGTAGCCATACAAGAAGATGGATCAGCA Φ (+) Φ (+) S13 GATGTCACTGAGTGTCTAAGCATTGCGTAC Φ (+) Φ (+) S14 TGAATAAGCAGTTCTTGACGACCAACCGAC Φ (-) Φ (-) Fig.. Alignment of the acquired CRISPR spacers with the corresponding genomic region of phage 858 and phage Identical bases are indicated by a dot, whereas nucleotide polymorphisms are specified. Positions (bp) and DNA strand relative to the phage genomes are indicated on the right.

6 S1 CAACACATTCAACAGATTAATGAAGAATAC Φ Φ858-A...A... Φ858-B...C. Fig. S3. Alignment of CRISPR spacer S1 with the corresponding genomic region of phage 858 and the two mutant phages that have circumvented the CRISPR resistance of strain WT Φ858 +S1. WT +S1 Φ858 cas5 cas1 cas6 cas7 repeat/spacer region ORF L S1 T P1 P2 P3 P4 L S1 T P1 P4 S1 construct: L S1 T Fig. S4. Schematic representation of the PCR strategy followed to generate the S1 construct. Genomic DNA of strain WT Φ858 +S1 was used as a template in two distinct PCR reactions with primer pairs P1-P2, and P3-P4, respectively. The two PCR products were mixed and subjected to a third PCR reaction in the presence of primers P1 and P4.

7 WT +S1 Φ858 cas5 cas1 cas6 cas7 repeat/spacer region ORF pori Integration of the pr plasmid via homologous recombination WT +S1 Φ858 ::pr cas5 cas1 cas6 cas7 pori repeat/spacer region ORF cas5 cas1 cas6 cas7 pori repeat/spacer region Plasmid excision with deletion of CRISPR1 WT +S1 Φ858 CRISPR1 cas5 cas1 cas6 cas7 ORF Fig. S5. Diagram representing the homologous recombination events that led to mutants WT Φ858 +S1 ::pr and WT Φ858 +S1 CRISPR1. Strain WT Φ858 +S1 ::pr was generated through integration of the pr plasmid into cas7. Subsequently strain WT Φ858 +S1 CRISPR1 was obtained after plasmid excision via homologous recombination at the 3' end of ORF. SUPPORTING REFERENCES 1. C. Lévesque et al., Appl. Environ. Microbiol. 71, 4057 (2005). 2. S. Moineau, J. Fortier, H.-W. Ackermann, S. Pandian. Can J. Microbiol. 38, 875 (1992). 3. W. M. Russell, T. R. Klaenhammer, Appl. Environ. Microbiol. 67, 4361 (2001). Supporting Online Material Materials and Methods Figs. S1 to S5 References and Notes

CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes. DOI: /science

CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes. DOI: /science CRISPR Provides Acquired Resistance Against Viruses in Prokaryotes Rodolphe Barrangou, et al. Science 315, 1709 (2007); DOI: 10.1126/science.1138140 The following resources related to this article are

More information

Data Sheet Quick PCR Cloning Kit

Data Sheet Quick PCR Cloning Kit Data Sheet Quick PCR Cloning Kit 6044 Cornerstone Ct. West, Ste. E DESCRIPTION: The Quick PCR Cloning Kit is a simple and highly efficient method to insert any gene or DNA fragment into a vector, without

More information

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3:

Step 1: Digest vector with Reason for Step 1. Step 2: Digest T4 genomic DNA with Reason for Step 2: Step 3: Reason for Step 3: Biol/Chem 475 Spring 2007 Study Problems for Quiz 2 Quiz 2 (~50 pts) is scheduled for Monday May 14 It will cover all handouts and lab exercises to date except the handout/worksheet (yet to be distributed)

More information

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC

Supplemental Materials. DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC Supplemental Materials DNA preparation. Dehalogenimonas lykanthroporepellens strain BL-DC-9 T (=ATCC BAA-1523 = JCM 15061) was grown in defined basal medium amended with 0.5 mm 1,1,2- trichloroethane (1,1,2-TCA)

More information

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References.

File name: Supplementary Information. Description: Supplementary Figures, Supplementary Tables and Supplementary References. 1 2 File name: Supplementary Information Description: Supplementary Figures, Supplementary Tables and Supplementary References. 3 1 4 Supplementary Figures 5 6 7 Figure S1 Comparison of the One-Step-Assembly

More information

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau

7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau 7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial

More information

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)

Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA) Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION doi:10.1038/nature09937 a Name Position Primersets 1a 1b 2 3 4 b2 Phenotype Genotype b Primerset 1a D T C R I E 10000 8000 6000 5000 4000 3000 2500 2000 1500 1000 800 Donor (D)

More information

Protocol CRISPR Genome Editing In Cell Lines

Protocol CRISPR Genome Editing In Cell Lines Protocol CRISPR Genome Editing In Cell Lines Protocol 2: HDR donor plasmid applications (gene knockout, gene mutagenesis, gene tagging, Safe Harbor ORF knock-in) Notes: 1. sgrna validation: GeneCopoeia

More information

Recombinant DNA recombinant DNA DNA cloning gene cloning

Recombinant DNA recombinant DNA DNA cloning gene cloning DNA Technology Recombinant DNA In recombinant DNA, DNA from two different sources, often two species, are combined into the same DNA molecule. DNA cloning permits production of multiple copies of a specific

More information

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES.

GENETICS - CLUTCH CH.5 GENETICS OF BACTERIA AND VIRUSES. !! www.clutchprep.com CONCEPT: WORKING WITH MICROORGANISMS Bacteria are easy to with in a laboratory setting They are fast dividing, take up little space, and are easily grown in a lab - Plating is when

More information

The Population and Evolutionary Dynamics of Phage and Bacteria with CRISPR Mediated Immunity

The Population and Evolutionary Dynamics of Phage and Bacteria with CRISPR Mediated Immunity The Population and Evolutionary Dynamics of Phage and Bacteria with CRISPR Mediated Immunity Bruce Levin, Emory University Sylvain Moineau, Université Laval Mary Bushman, Emory University Rodolphe Barrangou,

More information

A universal chassis plasmid pwh34 was first constructed to facilitate the

A universal chassis plasmid pwh34 was first constructed to facilitate the 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 File name: Supplementary method Plasmids construction A universal chassis plasmid pwh34 was first constructed to facilitate the construction

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive

Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive Designing and creating your gene knockout Background The rada gene was identified as a gene, that when mutated, caused cells to become hypersensitive to ionizing radiation. However, why these mutants are

More information

Biol/Chem 475 Spring 2007

Biol/Chem 475 Spring 2007 Biol/Chem 475 Spring 2007 Goal of lab: For most of the quarter, we will be exploring a gene family that was first discovered in fruitlfies and then found to be present in humans and worms and fish and

More information

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University

Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene. Andrew ElBardissi, The Pennsylvania State University Understanding the Cellular Mechanism of the Excess Microsporocytes I (EMSI) Gene Andrew ElBardissi, The Pennsylvania State University Abstract: Hong Ma, The Pennsylvania State University The Excess Microsporocytes

More information

DNA Cloning with Cloning Vectors

DNA Cloning with Cloning Vectors Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning

More information

Molecular Biology Techniques Supporting IBBE

Molecular Biology Techniques Supporting IBBE Molecular Biology Techniques Supporting IBBE Jared Cartwright Protein Production Lab Head Contact Details: email jared.cartwright@york.ac.uk Phone 01904 328797 Presentation Aims Gene synthesis Cloning

More information

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears

Chapter 15 Recombinant DNA and Genetic Engineering. Restriction Enzymes Function as Nature s Pinking Shears Chapter 15 Recombinant DNA and Genetic Engineering In this chapter you will learn How restriction enzyme work and why they are essential to DNA technology. About various procedures such as cloning and

More information

Presto Mini Plasmid Kit

Presto Mini Plasmid Kit Instruction Manual Ver. 03.06.17 For Research Use Only Presto Mini Plasmid Kit PDH004 (4 Preparation Sample Kit) PDH100 (100 Preparation Kit) PDH300 (300 Preparation Kit) Advantages Sample: 1-7 ml of cultured

More information

Genetic Engineering & Recombinant DNA

Genetic Engineering & Recombinant DNA Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

Amplicon Sequencing Template Preparation

Amplicon Sequencing Template Preparation Amplicon Sequencing Template Preparation The DNA sample preparation procedure for Amplicon Sequencing consists of a simple PCR amplification reaction, but uses special Fusion Primers (Figure 1-1). The

More information

peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending)

peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) peco TM -T7-nGST, Eco cloning Kit User Manual (Patent pending) Cloning PCR products for E Coli expression of N-term GST-tagged protein Cat# Contents Amounts Application IC-1004 peco-t7-ngst vector built-in

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis *

Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants Jeroen D. Langereis * Laboratory of Pediatric Infectious Diseases, Department of Pediatrics and Laboratory of Medical Immunology,

More information

Supporting Information

Supporting Information Supporting Information Kilian et al. 10.1073/pnas.1105861108 SI Materials and Methods Determination of the Electric Field Strength Required for Successful Electroporation. The transformation construct

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

Hetero-Stagger PCR Cloning Kit

Hetero-Stagger PCR Cloning Kit Product Name: Code No: Size: DynaExpress Hetero-Stagger PCR Cloning Kit DS150 20 reactions Kit Components: Box 1 (-20 ) phst-1 Vector, linearized Annealing Buffer Ligase Mixture phst Forward Sequence Primer

More information

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications

Biotechnology. Review labs 1-5! Ch 17: Genomes. Ch 18: Recombinant DNA and Biotechnology. DNA technology and its applications Biotechnology DNA technology and its applications Biotechnology and Molecular Biology Concepts: Polymerase chain reaction (PCR) Plasmids and restriction digests Recombinant protein production UV spectrophotometry

More information

Transformation of Escherichia coli With a Chimeric Plasmid

Transformation of Escherichia coli With a Chimeric Plasmid Transformation of Escherichia coli With a Chimeric Plasmid Now that we have generated recombinant molecules, we must next amplify them by inserting them into an acceptable host so that they may be analyzed

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix

Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix DNA CLONING DNA AMPLIFICATION & PCR Improved method for assembly of linear yeast expression cassettes using NEBuilder HiFi DNA Assembly Master Mix EPIGENETICS RNA ANALYSIS LIBRARY PREP FOR NEXT GEN SEQUENCING

More information

GenBuilder TM Cloning Kit User Manual

GenBuilder TM Cloning Kit User Manual GenBuilder TM Cloning Kit User Manual Cat.no L00701 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ. DNA

More information

Supplementary Methods

Supplementary Methods Supplementary Methods SMAP Assay Detailed Protocol I. Technology Description SMAP is a novel gene amplification method with high sensitivity and single-nucleotide precision, enabling rapid detection of

More information

Ready_to_use Fast Seamless Cloning Kit. User Manual

Ready_to_use Fast Seamless Cloning Kit. User Manual For general laboratory use. Not for use in diagnostic procedures. FOR IN VITRO USE ONLY. Ready_to_use Fast Seamless Cloning Kit User Manual 1 / 6 Tel: 021-58975266 Fax: 021-50800270 Email:tech@dogene.com

More information

Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST

Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Prof. Kathy Q. Luo and Prof. Donald C. Chang Dept. of Chemical Engineering, Bioengineering Graduate Program and Dept. of Biology HK

More information

NAME TA SEC Problem Set 5 FRIDAY October 29, 2004

NAME TA SEC Problem Set 5 FRIDAY October 29, 2004 MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 5 FRIDAY October 29,

More information

CRISPR/Cas9 Genome Editing: Transfection Methods

CRISPR/Cas9 Genome Editing: Transfection Methods CRISPR/ Genome Editing: Transfection Methods For over 20 years Mirus Bio has developed and manufactured high performance transfection products and technologies. That expertise is now being applied to the

More information

4/26/2015. Cut DNA either: Cut DNA either:

4/26/2015. Cut DNA either: Cut DNA either: Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds

More information

CRISPR Interference Limits Horizontal Gene Transfer in Staphylococci by Targeting DNA

CRISPR Interference Limits Horizontal Gene Transfer in Staphylococci by Targeting DNA www.sciencemag.org/cgi/content/full/322/5909/1843/dc1 Supporting Online Material for CRISPR Interference Limits Horizontal Gene Transfer in Staphylococci by Targeting DNA Luciano A. Marraffini and Erik

More information

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm.

Mos1 insertion. MosTIC protocol-11/2006. repair template - Mos1 transposase expression - Mos1 excision - DSB formation. homolog arm. MosTIC (Mos1 excision induced Transgene Instructed gene Conversion) Valérie Robert (vrobert@biologie.ens.fr) and Jean-Louis Bessereau (jlbesse@biologie.ens.fr) (November 2006) Introduction: MosTIC (Robert

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Supplementary Information

Supplementary Information Supplementary Information Vidigal and Ventura a wt locus 5 region 3 region CCTCTGCCACTGCGAGGGCGTCCAATGGTGCTTG(...)AACAGGTGGAATATCCCTACTCTA predicted deletion clone 1 clone 2 clone 3 CCTCTGCCACTGCGAGGGCGTC-AGGTGGAATATCCCTACTCTA

More information

Protocols for cloning SEC-based repair templates using SapTrap assembly

Protocols for cloning SEC-based repair templates using SapTrap assembly Protocols for cloning SEC-based repair templates using SapTrap assembly Written by Dan Dickinson (ddickins@live.unc.edu) and last updated July 2016. Overview SapTrap (Schwartz and Jorgensen, 2016) is a

More information

Module 17: Genetic Engineering and Biotechnology, Student Learning Guide

Module 17: Genetic Engineering and Biotechnology, Student Learning Guide Name: Period: Date: Module 17: Genetic Engineering and Biotechnology, Student Learning Guide Instructions: 1. Work in pairs (share a computer). 2. Make sure that you log in for the first quiz so that you

More information

All MGC premier clones are 100% guaranteed to match their published sequence.

All MGC premier clones are 100% guaranteed to match their published sequence. MGC premier full length cdna and ORF clones TCH1003, TCM1004, TCR1005, TCB1006, TCL1007, TCT1008, TCZ1009, TOH6003, TOM6004, TOZ6009, TCHS1003, TCMS1004, TCRS1005, TCBS1006, TCLS1007, TCTS1008 MGC premier

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Amgen Laboratory Series. Tabs C and E

Amgen Laboratory Series. Tabs C and E Amgen Laboratory Series Tabs C and E Chapter 2A Goals Describe the characteristics of plasmids Explain how plasmids are used in cloning a gene Describe the function of restriction enzymes Explain how to

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat. No. L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2

More information

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual

Cold Fusion Cloning Kit. Cat. #s MC100A-1, MC101A-1. User Manual Fusion Cloning technology Cold Fusion Cloning Kit Store the master mixture and positive controls at -20 C Store the competent cells at -80 C. (ver. 120909) A limited-use label license covers this product.

More information

GenBuilder TM Plus Cloning Kit User Manual

GenBuilder TM Plus Cloning Kit User Manual GenBuilder TM Plus Cloning Kit User Manual Cat.no L00744 Version 11242017 Ⅰ. Introduction... 2 I.1 Product Information... 2 I.2 Kit Contents and Storage... 2 I.3 GenBuilder Cloning Kit Workflow... 2 Ⅱ.

More information

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage. 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: techsupport@norgenbiotek.com Phage DNA Isolation Kit Product # 46800, 46850 Product Insert

More information

BRED: Bacteriophage Recombineering with Electroporated DNA

BRED: Bacteriophage Recombineering with Electroporated DNA BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have termed BRED: Bacteriophage

More information

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2

YG1 Control. YG1 PstI XbaI. YG5 PstI XbaI Water Buffer DNA Enzyme1 Enzyme2 9/9/03 Aim: Digestion and gel extraction of YG, YG3, YG5 and 8/C. Strain: E. coli DH5α Plasmid: Bba_J600, psbc3 4,, 3 6 7, 8 9 0, 3, 4 8/C 8/C SpeI PstI 3 3 x3 YG YG PstI XbaI.5 3.5 x YG3 YG3 PstI XbaI

More information

Simple Deletion: a vector- and marker-free method to generate and isolate site-directed

Simple Deletion: a vector- and marker-free method to generate and isolate site-directed Electronic supplementary materials Simple Deletion: a vector- and marker-free method to generate and isolate site-directed deletion mutants Yasuhiro Inoue 1, Seiji Tsuge 2 1 National Agriculture and Food

More information

Supporting information

Supporting information Supporting information Construction of strains and plasmids To create ptc67, a PCR product obtained with primers cc2570-162f (gcatgggcaagcttgaggacggcgtcatgt) and cc2570+512f (gaggccgtggtaccatagaggcgggcg),

More information

BRED: Bacteriophage Recombineering with Electroporated DNA

BRED: Bacteriophage Recombineering with Electroporated DNA Phagehunting Program BRED: Bacteriophage Recombineering with Electroporated DNA Introduction We have developed a system for generating mutations in lytically replicating mycobacteriophages that we have

More information

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning

CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can

More information

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC

Journal of Experimental Microbiology and Immunology (JEMI) Vol. 6:20-25 Copyright December 2004, M&I UBC Preparing Plasmid Constructs to Investigate the Characteristics of Thiol Reductase and Flavin Reductase With Regard to Solubilizing Insoluble Proteinase Inhibitor 2 in Bacterial Protein Overexpression

More information

Answer sheet. Student number:

Answer sheet. Student number: Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid

More information

Creating pentr vectors by BP reaction

Creating pentr vectors by BP reaction Creating pentr vectors by BP reaction Tanya Lepikhova and Rafael Martinez 15072011 Overview: 1. Design primers to add the attb sites to gene of interest 2. Perform PCR with a high fidelity DNA polymerase

More information

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.

Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell. Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon

More information

Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability

Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Antisense RNA Targeting the First Periplasmic Domain of YidC in Escherichia coli Appears to Induce Filamentation but Does Not Affect Cell Viability Riaaz Lalani, Nathaniel Susilo, Elisa Xiao, Andrea Xu

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Gene replacements and insertions in rice by intron targeting using CRISPR Cas9 Table of Contents Supplementary Figure 1. sgrna-induced targeted mutations in the OsEPSPS gene in rice protoplasts. Supplementary

More information

Guide-it Indel Identification Kit User Manual

Guide-it Indel Identification Kit User Manual Clontech Laboratories, Inc. Guide-it Indel Identification Kit User Manual Cat. No. 631444 (120114) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain View, CA 94043, USA

More information

Supporting Information

Supporting Information Supporting Information Gómez-Marín et al. 10.1073/pnas.1505463112 SI Materials and Methods Generation of BAC DK74B2-six2a::GFP-six3a::mCherry-iTol2. BAC clone (number 74B2) from DanioKey zebrafish BAC

More information

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION

MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION ICBAA2017-30 MUTAGENESIS OF THE PROMOTER OF THE OIL PALM HOMOGENTISATE GERANYLGERANYL TRANSFERASE GENE (HGGT) BY PCR-DRIVEN OVERLAP EXTENSION Mohd Shahrul Nizwanshah Karim and Siti Nor Akmar Abdullah Laboratory

More information

4. Analysing genes II Isolate mutants*

4. Analysing genes II Isolate mutants* .. 4. Analysing s II Isolate mutants* Using the mutant to isolate the classify mutants by complementation analysis wild type study phenotype of mutants mutant 1 - use mutant to isolate sequence put individual

More information

SCREENING AND PRESERVATION OF DNA LIBRARIES

SCREENING AND PRESERVATION OF DNA LIBRARIES MODULE 4 LECTURE 5 SCREENING AND PRESERVATION OF DNA LIBRARIES 4-5.1. Introduction Library screening is the process of identification of the clones carrying the gene of interest. Screening relies on a

More information

Genetic Background Page 1 PHAGE P22

Genetic Background Page 1 PHAGE P22 Genetic Background Page 1 PHAGE P22 Growth of P22. P22 is a temperate phage that infects Salmonella by binding to the O-antigen, part of the lipopolysaccharide on the outer membrane. After infection, P22

More information

Polymerase Chain Reaction

Polymerase Chain Reaction Polymerase Chain Reaction Amplify your insert or verify its presence 3H Taq platinum PCR mix primers Ultrapure Water PCR tubes PCR machine A. Insert amplification For insert amplification, use the Taq

More information

BIO440 Genetics Laboratory Transformation

BIO440 Genetics Laboratory Transformation BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920

More information

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase

Fast and efficient site-directed mutagenesis with Platinum SuperFi DNA Polymerase APPLICATION NOTE Platinum Superi Polymerase ast and efficient site-directed mutagenesis with Platinum Superi Polymerase Introduction Site-directed mutagenesis is one of the most essential techniques to

More information

Synthetic Biology for

Synthetic Biology for Synthetic Biology for Plasmids and DNA Digestion Plasmids Plasmids are small DNA molecules that are separate from chromosomal DNA They are most commonly found as double stranded, circular DNA Typical plasmids

More information

HiPer Plasmid DNA Cloning Teaching Kit

HiPer Plasmid DNA Cloning Teaching Kit HiPer Plasmid DNA Cloning Teaching Kit Product Code: HTBM022 Number of experiments that can be performed: 5 Duration of Experiment: 4 days Day 1- Preparation of media and revival of E. coli Host Day2-

More information

Hernday Lab C. albicans CRISPR System Background:

Hernday Lab C. albicans CRISPR System Background: Hernday Lab C. albicans CRISPR System Background: This document covers the plasmids and protocols used for the Hernday lab Candida albicans CRISPR system. This system allows the user to edit virtually

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

Genetics Lecture Notes Lectures 13 16

Genetics Lecture Notes Lectures 13 16 Genetics Lecture Notes 7.03 2005 Lectures 13 16 Lecture 13 Transposable elements Transposons are usually from 10 3 to 10 4 base pairs in length, depending on the transposon type. The key property of transposons

More information

Biology 4100 Minor Assignment 1 January 19, 2007

Biology 4100 Minor Assignment 1 January 19, 2007 Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on

More information

By two mechanisms: Mutation Genetic Recombination

By two mechanisms: Mutation Genetic Recombination Genetics (see text pages 257-259, 267-298) Remember what it is we want to address: How is it that prokaryotes gain new genetic ability? The cells are haploid and reproduce by fission...so how does an genetic

More information

Determination of Exclusion Effect in Wild Type and Rop Deficient Mutated pbr322 Co-transformations

Determination of Exclusion Effect in Wild Type and Rop Deficient Mutated pbr322 Co-transformations Determination of Exclusion Effect in Wild Type and Rop Deficient Mutated pbr322 Co-transformations Suzana Sabaiduc and Andy Lo Microbiology and Immunology University of British Columbia pbr322 is an expression

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figures Figure S1. Study of mgtl translation in vitro. (A) Detection of 5 LR RNA using wild-type and anti-sd (91-95) substituted templates in a transcription-translation

More information

7. (10pts.) The diagram below shows the immunity region of phage l. The genes are:

7. (10pts.) The diagram below shows the immunity region of phage l. The genes are: 7. (10pts.) The diagram below shows the immunity region of phage l. The genes are: ci codes for ci repressor. The ci857 allele is temperature sensitive. cro codes for Cro protein. N codes for the transcription

More information

Ligation Independent Cloning (LIC) Procedure

Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) Procedure Ligation Independent Cloning (LIC) LIC cloning allows insertion of DNA fragments without using restriction enzymes into specific vectors containing engineered

More information

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity

The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega

More information

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX

Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX Transfection of CRISPR/Cas9 Nuclease NLS ribonucleoprotein (RNP) into adherent mammalian cells using Lipofectamine RNAiMAX INTRODUCTION The CRISPR/Cas genome editing system consists of a single guide RNA

More information

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.

CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved. CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,

More information

Recombinant DNA Libraries and Forensics

Recombinant DNA Libraries and Forensics MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier

More information

Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system

Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system SUPPLEMENTARY DATA Modulating the Cascade architecture of a minimal Type I-F CRISPR-Cas system Daniel Gleditzsch 1, Hanna Müller-Esparza 1, Patrick Pausch 2,3, Kundan Sharma 4, Srivatsa Dwarakanath 1,

More information

NZYGene Synthesis kit

NZYGene Synthesis kit Kit components Component Concentration Amount NZYGene Synthesis kit Catalogue number: MB33901, 10 reactions GS DNA Polymerase 1U/ μl 30 μl Reaction Buffer for GS DNA Polymerase 10 150 μl dntp mix 2 mm

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information