Supplementary Information
|
|
- Donna Morton
- 5 years ago
- Views:
Transcription
1 Supplementary Information Two new susceptibility loci for Kawasaki disease identified through genome-wide association analysis Yi-Ching Lee 1,2, Ho-Chang Kuo 3,4, Jeng-Sheng Chang,Luan-Yin Chang 6,1, Li-Min Huang 6,1, Ming-Ren Chen 7, Chi-Di Liang 3,4, Hsin Chi 7,1, Fu-Yuan Huang 7, Meng-Luen Lee 8, Yhu-Chering Huang 9,10,1, Betau Hwang 11, Nan-Chang Chiu 7,1, Kao-Pin Hwang 3,12,13,1, Pi-Chang Lee 14, Li-Ching Chang 1, Yi-Min Liu 1, Ying-Ju Chen 1, Chien-Hsiun Chen 1,13, Taiwan Pediatric ID Alliance 1, Yuan-Tsong Chen 1,16*, Fuu-Jen Tsai 13,17,18* 1, 13*, Jer-Yuarn Wu 1 Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan 2 Institute of Molecular Medicine, National Tsing Hua University, Hsinchu, Taiwan 3 Department of Pediatrics, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung, Taiwan 4 Graduate Institute of Clinical Medical Science, Chang Gung University College of Medicine, Kaohsiung, Taiwan. Department of Pediatrics, China Medical University Hospital, Taichung, Taiwan 6 Department of Pediatrics, National Taiwan University Hospital, Taipei, Taiwan 7 Department of Pediatrics, Mackay Memorial Hospital, Taipei, Taiwan 8 Department of Pediatrics and Divisions of Pediatric Cardiology, Changhua Christian Hospital, Changhua, Taiwan 9 Division of Pediatric Infectious Diseases, Chang Gung Memorial Hospital at Linkou, Taoyuan, Taiwan 10 Chang Gung University College of Medicine, Taoyuan, Taiwan 11 Department of Pediatrics, Taipei City Hospital, ZhongXiao Branch, Taipei, Taiwan 12 Division of Pediatrics Infectious Diseases, Department of Pediatrics, China Medical University Hospital, Taichung, Taiwan 13 School of Chinese Medicine, China Medical University, Taichung, Taiwan 14 Department of Pediatrics, Taipei Veterans General Hospital, Taipei, Taiwan. 1 Taiwan Pediatric ID Alliance. A complete list of the Alliance and affiliations appears at the Supplementary Note. 16 Department of Pediatrics, Duke University Medical Center, Durham, North Carolina, United States of American 17 Department of Medical Genetics, China Medical University Hospital, Taichung, Taiwan 18 Department of Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan 1
2 Supplementary Note Taiwan Pediatric ID Alliance: Luan-Yin Chang, Chun-Yi Lu, Pei-Lan Shao, Li-Min Huang (Department of Pediatrics, National Taiwan University Hospital, Taipei, Taiwan) Nan-Chang Chiu, Hsin Chi, Daniel Tsung-Ning Huang (Department of Pediatrics, Mackay Memorial Hospital, Taipei, Taiwan) Hsiao-Chuan Lin, Kao-Pin Hwang, Ting-Yu Yen, Tsung-Hsueh Hsieh (Department of Pediatrics, China Medical University Hospital, Taichung, Taiwan) Yungling Leo Lee (Institute of Epidemiology and Preventive Medicine, National Taiwan University, Taipei, Taiwan) Ching-Chuan Liu, Shih-Min Wang (Department of Pediatrics, National Cheng-Kung University Hospital, Tainan, Taiwan) Shun-Cheng Yang (Department of Pediatrics, Changhua Christian Hospital, Changhua, Taiwan) Yu-Chia Hsieh, Yhu-Chering Huang, Cheng-Hsun Chiu (Department of Pediatrics,Chang Gung Hospital, Taoyuan, Taiwan) Jin-Town Wang (Department of Microbiology, National Taiwan University College of Medicine, Taipei, Taiwan) Yu-Huai Ho (Department of Pediatrics, Tzu Chi University, Hualien, Taiwan) Jung-Jung Mu (Research and Diagnostic Center, Centers for Disease Control, Taiwan) Yi-Chuan Huang (Department of Pediatrics, Chang Gung Hospital, Kaohsiung, Taiwan) Supplementary Figures 2
3 3
4 4
5 Supplementary Figure 1: Principal components analysis and Q Q plot for the trend test. (a) We used EIGENSTRAT 2.0 to conduct principal components analysis (PCA) with HapMap III data to correct our data for population stratification in GWAS. PCA was carried out based on the genotype data of 40,000 SNPs, roughly equal spacing across the human genome and selected from 716,93 high-quality SNPs in KD
6 6
7 Supplementary Figure 2: The LD structure and logistic regression analyses in BLK region. (a) LD patterns, D value and r 2 among the disease-associated SNPs (P < ) in BLK region. (b) The P-values for the rs and the linked SNPs in logistic regression models conditioned on rs The insignificant effects of the linked SNPs in the logistic regression models conditioned on rs indicated the linked SNPs were individually confounded with rs due to the strong LD with rs In particular, rs and rs were confounded that one showed 7
8 an insignificant association when conditioned on the other. Supplementary Figure 3: The LD structure and logistic regression analyses in CD40 region. (a) LD patterns, D value and r 2 among the disease-associated SNPs (P < ) in CD40 region. (b) The P values for the rs and the linked SNPs in logistic regression models conditioned on rs The insignificant effects of the linked SNPs in the logistic regression models conditioned on rs indicated all of the linked SNPs were individually confounded with rs due to the strong LD with rs
9 Supplementary Figure 4: Regional association, recombination rate, and linkage disequilibrium plots at the Chr 19 ITPKC/MIA regions. Top panel: regional association plot and recombination rate for the associated region, with gene annotations superimposed. The log 10 P values (left y-axis) for the trend test from the primary GWAS scan are shown as blue diamonds, and the red squares represent joint analysis of the GWAS and replication study. The estimated recombination rates (right y-axis) based on the Chinese HapMap population are plotted in light green across the region. Bottom panel: Regional LD plot (using D algorithm) for all SNPs in the top panel using data from the GWAS. Gene annotations are based on NCBI Build
10 Supplementary Figure : Regional association plots at the Chr 6 MHC region. The log 10 P values (y-axis) for the trend test from the primary GWAS scan are shown as blue diamonds. 10
11 Supplementary Table 1: Quality control of participant data. Number at start of QC 90,38 SNPs SNPs dropped during exclusion steps: Nonpolymorphic in patients and controls Call rate in patients or controls <9% Overall MAF < % and total call rate <99% HWE for control (P < 10 4 ) with polymorphic in control Number at end of QC 66,429 SNPs 66,46 SNPs 23,130 SNPs 32,318 SNPs 716,93 SNPs HWE, Hardy Weinberg equilibrium; MAF, minor allele frequency; QC, quality control. 11
12 Supplementary Table 2: All SNPs (n = 101) with P trend < 10 4 in the GWAS. Risk RAF RAF Risk allele OR Chr SNP Position Gene Allele Allele Controls Patients Trend P (9%CI) 1 rs no gene AC A E ( ) 1 rs RNF187 CT T E ( ) 2 rs no gene CT T E ( ) 2 rs no gene AG G E ( ) 2 rs no gene CT C E ( ) 3 rs LOC AC A E ( ) 3 rs SLC6A6 AG A E ( ) 3 rs SLC12A8 CG C E ( ) 3 rs COPB2 CG G E ( ) 3 rs COPB2 AC A E ( ) 3 rs COPB2 AG G E ( ) 3 rs COPB2 CT C E ( ) 3 rs PPM1L AG G E ( ) 4 rs SRDA2L2 AG G E ( ) 4 rs SRDA2L2 AC A E ( ) 4 rs SRDA2L2 CT T E ( ) 4 rs LOC64699 GT T E ( ) 4 rs LOC64699 AG G E ( ) 4 rs LOC64699 CT T E ( ) 4 rs LOC64699 GT T E ( ) 4 rs DDX60L AG A E ( ) 4 rs DDX60L GT T E ( ) rs LOC7283 AG A E ( ) rs no gene AT A E ( ) 6 rs LOC CT C E ( ) 6 rs LOC CG C E ( ) 6 rs LOC AG G E ( ) 6 rs LOC CG G E ( ) 6 rs LRRC16 AG G E ( ) 6 rs LRRC16 CG C E ( ) 6 rs PARK2 AG A E ( ) 6 rs PARK2 AC A E ( ) 7 rs no gene AT T E ( ) 7 rs BMPER AC A E ( ) 7 rs FLJ23834 CG G E ( ) 12
13 7 rs no gene CT T E ( ) 8 rs no gene AT A E ( ) 8 rs BLK CT T E ( ) 8 rs BLK CT T E ( ) 8 rs BLK AG G E ( ) 8 rs BLK AG A E ( ) 8 rs BLK AG G E ( ) 8 rs BLK CG G E ( ) 8 rs BLK CT C E ( ) 8 rs BLK AG G E ( ) 8 rs BLK AC A E ( ) 8 rs BLK CG G E ( ) 8 rs BLK CT C E ( ) 8 rs BLK AT T E ( ) 8 rs no gene CT C E ( ) 8 rs no gene CT C E ( ) 8 rs MED30 AG G E ( ) 8 rs MED30 CT C E ( ) 9 rs ROR2 CT T E ( ) 10 rs no gene CT T E ( ) 11 rs no gene AG G E ( ) 11 rs SPI1 AC A E ( ) 11 rs SPI1 CG G E ( ) 11 rs SPI1 AG A E ( ) 11 rs SPI1 CT T E ( ) 11 rs MTCH2 AG G E ( ) 11 rs no gene AG A E ( ) 11 rs no gene AG G E ( ) 11 rs no gene AG G E ( ) 11 rs CADM1 CT T E ( ) 12 rs CLEC4A GT G E ( ) 13 rs HS6ST3 GT T E ( ) 13 rs COL4A2 CT T E rs KNS2 CT C E ( ) 1 rs ARPP-19 AG G E rs no gene AC C E ( ) 1 rs BTBD1 CT C E ( ) 1 rs BTBD1 AG G E ( ) 13
14 1 rs BTBD1 CT C E ( ) 16 rs CLEC3A AG G E ( ) 16 rs CLEC3A AC A E ( ) 16 rs CLEC3A AG G E ( ) 16 rs CLEC3A CT T E ( ) 16 rs CLEC3A AC A E ( ) 16 rs IRF8 CT T E ( ) 16 rs IRF8 CT T E ( ) 16 rs IRF8 AG A E ( ) 16 rs IRF8 GT T E ( ) 19 rs ITPKC AG A E ( ) 19 rs MIA AC C E ( ) 19 rs MIA CT T E ( ) 19 rs MIA AT A E ( ) 20 rs PROKR2 AG G E ( ) 20 rs PROKR2 AG G E ( ) 20 rs PROKR2 AG A E ( ) 20 rs CD40 CT C E ( ) 20 rs CD40 AC A E ( ) 20 rs CD40 CT C E ( ) 20 rs CD40 AC A E ( ) 20 rs CD40 GT G E ( ) 20 rs CD40 AC C E ( ) 20 rs CD40 CT C E ( ) 20 rs CD40 AG A E ( ) 20 rs CD40 GT T E ( ) 20 rs CD40 CT T E ( ) 21 rs no gene AT T E ( ) Chr, chromosome; RAF controls, risk allele frequency in controls; RAF patients, risk allele frequency in KD patients; risk allele OR: risk-allele odds ratio; Trend P, P value derived from a one-degree-of-freedom of Armitage trend test. SNPs failed assay design for Sequenom platform were highlighted in yellow; SNPs not reach 99% successful rate or not reach 99% concordance between Affymetrix and Sequenom platform were highlighted in pink; SNPs departed significantly from Hardy Weinberg equilibrium (P< 10 4 ) in replication cohort were highlighted in light green; SNPs successfully analyzed in the replication collection were remained in white background. 14
15 Supplementary Table 3. SNPs with P < 10-4 in the KD GWAS collection and P <0.0 in the KD replication collection and results of joint analysis. RAF Allele Risk Control RAF Chr. SNP Position Gene format Allele Stage s Patients TrendP Risk Allele OR (9% CI) 3 rs COPB2 CG G GWAS Replication rs PPM1L AG G GWAS Replication rs SRDA2L2 AC A GWAS Replication rs BLK CT T GWAS Replication rs BLK CT T GWAS Replication rs BLK AG G GWAS Replication ( ) ( ) ( ) ( ) 1.81 ( ) ( ) ( ) ( ) ( ) 1.14 ( ) 1.91 ( ) 1.38 ( ) ( ) 1.43 ( ) ( ) ( ) ( ) 1.24 ( ) 1
16 8 rs BLK AG A GWAS Replication rs BLK AG G GWAS Replication rs BLK CG G GWAS Replication rs BLK CT C GWAS Replication rs BLK AG G GWAS Replication rs BLK AC A GWAS replication rs BLK CG G GWAS Replication rs BLK CT C GWAS Replication ( ) 1.18 ( ) ( ) 1.48 ( ) 1.1 ( ) ( ) 1.49 ( ) 1.7 ( ) ( ) 1.43 ( ) 1.3 ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) 1.42 ( ) ( ) ( ) 1.96 ( ) 16
17 rs BLK AT T GWAS replication rs MED30 AG G GWAS replication rs MED30 CT C GWAS replication rs CD40 AC A GWAS replication rs CD40 CT C GWAS replication rs CD40 AC A GWAS replication rs CD40 AC C GWAS replication rs CD40 CT C GWAS ( ) ( ) 1.33 ( ) ( ) ( ) 2.31 ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) ( ) 1.41 ( ) ( ) ( ) 1.38 ( ) ( ) 17
18 replication ( ) 1.34 ( ) 20 rs CD40 AG A GWAS ( ) replication ( ) ( ) Gene, genes containing the SNP or the closest gene up to 0 kb up or downstream of the SNP; RAF controls, risk allele frequency in controls; RAF patients, risk allele frequency in KD patients; risk allele OR: risk-allele odds ratio; 9%CI, 9% confidence interval. The SNPs with genome-wide significance (P <10-8 in the joint analysis) were highlighted with bold typeface. 18
19 Supplementary Table 4: The 4 P-values of 23 SNPs resulted from (1) the original association analysis (2) analysis with PCA justification (C1 to C10), (3) analysis after removing 4 outliers, and (4) analysis with PCA justification (C1 to C10) after removing 4 outliers. KW622SC1107 KW622SC1103 KW622SC1107 adjusted KW622SC1103 adjusted SNPs allele chr P trend P trend P trend P trend rs CG E E E E-04 rs AG E E E E-04 rs AC 4.726E E E E-0 rs CT E E E E-07 rs CT E E E E-0 rs AG E E E E-06 rs AG E E E E-06 rs AG E E E E-06 rs CG E E E E-06 rs CT E E E E-06 rs AG E E E E-0 rs AC E E E E-0 rs CG E E E E-0 rs CT E E E E-0 rs AT E E E E-0 rs AG E E E E-04 rs CT E E E E-04 rs AC E E E-0 rs CT E E E E-0 rs AC E E E E-07 rs AC E E E E-0 rs CT E E E E-0 rs AG E E E E-0 19
20 Supplementary Table : Results of heterogeneity test between GWAS and replication groups. Heterogeneity Trend-P Combined P a SNPs chr A1 A2 Q test I 2 GWAS Replicate rs G C E E E-0 rs G A E E E-0 rs A C E E-02.4E-07 rs C T E E E-09 rs C T E E E-07 rs A G E E E-09 rs G A E E E-08 rs A G E E E-08 rs C G E E E-08 rs T C E E E-08 rs A G E E E-07 rs C A E E E-07 rs C G E-0.62E E-07 rs T C E E E-08 rs A T E E E-06 rs G A E E E-07 rs C T E E E-07 rs C A E E E-06 rs T C E-0 3.9E E-06 rs C A E E E-09 rs A C E E E-07 rs T C E-0 3.9E E-07 rs G A E E E-06 a the combined P values were determined by Cochran-Mantel- Haenszel stratification analysis. 20
21 Supplementary Table 6: Association of the significant SNPs (P <10-4 ) in chromosome 19 q13 region in GWAS samples separated into previously reported GWAS samples and newly genotyped GWAS samples. SNP Allele Risk allele Stage RAF Controls RAF Patients Trend P rs AG A previous newly added total E-0 rs AC C previous newly added total E-06 rs CT T previous newly added total E-0 rs AT A previous newly added total E-0 RAF Controls: risk allele frequency in controls RAF Patients: risk allele frequency in KD cases Trend P: P-value derived from a 1 degree of freedom of Armitage trend test. Previous: The 20 KD samples and 446 control samples genotyped in previously report. (Tsai et al., PoLS ONE 6(2): e1683) New added: The newly genotyped samples including 372 KD samples and 661 controls Total: all 622 KD samples and 1107 samples. 21
22 Supplementary Table 7: The call rat, MAF, HWEP and association of SNPs, rs , rs , rs223312, within Chr.19q13 in GWAS and replication studies Stage Minor Call rate MAF HWEP Call rate MAF HWEP SNP Allele Allele Controls Controls Controls Patients Patients Patients Trend P rs GWAS AG A E-0 Rep rs GWAS AC C E-06 Rep rs GWAS CT T E-0 Rep Rep.: the replication stage MAF Controls: minor allele frequency in controls MAF Patients: minor allele frequency in KD cases Trend P: P-value derived from a 1 degree of freedom of Armitage trend test. 22
23 Supplementary Table 8: The SNPs in chromosome 1 FCGR2A region with P < 0.00 in the GWAS samples separated into previously reported GWAS samples and newly genotyped GWAS samples and their. SNP Allele Risk allele RAF Controls RAF Patients Trend P rs AG A previous newly added total rs CT C previous newly added total rs64279 AG G previous newly added total rs7347 AC C previous newly added total rs AG G previous newly added total rs CT T previous newly added total RAF Controls: risk allele frequency in controls RAF Patients: risk allele frequency in KD cases Trend P: P-value derived from a 1 degree of freedom of Armitage trend test. Previous: The 20 KD samples and 446 control samples genotyped in previously report. (Tsai et al., PoLS ONE 6(2): e1683) New added: The newly genotyped samples including 372 KD samples and 661 controls Total: all 622 KD samples and 1107 samples. 23
24 Supplementary Table 9: Demographic and clinical characteristics of participants in the GWAS and replication study. Characteristics GWAS cohort Follow-up cohort Patients (male%) 622 (64.31%) 261 (62.07%) CAA a / PE b (%) 16/86 (28.11%) 73/223 (32.74%) Control (male%) 1107 (48.87%) 0 (8.18 %) a CAA: significant coronary artery dilatation on echocardiogram at 4-8 weeks after the onset of the illness b PE: patients with echocardiographic data available 24
Supplementary Figure 1. Study design of a multi-stage GWAS of gout.
Supplementary Figure 1. Study design of a multi-stage GWAS of gout. Supplementary Figure 2. Plot of the first two principal components from the analysis of the genome-wide study (after QC) combined with
More informationGenome-wide association study identifies five loci associated with susceptibility to pancreatic cancer in Chinese populations. Supplementary Materials
Genome-wide association study identifies five loci associated with susceptibility to pancreatic cancer in Chinese populations Supplementary Materials Chen Wu 1, 22, Xiaoping Miao 2, 22, Liming Huang 1,
More information2017 Qualifying Examination
B1 1 Basic Molecular Genetics Mechanisms Dr. Ueng-Cheng Yang Molecular Genetics Techniques Cellular Energetics 24 2 Dr. Dar-Yi Wang Transcriptional Control of Gene Expression 8 3 Dr. Chuan-Hsiung Chang
More informationWhere innovations are shaping a new era of intelligent healthcare
EXPO 11.29-12.02 TAIWAN Where innovations are shaping a new era of intelligent healthcare World-class medical centers and advanced medical specialties Most influential IT, ICT & Electronics industry in
More informationSupplementary Figure 1. Linkage disequilibrium (LD) at the CDKN2A locus
rs3731249 rs3731217 Supplementary Figure 1. Linkage disequilibrium (LD) at the CDKN2A locus. Minimal correlation was observed (r 2 =0.0007) in Hapmap CEU individuals between B ALL risk variants rs3731249
More informationIAM2016W Program. January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 29, 2016 (Friday) 09:30-15:00 Registration
IAM2016W Program January 27, 2016 (Wednesday) 15:00-16:30 Registration (Lobby) January 28, 2016 (Thursday) 09:30-15:00 Registration 10:00-12:00 Session A 13:30-15:30 Session B January 29, 2016 (Friday)
More informationUnderstanding genetic association studies. Peter Kamerman
Understanding genetic association studies Peter Kamerman Outline CONCEPTS UNDERLYING GENETIC ASSOCIATION STUDIES Genetic concepts: - Underlying principals - Genetic variants - Linkage disequilibrium -
More informationNature Genetics: doi: /ng.3143
Supplementary Figure 1 Quantile-quantile plot of the association P values obtained in the discovery sample collection. The two clear outlying SNPs indicated for follow-up assessment are rs6841458 and rs7765379.
More informationGenome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma. Supplementary Information
Genome-wide association study identifies a susceptibility locus for HCVinduced hepatocellular carcinoma Vinod Kumar 1,2, Naoya Kato 3, Yuji Urabe 1, Atsushi Takahashi 2, Ryosuke Muroyama 3, Naoya Hosono
More informationSupplementary Figure 1 a
Supplementary Figure 1 a b GWAS second stage log 10 observed P 0 2 4 6 8 10 12 0 1 2 3 4 log 10 expected P rs3077 (P hetero =0.84) GWAS second stage (BBJ, Japan) First replication (BBJ, Japan) Second replication
More informationSupplementary Figures
1 Supplementary Figures exm26442 2.40 2.20 2.00 1.80 Norm Intensity (B) 1.60 1.40 1.20 1 0.80 0.60 0.40 0.20 2 0-0.20 0 0.20 0.40 0.60 0.80 1 1.20 1.40 1.60 1.80 2.00 2.20 2.40 2.60 2.80 Norm Intensity
More informationGenome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis
correction notice Nat. Genet. 45, 613 620 (2013); published online 14 April 2013; corrected online 1 October 2013 Genome-wide association study identifies multiple susceptibility loci for pulmonary fibrosis
More informationA genome-wide association study in Han Chinese identifies new susceptibility loci for. ankylosing spondylitis. Supplementary Materials
A genome-wide association study in Han Chinese identifies new susceptibility loci for ankylosing spondylitis Supplementary Materials Zhiming Lin 1,24, Jin-Xin Bei 2,24, Meixin Shen 3, Qiuxia Li 1, Zetao
More informationEPIB 668 Genetic association studies. Aurélie LABBE - Winter 2011
EPIB 668 Genetic association studies Aurélie LABBE - Winter 2011 1 / 71 OUTLINE Linkage vs association Linkage disequilibrium Case control studies Family-based association 2 / 71 RECAP ON GENETIC VARIANTS
More informationPoster Session 1. Room: 4F, Building B
Poster Session 1 Time:13:30-15:00 Guoqing Ma, Yantai University, China Jieh-Shian Young, National Changhua University of Education, Taiwan 1005 ESTABLISHING A SMART HOME BASED ON NI MYRIO Kai-chao Yao,
More informationFamilial Breast Cancer
Familial Breast Cancer SEARCHING THE GENES Samuel J. Haryono 1 Issues in HSBOC Spectrum of mutation testing in familial breast cancer Variant of BRCA vs mutation of BRCA Clinical guideline and management
More informationSupplementary table 1: List of sequences of primers used in sequenom assay
Supplementary table 1: List of sequences of primers used in sequenom assay SNP_ID 2nd-PCRP Sequence 1st-PCRP Sequence Allele specific (iplex) iplex primer primer Direction ROCK2 1 rs978906 ACGTTGGATGATAAAGCTCTCTCGGCAGTC
More information4.1.1 Association of SNP variants within PARK2-PACRG gene regulatory region with leprosy susceptibility sharing chromosomal region 6q26
4.1 GENETIC VARIATIONS IN PARK2 AND PACRG GENE REGULATORY REGIONS AND THEIR INTERACTION WITH IMPORTANT IMMUNO-REGULATORY GENES IN THE OUTCOME OF LEPROSY PARK2 and PACRG gene regulatory region was saturated
More informationNature Genetics: doi: /ng Supplementary Figure 1. Eigenvector plots for the three GWAS including subpopulations from the NCI scan.
Supplementary Figure 1 Eigenvector plots for the three GWAS including subpopulations from the NCI scan. The NCI subpopulations are as follows: NITC, Nutrition Intervention Trial Cohort; SHNX, Shanxi Cancer
More informationGenome-wide association studies (GWAS) Part 1
Genome-wide association studies (GWAS) Part 1 Matti Pirinen FIMM, University of Helsinki 03.12.2013, Kumpula Campus FIMM - Institiute for Molecular Medicine Finland www.fimm.fi Published Genome-Wide Associations
More informationAnalysis of genome-wide genotype data
Analysis of genome-wide genotype data Acknowledgement: Several slides based on a lecture course given by Jonathan Marchini & Chris Spencer, Cape Town 2007 Introduction & definitions - Allele: A version
More informationSupplementary Online Content
Supplementary Online Content Lee JH, Cheng R, Barral S, Reitz C, Medrano M, Lantigua R, Jiménez-Velazquez IZ, Rogaeva E, St. George-Hyslop P, Mayeux R. Identification of novel loci for Alzheimer disease
More informationA genome wide association study of metabolic traits in human urine
Supplementary material for A genome wide association study of metabolic traits in human urine Suhre et al. CONTENTS SUPPLEMENTARY FIGURES Supplementary Figure 1: Regional association plots surrounding
More informationS G. Design and Analysis of Genetic Association Studies. ection. tatistical. enetics
S G ection ON tatistical enetics Design and Analysis of Genetic Association Studies Hemant K Tiwari, Ph.D. Professor & Head Section on Statistical Genetics Department of Biostatistics School of Public
More informationH3A - Genome-Wide Association testing SOP
H3A - Genome-Wide Association testing SOP Introduction File format Strand errors Sample quality control Marker quality control Batch effects Population stratification Association testing Replication Meta
More informationSupplementary table 1. Study design
Supplementary table 1. Study design Population GWAS genotyping platform N Case/Controls After genotyping quality controls Genotyped SNPs Analyzed SNPs (overlapping between populations) Statistical Power*
More informationA candidate gene study of the type I interferon pathway implicates IKBKE and IL8 as risk loci for SLE
A candidate gene study of the type I interferon pathway implicates IKBKE and IL8 as risk loci for SLE Johanna K. Sandling, Sophie Garnier, Snaevar Sigurdsson, Chuan Wang, Gunnel Nordmark, Iva Gunnarsson,
More informationTitle: Association of BAK1 single nucleotide polymorphism with a risk for dengue hemorrhagic fever
Author s response to reviews Title: Association of BAK1 single nucleotide polymorphism with a risk for dengue hemorrhagic fever Authors: Tran Ngoc Dang (ngocdangytcc@gmail.com) Izumi Naka (izumin-tky@umin.ac.jp)
More information國際期刊 SCI 論文 Wei-Lung Chou* Accepted in October, 2009 (SCI, IF=1.155, 2008) (Corresponding author) Wei-Lung Chou* Accepted in September, 2009
SCI 1. Wei-Lung Chou*, Chih-Ta Wang, Kai-Yu Huang, Investigation of process parameters for the removal of polyvinyl alcohol from aqueous solution by iron electrocoagulation, Desalination, Accepted in October,
More informationMulti-SNP Models for Fine-Mapping Studies: Application to an. Kallikrein Region and Prostate Cancer
Multi-SNP Models for Fine-Mapping Studies: Application to an association study of the Kallikrein Region and Prostate Cancer November 11, 2014 Contents Background 1 Background 2 3 4 5 6 Study Motivation
More informationThe Application of RFID in Emergency Medicine
The Fourth International Conference on Electronic Business (ICEB2004) / Beijing 1201 The Application of RFID in Emergency Medicine Tsai W.C. 1, Frank Kuo 2, Yuehching Lee 2, F. Wu 2 1 Institute of Health
More informationThe Analysis of Chinese Authors Papers in Library and Information Science. Chen Yuecong1, a
2nd International Conference on Economy, Management and Education Technology (ICEMET 2016) The Analysis of Chinese Authors Papers in Library and Information Science Chen Yuecong1, a 1 Library of North
More informationPLINK gplink Haploview
PLINK gplink Haploview Whole genome association software tutorial Shaun Purcell Center for Human Genetic Research, Massachusetts General Hospital, Boston, MA Broad Institute of Harvard & MIT, Cambridge,
More informationSupplementary Figure 2.Quantile quantile plots (QQ) of the exome sequencing results Chi square was used to test the association between genetic
SUPPLEMENTARY INFORMATION Supplementary Figure 1.Description of the study design The samples in the initial stage (China cohort, exome sequencing) including 216 AMD cases and 1,553 controls were from the
More informationCOUNTRY SECTION. Taiwan Fishery products. Validity date from 17/04/2018 Date of publication 04/04/2018. List in force
COUNTRY SECTION Taiwan Fishery products Validity date from 17/04/2018 Date of publication 04/04/2018 00345 List in force 2F30017 I-Mei Frozen Foods Company Limited Su-Ao Township Yilan County 2F30036 Hsien-Pin
More informationOral Presentation Session
Oral Presentation Session 2016 International Conference on ICHTL May 6 th Session NO Title Aurthor 0002 Promoting hospitality students career decision making self-efficacy based on intern experiences Chung-Jen
More informationNo. Name College Major Email 1 Ke Yang Chuan College of Science Chemistry key@cup.edu.cn 2 Wang Li Qun College of Science Mathematics wliqunhmily@gmail.com 3 Xu Tao College of Science Mathematics xutao@cup.edu.cn
More informationSupplementary Figure 1. Quantile quantile plot for the combined analysis of cohorts 1 and 2.
Supplementary Figure 1 Quantile quantile plot for the combined analysis of cohorts 1 and 2. Quantile quantile plot of the observed log 10 (P values) versus the expectation under the null hypothesis. Data
More informationGenome Wide Association Studies
Genome Wide Association Studies Liz Speliotes M.D., Ph.D., M.P.H. Instructor of Medicine and Gastroenterology Massachusetts General Hospital Harvard Medical School Fellow Broad Institute Outline Introduction
More informationSupplementary Information. Werner Koch, Petra Hoppmann, Jakob C. Mueller, Albert Schömig & Adnan Kastrati
Supplementary Information Werner Koch, Petra Hoppmann, Jakob C. Mueller, Albert Schömig & Adnan Kastrati The Supplementary Information has the following sections in order: 1. Supplementary Methods 2. Supplementary
More informationThe 3 rd Asian Hygiene of Occupational Network Conference List of Poster Presentations
P1: Chemical Exposure and Control P101 Filtration characteristics of filtering facepieces Yu-Lin Tseng P102 Using silicone wristbands as a personal sampler to monitor the exposures of airborne terpenes
More informationGenetic Variation and Genome- Wide Association Studies. Keyan Salari, MD/PhD Candidate Department of Genetics
Genetic Variation and Genome- Wide Association Studies Keyan Salari, MD/PhD Candidate Department of Genetics How many of you did the readings before class? A. Yes, of course! B. Started, but didn t get
More informationA. Positions and Honors
BIOGRAPHICAL SKETCH NAME in English Chao-Sung Lai NAME in Chinese 賴朝松 POSITION TITLE Professor, Department of Electronic Engineering EDUCATION/TRAINING INSTITUTION AND LOCATION DEGREE (if applicable) MM/YY
More informationInternational Journal of Information Technology and Business Management 29 th March, Vol.35 No JITBM & ARF. All rights reserved
A STUDY ON THE INDICATOR-WEIGHT EVALUATION OF CITY COMPETITIVENESS IN THE SELECTION OF CONVENTION/EXHIBITION VENUE FOR MICE INDUSTRY DEVELOPMENT: USING TAIPEI CITY AS AN EXAMPLE Mei-Hsien Huang 1, Tracy
More information3. Department of Biomedical Engineering, Chung Yuan Christian University, Taiwan
Chun-Hsu Yao, Ph.D. Professor, Department of Biological Imaging and Radiological Science, School of Chinese Medicine, China Medical University, Taichung, Taiwan Tel:886-4-22053366 ext.7806;3325 e-mail:chyao@mail.cmu.edu.tw
More informationResults of Applications for the 2016 Integrated Thematic Projects at Academia Sinica Announced
Results of Applications for the 2016 Integrated Thematic Projects at Academia Announced There is a total of 23 applications for the 2016 Thematic Projects (7 from Division of Mathematics and Physical Sciences;
More informationACCEPTED. Victoria J. Wright Corresponding author.
The Pediatric Infectious Disease Journal Publish Ahead of Print DOI: 10.1097/INF.0000000000001183 Genome-wide association studies in infectious diseases Eleanor G. Seaby 1, Victoria J. Wright 1, Michael
More informationTHE HEALTH AND RETIREMENT STUDY: GENETIC DATA UPDATE
: GENETIC DATA UPDATE April 30, 2014 Biomarker Network Meeting PAA Jessica Faul, Ph.D., M.P.H. Health and Retirement Study Survey Research Center Institute for Social Research University of Michigan HRS
More informationStatistical challenges to genome-wide association study
1 Statistical challenges to genome-wide association study Naoyuki Kamatani, M.D., Ph.D. 1. Director and Professor, Institute of Rheumatology, Tokyo Women s Medical University 2. Director, Medical Informatics
More informationTeng-Sheng Sang, Ph.D. Associate Professor Department of Accounting College of Business, Chung Yuan Christian University
Teng-Sheng Sang, Ph.D. Associate Professor Department of Accounting College of Business, Chung Yuan Christian University sts701r@cycu.edu.tw Academic Background Ph.D. Accounting, National Taipei University,
More informationPopulation stratification. Background & PLINK practical
Population stratification Background & PLINK practical Variation between, within populations Any two humans differ ~0.1% of their genome (1 in ~1000bp) ~8% of this variation is accounted for by the major
More informationDepartment of Business Administration, National Central University, Taiwan. Industrial Engineering and Management Sciences,
Chien-wen Shen Experience Associate Professor 2014/08 Present Department of Business Administration, National Central University, Taiwan Director 2015/03 Present Yunus Social Business Centre, National
More informationAssociation studies (Linkage disequilibrium)
Positional cloning: statistical approaches to gene mapping, i.e. locating genes on the genome Linkage analysis Association studies (Linkage disequilibrium) Linkage analysis Uses a genetic marker map (a
More informationLecture 3: Introduction to the PLINK Software. Summer Institute in Statistical Genetics 2015
Lecture 3: Introduction to the PLINK Software Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2015 1 / 1 PLINK Overview PLINK is a free, open-source whole genome association analysis
More informationSingle drop Whole Blood Diagnostics: Portable Biomedical Sensor for cardiac. Troponin I detection
Single drop Whole Blood Diagnostics: Portable Biomedical Sensor for cardiac Troponin I detection Indu Sarangadharan 1, Shin-Li Wang 1, Revathi Sukesan 1, Pei-chi Chen 1, Tze-Yu Dai 1, Anil Kumar Pulikkathodi,
More informationPrincipal Component Analysis in Genomic Data
Principal Component Analysis in Genomic Data Seunggeun Lee Department of Biostatistics University of North Carolina at Chapel Hill March 4, 2010 Seunggeun Lee (UNC-CH) PCA March 4, 2010 1 / 12 Bio Korean
More informationLecture 3: Introduction to the PLINK Software. Summer Institute in Statistical Genetics 2017
Lecture 3: Introduction to the PLINK Software Instructors: Timothy Thornton and Michael Wu Summer Institute in Statistical Genetics 2017 1 / 20 PLINK Overview PLINK is a free, open-source whole genome
More informationDetecting gene-gene interactions in high-throughput genotype data through a Bayesian clustering procedure
Detecting gene-gene interactions in high-throughput genotype data through a Bayesian clustering procedure Sui-Pi Chen and Guan-Hua Huang Institute of Statistics National Chiao Tung University Hsinchu,
More informationSupplementary Fig. 1. Location of top two candidemia associated SNPs in CD58 gene
Supplementary Figures Supplementary Fig. 1. Location of top two candidemia associated SNPs in CD58 gene locus. The region encompass CD58 and three long non-coding RNAs (RP4-655J12.4, RP5-1086K13.1 and
More informationGenome-Wide Association Studies. Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey
Genome-Wide Association Studies Ryan Collins, Gerissa Fowler, Sean Gamberg, Josselyn Hudasek & Victoria Mackey Introduction The next big advancement in the field of genetics after the Human Genome Project
More informationIAM2017W Program. Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) Feb. 9, 2017 (Thursday) 08:00-16:00 Registration
IAM2017W Program Feb. 7, 2017 (Tuesday) 15:00-16:30 Registration (HATSUNE 初音, 5F) Room 08:30-10:10 Session A Feb. 8, 2017 (Wednesday) 08:00-16:00 Registration HATSUNE 初音 (5F) 10:10-10:30 Social Time (Refreshment)
More informationIAM2018W Program. Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration
IAM2018W Program Jan. 30, 2018 (Tuesday) 15:30-16:30 Registration (Lobby, 1F) Room Jan. 31, 2018 (Wednesday) 07:30-17:00 Registration Olive Ⅰ (3F) 08:05-09:50 Session A 09:50-10:10 Social Time (Refreshments)
More informationAuthor's response to reviews
Author's response to reviews Title: A pooling-based genome-wide analysis identifies new potential candidate genes for atopy in the European Community Respiratory Health Survey (ECRHS) Authors: Francesc
More informationLinkage Disequilibrium
Linkage Disequilibrium Why do we care about linkage disequilibrium? Determines the extent to which association mapping can be used in a species o Long distance LD Mapping at the tens of kilobase level
More informationAppendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by
Appendix 5: Details of statistical methods in the CRP CHD Genetics Collaboration (CCGC) [posted as supplied by author] Statistical methods: All hypothesis tests were conducted using two-sided P-values
More informationAbstract. PLOS ONE 1 August 2013 Volume 8 Issue 8 e72037
Replication and Meta-Analysis of GWAS Identified Susceptibility Loci in Kawasaki Disease Confirm the Importance of B Lymphoid Tyrosine Kinase (BLK) in Disease Susceptibility Chia-Jung Chang 1,2, Ho-Chang
More informationAssociation Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010
Association Mapping in Plants PLSC 731 Plant Molecular Genetics Phil McClean April, 2010 Traditional QTL approach Uses standard bi-parental mapping populations o F2 or RI These have a limited number of
More information臺灣獎學金聯盟大學清單 A list of University Sponsored by the Taiwan Scholarship Project 2015
1 North 大同大學 Tatung University http://www.ttu.edu.tw http://www.en.ttu.edu.tw 2 North 國立政治大學 National Chengchi University http://www.nccu.edu.tw http://www.nccu.edu.tw/english 3 North 國立陽明大學 National Yang-Ming
More informationJOURNAL PAPERS [SCI IF=2.788, 29/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 共 5 頁, 第 1 頁
JOURNAL PAPERS [SCI IF=4.338, 13/122, RADIOLOGY, NUCLEAR MEDICINE & MEDICAL IMAGING] 1. Jui-Hsun Fu, Tzu-Chao Chuang, Hsiao-Wen Chung, Hing-Chiu Chang, Huey-Shyan Lin, Shu-Shong Hsu, Po-Chin Wang, Shuo-Hsiu
More informationIntroduction to Add Health GWAS Data Part I. Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill
Introduction to Add Health GWAS Data Part I Christy Avery Department of Epidemiology University of North Carolina at Chapel Hill Outline Introduction to genome-wide association studies (GWAS) Research
More informationFFGWAS. Fast Functional Genome Wide Association AnalysiS of Surface-based Imaging Genetic Data
FFGWAS Fast Functional Genome Wide Association AnalysiS of Surface-based Imaging Genetic Data Chao Huang Department of Biostatistics Biomedical Research Imaging Center The University of North Carolina
More informationSupporting Information
Supporting Information De Jager et al. 10.1073/pnas.0813310106 SI Methods Genotyping. In the initial screen of the Brigham and Women s Hospital samples, SNPs were genotyped using the iplex Sequenom MassARRAY
More informationTyping of 67 SNP Loci on X Chromosome by PCR and MALDI-TOF MS
IBIMA Publishing Research in Genetics http://www.ibimapublishing.com/journals/rigs/rigs.html Vol. 2015 (2015), Article ID 374688, 9 pages DOI: 10.5171/2015.374688 Research Article Typing of 67 SNP Loci
More informationRedefine what s possible with the Axiom Genotyping Solution
Redefine what s possible with the Axiom Genotyping Solution From discovery to translation on a single platform The Axiom Genotyping Solution enables enhanced genotyping studies to accelerate your research
More informationSNPs - GWAS - eqtls. Sebastian Schmeier
SNPs - GWAS - eqtls s.schmeier@gmail.com http://sschmeier.github.io/bioinf-workshop/ 17.08.2015 Overview Single nucleotide polymorphism (refresh) SNPs effect on genes (refresh) Genome-wide association
More informationGenetic data concepts and tests
Genetic data concepts and tests Cavan Reilly September 21, 2018 Table of contents Overview Linkage disequilibrium Quantifying LD Heatmap for LD Hardy-Weinberg equilibrium Genotyping errors Population substructure
More informationUsing the Association Workflow in Partek Genomics Suite
Using the Association Workflow in Partek Genomics Suite This user guide will illustrate the use of the Association workflow in Partek Genomics Suite (PGS) and discuss the basic functions available within
More informationProstate Cancer Genetics: Today and tomorrow
Prostate Cancer Genetics: Today and tomorrow Henrik Grönberg Professor Cancer Epidemiology, Deputy Chair Department of Medical Epidemiology and Biostatistics ( MEB) Karolinska Institutet, Stockholm IMPACT-Atanta
More informationAxiom mydesign Custom Array design guide for human genotyping applications
TECHNICAL NOTE Axiom mydesign Custom Genotyping Arrays Axiom mydesign Custom Array design guide for human genotyping applications Overview In the past, custom genotyping arrays were expensive, required
More informationHuman Genetics and Gene Mapping of Complex Traits
Human Genetics and Gene Mapping of Complex Traits Advanced Genetics, Spring 2015 Human Genetics Series Thursday 4/02/15 Nancy L. Saccone, nlims@genetics.wustl.edu ancestral chromosome present day chromosomes:
More informationDownloaded from:
Chang, CJ; Kuo, HC; Chang, JS; Lee, JK; Tsai, FJ; Khor, CC; Chang, LC; Chen, SP; Ko, TM; Liu, YM; Chen, YJ; Hong, YM; Jang, GY; Hibberd, ML; Kuijpers, T; Burgner, D; Levin, M; Burns, JC; Davila, S; International
More informationGlobal Entrepreneurship and Innovation in Management (GEIM) Conference
2014 Global Entrepreneurship and Innovation in Management (GEIM) Conference in partnership with Journal of Business Research Special Issue, May 14-15, 2014, Taichung, Taiwan College of Management National
More informationBlood Pressure and Hypertension Genetics
Blood Pressure and Hypertension Genetics Yong Huo, M.D. Wei Gao, M.D. Yan Zhang, M.D. Santhi K. Ganesh, M.D. Outline Blood pressure and hypertension in China Update on genetics of blood pressure BP/HTN
More informationSupplementary Note: Detecting population structure in rare variant data
Supplementary Note: Detecting population structure in rare variant data Inferring ancestry from genetic data is a common problem in both population and medical genetic studies, and many methods exist to
More informationGenome wide association studies. How do we know there is genetics involved in the disease susceptibility?
Outline Genome wide association studies Helga Westerlind, PhD About GWAS/Complex diseases How to GWAS Imputation What is a genome wide association study? Why are we doing them? How do we know there is
More informationGenoWatch: a disease gene mining browser for association study
W336 W340 Nucleic Acids Research, 2008, Vol. 36, Web Server issue Published online 25 April 2008 doi:10.1093/nar/gkn214 GenoWatch: a disease gene mining browser for association study Yan-Hau Chen 1, Chuan-Kun
More informationIdentifying rare and common disease associated variants in genomic data using Parkinson s disease as a model
Lin et al. Journal of Biomedical Science 2014, 21:88 RESEARCH Open Access Identifying rare and common disease associated variants in genomic data using Parkinson s disease as a model Ying-Chao Lin 1,2,3,
More informationResearch Article FCGR2A Promoter Methylation and Risks for Intravenous Immunoglobulin Treatment Responses in Kawasaki Disease
Hindawi Publishing Corporation Mediators of Inflammation Volume 2015, Article ID 564625, 5 pages http://dx.doi.org/10.1155/2015/564625 Research Article FCGR2A Promoter Methylation and Risks for Intravenous
More informationCURRICULUM VITAE. Editor-in-Chief, Maritime Business Review (Emerald Group Publishing)
CURRICULUM VITAE Professor Chin-Shan Lu ( 呂錦山 ), Ph.D. Address: Department of Logistics and Maritime Studies, Director, C.Y. Tung International Centre for Maritime Studies, The Hong Kong Polytechnic University,
More informationHigh-Mobility InSe Transistors: the Role of Surface Oxides
Supporting information of High-Mobility InSe Transistors: the Role of Surface Oxides Po-Hsun Ho, Yih-Ren Chang, Yu-Cheng Chu, Min-Ken Li, Che-An Tsai, Wei-Hua Wang, Ching-Hwa Ho, ± Chun-Wei Chen and Po-Wen
More informationSUPPLEMENTARY METHODS AND RESULTS
SUPPLEMENTARY METHODS AND RESULTS With: Genetic variation in the KIF1B locus influences susceptibility to multiple sclerosis Yurii S. Aulchenko 1,8, Ilse A. Hoppenbrouwers 2,8, Sreeram V. Ramagopalan 3,
More informationProgram Overview. DAY 1/ Jan. 7 th, :00~16:00 Registration. 16:00~17:30 NTUMSE Laboratory Tour. 18:00~20:00 Banquet, Taipei 101
Program Overview DAY 1/ Jan. 7 th, 2015 15:00~16:00 Registration 16:00~17:30 NTUMSE Laboratory Tour 18:00~20:00 Banquet, Taipei 101 DAY 2/ Jan. 8 th, 2015 08:30~08:40 Opening Talk, Dean Jia-Yush Yen, School
More informationOffice: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: ext.2677,
王志光教授 Chih-Kuang Wang, Ph.D. Office: No.1, Shih-Chuan 1st Road, Kaohsiung 807, Taiwan, ROC. Tel: +886-7-3121101 ext.2677, 2553 Email: ckwang@kmu.edu.tw Affiliation Division of Industry and University Cooperation,
More informationWhy do we need statistics to study genetics and evolution?
Why do we need statistics to study genetics and evolution? 1. Mapping traits to the genome [Linkage maps (incl. QTLs), LOD] 2. Quantifying genetic basis of complex traits [Concordance, heritability] 3.
More informationIntroduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies
Introduc)on to Sta)s)cal Gene)cs: emphasis on Gene)c Associa)on Studies Lisa J. Strug, PhD Guest Lecturer Biosta)s)cs Laboratory Course (CHL5207/8) March 5, 2015 Gene Mapping in the News Study Finds Gene
More informationDNA Collection. Data Quality Control. Whole Genome Amplification. Whole Genome Amplification. Measure DNA concentrations. Pros
DNA Collection Data Quality Control Suzanne M. Leal Baylor College of Medicine sleal@bcm.edu Copyrighted S.M. Leal 2016 Blood samples For unlimited supply of DNA Transformed cell lines Buccal Swabs Small
More informationShyh-Ming Huang ( 黃識銘 )
Shyh-Ming Huang ( 黃識銘 ) Department of Marketing and Logistics Management Southern Taiwan University of Science Technology No. 1, Nan-Tai Street, Yongkang Dist., Tainan City 71005, Taiwan Office: T1128
More informationBioinformatic Analysis of SNP Data for Genetic Association Studies EPI573
Bioinformatic Analysis of SNP Data for Genetic Association Studies EPI573 Mark J. Rieder Department of Genome Sciences mrieder@u.washington washington.edu Epidemiology Studies Cohort Outcome Model to fit/explain
More informationLecture 23: Causes and Consequences of Linkage Disequilibrium. November 16, 2012
Lecture 23: Causes and Consequences of Linkage Disequilibrium November 16, 2012 Last Time Signatures of selection based on synonymous and nonsynonymous substitutions Multiple loci and independent segregation
More information