Gene Prediction: Similarity-Based Approaches Spliced Alignment
|
|
- Blake Atkinson
- 5 years ago
- Views:
Transcription
1 Gene Prediction: Similarity-Based Approaches Spliced Alignment
2 Gene Prediction introns S exon exon exon he predicted gene November 15 2
3 Outline of Agenda he idea of similarity-based approach to gene prediction Previous Lecture: Exon Chaining Problem (2D Interval Chaining) his Lecture: Spliced Alignment Problem
4 Problem with 2D chaining Sometimes we know the exact chaining (gene sequence) in one of the two sequences would like to utilize this information better.
5 Using Known Genes to Predict New Genes Some genomes may be very well-studied, with many genes having been experimentally verified. Closely-related organisms may have similar genes Unknown genes in one species may be compared to genes in some closely-related species
6 Similarity-Based Approach to Gene Prediction he similarity-based approach uses known genes in one genome to predict (unknown) genes in another genome Problem: Given a known gene sequence and an (unannotated) genomic sequence S, find a set of non overlapping substrings S* of the genomic sequence S whose concatenation yields the highest similarity to (where similarity is measured in terms of an alignment score).
7 Gene Prediction Analogy: Selecting Putative Exons he cell carries DNA as a blueprint for producing proteins, like a manufacturer carries a blueprint for producing a car.
8 Assembling Candidate Exons
9 Using Blueprint
10 Assembling Candidate Exons Guided by known gene sequence
11 Similarity-Based Approach to Gene Prediction he similarity-based approach uses known genes in one genome to predict (unknown) genes in another genome Problem: Given a known gene sequence and an (unannotated) genomic sequence S, find a set of non overlapping substrings S* of the genomic sequence S whose concatenation yields the highest similarity to (where similarity is measured in terms of an alignment score).
12 Spliced Alignment Problem: Formulation Goal: Find a chain of blocks in a genomic sequence that best fits a target sequence Input: Genomic sequences S of size n, target sequence, and a set of candidate exons B. Output: A chain of non overlapping exons S* such that the global alignment score between S* and is maximum among all chains of blocks from B.
13 Gene Prediction Via Spliced Alignment Gelfand, Mironov and Pevzner (96) O(nb + nk) time complexity - n is the length of S - k is the number of candidate exons in B - b denotes the sum of the lengths of the blocks from B
14 Spliced Alignment Algorithm Begins by selecting either all putative exons between potential acceptor (A) and donor (G) sites. his set is further filtered in a such a way that attempts to retain all true exons, with some false ones.
15 Gene Prediction Via Spliced Alignment he Puzzle: find a set of exons in S whose concatenation fits best a known homologous genome. S???? November 15 15
16 Small Example on Board
17 S [Gelfand et al-96 ]: Gene Prediction As a Network Graph
18 Do we really need to compute all possible chains, at the cost of O(n 2 ) each?
19 Spliced Alignment: Idea Compute the best alignment between i-prefix of genomic sequence S and j-prefix of target under the assumption that the alignment uses the block B (i,j,b) (i,j,3) 3
20 [Gelfand et al-96 ]: Gene Prediction As a Network Graph I O I I O I I 8 O 2 O I 3 O O
21 Spliced Alignment Recurrence If i is not the starting vertex of block B: (i, j, B) = max { (i 1, j, B) indel penalty (i, j 1, B) indel penalty (i 1, j 1, B) + δ(g i, t j ) } If i is the starting vertex of block B: (i, j, B) = max { (i, j 1, B) indel penalty max all blocks B preceding block B (end(b ), j, B ) indel penalty max all blocks B preceding block B (end(b ), j 1, B ) + δ(g i, t j ) }
22
23
24 Spliced Alignment Solution After computing the three-dimensional table (i, j, B), the score of the optimal spliced alignment is: max all blocks B (end(b), length(), B)
25 Spliced Alignment: Complications Considering multiple i-prefixes leads to slow down. running time: O(nb + nk 2 ) where n is the target length, b is the sum of the lengths of the blocks from B and k is the number of blocks.
26 Spliced Alignment: Complications Considering multiple i-prefixes leads to slow down. running time: O(nb + nk 2 ) where n is the target length, b is the sum of the lengths of the blocks from B and k is the number of blocks. Can we get rid of one O(k) in the time complexity?
27 Lewis Carroll Example
28 Spliced Alignment: Speedup
29 P(1)= 0 P(2)= 0 P(3)= 0 P(4)= 2 P(5)= 3 1 w(1)= 6 w(2)= 5 w(3)= 4 w(4)= 1 w(5)= 10 M[0] = 0 M[1] = max(6 + 0, 0) = 6 M[2] = max(5+0,6) = 6 M[3] = max(4+0,6) = 6 6( = 7M[4] = max(1+6, M[5] = max(10+6,7)=16 תזכורת: אינטרוולים במימד דוגמת ריצה לאלגוריתם האיטרטיבי: Input: n, s 1,,s n, f 1,,f n, w 1,,w n M: Sort jobs by finish times so that f 1 f 2... f n. Compute p(1), p(2),, p(n) Iterative-Compute-Opt { M[0] = 0 for j = 1 to n M[j] = max(w j + M[p(j)], M[j-1]) } 4
30 Spliced Alignment: Speedup
31 Spliced Alignment: Speedup P(i,j)=max all blocks B preceding position i (end(b), j, B) j S i
32 S I I 2 O I O ime Complexity? I O 3 I 7 O O
33 S I I 2 O I O ime Complexity? O(nb + nk) I O 3 I 7 O O
Outline. 1. Introduction. 2. Exon Chaining Problem. 3. Spliced Alignment. 4. Gene Prediction Tools
Outline 1. Introduction 2. Exon Chaining Problem 3. Spliced Alignment 4. Gene Prediction Tools Section 1: Introduction Similarity-Based Approach to Gene Prediction Some genomes may be well-studied, with
More informationLecture 11: Gene Prediction
Lecture 11: Gene Prediction Study Chapter 6.11-6.14 1 Gene: A sequence of nucleotides coding for protein Gene Prediction Problem: Determine the beginning and end positions of genes in a genome Where are
More informationHomework 4. Due in class, Wednesday, November 10, 2004
1 GCB 535 / CIS 535 Fall 2004 Homework 4 Due in class, Wednesday, November 10, 2004 Comparative genomics 1. (6 pts) In Loots s paper (http://www.seas.upenn.edu/~cis535/lab/sciences-loots.pdf), the authors
More informationGene Prediction in Eukaryotes
Gene Prediction in Eukaryotes Jan-Jaap Wesselink Biomol Informatics, S.L. jjw@biomol-informatics.com June 2010/Madrid jjw@biomol-informatics.com (BI) Gene Prediction June 2010/Madrid 1 / 34 Outline 1 Gene
More informationDatabase Searching and BLAST Dannie Durand
Computational Genomics and Molecular Biology, Fall 2013 1 Database Searching and BLAST Dannie Durand Tuesday, October 8th Review: Karlin-Altschul Statistics Recall that a Maximal Segment Pair (MSP) is
More informationComparative Genomics. Page 1. REMINDER: BMI 214 Industry Night. We ve already done some comparative genomics. Loose Definition. Human vs.
Page 1 REMINDER: BMI 214 Industry Night Comparative Genomics Russ B. Altman BMI 214 CS 274 Location: Here (Thornton 102), on TV too. Time: 7:30-9:00 PM (May 21, 2002) Speakers: Francisco De La Vega, Applied
More informationAnnotation Walkthrough Workshop BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University
Annotation Walkthrough Workshop NAME: BIO 173/273 Genomics and Bioinformatics Spring 2013 Developed by Justin R. DiAngelo at Hofstra University A Simple Annotation Exercise Adapted from: Alexis Nagengast,
More informationIntroduction. CS482/682 Computational Techniques in Biological Sequence Analysis
Introduction CS482/682 Computational Techniques in Biological Sequence Analysis Outline Course logistics A few example problems Course staff Instructor: Bin Ma (DC 3345, http://www.cs.uwaterloo.ca/~binma)
More informationMapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
More informationGene Identification in silico
Gene Identification in silico Nita Parekh, IIIT Hyderabad Presented at National Seminar on Bioinformatics and Functional Genomics, at Bioinformatics centre, Pondicherry University, Feb 15 17, 2006. Introduction
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationCollect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
More informationIn 1996, the genome of Saccharomyces cerevisiae was completed due to the work of
Summary: Kellis, M. et al. Nature 423,241-253. Background In 1996, the genome of Saccharomyces cerevisiae was completed due to the work of approximately 600 scientists world-wide. This group of researchers
More informationOutline. Gene Finding Questions. Recap: Prokaryotic gene finding Eukaryotic gene finding The human gene complement Regulation
Tues, Nov 29: Gene Finding 1 Online FCE s: Thru Dec 12 Thurs, Dec 1: Gene Finding 2 Tues, Dec 6: PS5 due Project presentations 1 (see course web site for schedule) Thurs, Dec 8 Final papers due Project
More informationMATH 5610, Computational Biology
MATH 5610, Computational Biology Lecture 2 Intro to Molecular Biology (cont) Stephen Billups University of Colorado at Denver MATH 5610, Computational Biology p.1/24 Announcements Error on syllabus Class
More information132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, This exposition is based on the following source, which is recommended reading:
132 Grundlagen der Bioinformatik, SoSe 14, D. Huson, June 22, 214 1 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationFermentation. Lesson Overview. Lesson Overview 13.1 RNA
13.1 RNA THINK ABOUT IT DNA is the genetic material of cells. The sequence of nucleotide bases in the strands of DNA carries some sort of code. In order for that code to work, the cell must be able to
More informationGrundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, This exposition is based on the following source, which is recommended reading:
Grundlagen der Bioinformatik, SoSe 11, D. Huson, July 4, 211 155 12 Gene Prediction Using HMMs This exposition is based on the following source, which is recommended reading: 1. Chris Burge and Samuel
More informationProblem formulations. Wikipedia :: Multidisciplinary design optimization
Problem formulations Problem formulation is normally the most difficult part of the process. It is the selection of design variables, constraints, objectives, and models... Wikipedia :: Multidisciplinary
More informationAnnotating Fosmid 14p24 of D. Virilis chromosome 4
Lo 1 Annotating Fosmid 14p24 of D. Virilis chromosome 4 Lo, Louis April 20, 2006 Annotation Report Introduction In the first half of Research Explorations in Genomics I finished a 38kb fragment of chromosome
More informationChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
More informationRapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing
Rapid Transcriptome Characterization for a nonmodel organism using 454 pyrosequencing "#$%&'()*+,"(-*."#$%&/.,"*01*0.,(%-*.&0("2*01*3,$,45,"-*4#66&*71** 3"#)(82,"-*2&9:)($*)1*"(03&"2-*#)66(*.(8$6#*;
More informationLecture 2: Central Dogma of Molecular Biology & Intro to Programming
Lecture 2: Central Dogma of Molecular Biology & Intro to Programming Central Dogma of Molecular Biology Proteins: workhorse molecules of biological systems Proteins are synthesized from the genetic blueprints
More informationAnnotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G
Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of
More informationAnnotation of contig27 in the Muller F Element of D. elegans. Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans.
David Wang Bio 434W 4/27/15 Annotation of contig27 in the Muller F Element of D. elegans Abstract Contig27 is a 60,000 bp region located in the Muller F element of the D. elegans. Genscan predicted six
More information10/20/2009 Comp 590/Comp Fall
Lecture 14: DNA Sequencing Study Chapter 8.9 10/20/2009 Comp 590/Comp 790-90 Fall 2009 1 DNA Sequencing Shear DNA into millions of small fragments Read 500 700 nucleotides at a time from the small fragments
More informationSystematic evaluation of spliced alignment programs for RNA- seq data
Systematic evaluation of spliced alignment programs for RNA- seq data Pär G. Engström, Tamara Steijger, Botond Sipos, Gregory R. Grant, André Kahles, RGASP Consortium, Gunnar Rätsch, Nick Goldman, Tim
More informationQuestion 2: There are 5 retroelements (2 LINEs and 3 LTRs), 6 unclassified elements (XDMR and XDMR_DM), and 7 satellite sequences.
Bio4342 Exercise 1 Answers: Detecting and Interpreting Genetic Homology (Answers prepared by Wilson Leung) Question 1: Low complexity DNA can be described as sequences that consist primarily of one or
More informationGene Prediction. Mario Stanke. Institut für Mikrobiologie und Genetik Abteilung Bioinformatik. Gene Prediction p.
Gene Prediction Mario Stanke mstanke@gwdg.de Institut für Mikrobiologie und Genetik Abteilung Bioinformatik Gene Prediction p.1/23 Why Predict Genes with a Computer? tons of data 39/250 eukaryotic/prokaryotic
More informationComparative Bioinformatics. BSCI348S Fall 2003 Midterm 1
BSCI348S Fall 2003 Midterm 1 Multiple Choice: select the single best answer to the question or completion of the phrase. (5 points each) 1. The field of bioinformatics a. uses biomimetic algorithms to
More informationAnalysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer. Project XX1001. Customer Detail
Analysis of neo-antigens to identify T-cell neo-epitopes in human Head & Neck cancer Project XX Customer Detail Table of Contents. Bioinformatics analysis pipeline...3.. Read quality check. 3.2. Read alignment...3.3.
More informationComputational Gene Finding
Computational Gene Finding Dong Xu Digital Biology Laboratory Computer Science Department Christopher S. Life Sciences Center University of Missouri, Columbia E-mail: xudong@missouri.edu http://digbio.missouri.edu
More informationChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
More informationGenome 373: Hidden Markov Models III. Doug Fowler
Genome 373: Hidden Markov Models III Doug Fowler Review from Hidden Markov Models I and II We talked about two decoding algorithms last time. What is meant by decoding? Review from Hidden Markov Models
More informationAn Overview of Probabilistic Methods for RNA Secondary Structure Analysis. David W Richardson CSE527 Project Presentation 12/15/2004
An Overview of Probabilistic Methods for RNA Secondary Structure Analysis David W Richardson CSE527 Project Presentation 12/15/2004 RNA - a quick review RNA s primary structure is sequence of nucleotides
More informationProGen: GPHMM for prokaryotic genomes
ProGen: GPHMM for prokaryotic genomes Sharad Akshar Punuganti May 10, 2011 Abstract ProGen is an implementation of a Generalized Pair Hidden Markov Model (GPHMM), a model which can be used to perform both
More informationThe first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks.
Open Seqmonk Launch SeqMonk The first thing you will see is the opening page. SeqMonk scans your copy and make sure everything is in order, indicated by the green check marks. SeqMonk Analysis Page 1 Create
More informationGenome annotation. Erwin Datema (2011) Sandra Smit (2012, 2013)
Genome annotation Erwin Datema (2011) Sandra Smit (2012, 2013) Genome annotation AGACAAAGATCCGCTAAATTAAATCTGGACTTCACATATTGAAGTGATATCACACGTTTCTCTAAT AATCTCCTCACAATATTATGTTTGGGATGAACTTGTCGTGATTTGCCATTGTAGCAATCACTTGAA
More informationLecture 2: Biology Basics Continued. Fall 2018 August 23, 2018
Lecture 2: Biology Basics Continued Fall 2018 August 23, 2018 Genetic Material for Life Central Dogma DNA: The Code of Life The structure and the four genomic letters code for all living organisms Adenine,
More informationCSE 549: RNA-Seq aided gene finding
CSE 549: RNA-Seq aided gene finding Finding Genes We ll break gene finding methods into 3 main categories. ab initio latin from the beginning w/o experimental evidence comparative make use of knowledge
More informationMCDB 1041 Class 21 Splicing and Gene Expression
MCDB 1041 Class 21 Splicing and Gene Expression Learning Goals Describe the role of introns and exons Interpret the possible outcomes of alternative splicing Relate the generation of protein from DNA to
More informationMarch 9, Hidden Markov Models and. BioInformatics, Part I. Steven R. Dunbar. Intro. BioInformatics Problem. Hidden Markov.
and, and, March 9, 2017 1 / 30 Outline and, 1 2 3 4 2 / 30 Background and, Prof E. Moriyama (SBS) has a Seminar SBS, Math, Computer Science, Statistics Extensive use of program "HMMer" Britney (Hinds)
More informationBasic Local Alignment Search Tool
14.06.2010 Table of contents 1 History History 2 global local 3 Score functions Score matrices 4 5 Comparison to FASTA References of BLAST History the program was designed by Stephen W. Altschul, Warren
More informationAnalysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
More informationSINGLE MACHINE SEQUENCING. ISE480 Sequencing and Scheduling Fall semestre
SINGLE MACHINE SEQUENCING 2011 2012 Fall semestre INTRODUCTION The pure sequencing problem is a specialized scheduling problem in which an ordering of the jobs completely determines a schedule. Moreover,
More informationMODULE 5: TRANSLATION
MODULE 5: TRANSLATION Lesson Plan: CARINA ENDRES HOWELL, LEOCADIA PALIULIS Title Translation Objectives Determine the codons for specific amino acids and identify reading frames by looking at the Base
More informationCSE 527 Computational Biology Autumn Lectures ~14-15 Gene Prediction
CSE 527 Computational Biology Autumn 2004 Lectures ~14-15 Gene Prediction Some References A great online bib http://www.nslij-genetics.org/gene/ A good intro survey JM Claverie (1997) "Computational methods
More informationLecture 10 : Whole genome sequencing and analysis. Introduction to Computational Biology Teresa Przytycka, PhD
Lecture 10 : Whole genome sequencing and analysis Introduction to Computational Biology Teresa Przytycka, PhD Sequencing DNA Goal obtain the string of bases that make a given DNA strand. Problem Typically
More informationUNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics
UNIVERSITY OF KWAZULU-NATAL EXAMINATIONS: MAIN, 2010 SUBJECT, COURSE AND CODE: GENE 320: Bioinformatics DURATION: 3 HOURS TOTAL MARKS: 125 Internal Examiner: Dr. Ché Pillay External Examiner: Prof. Nicola
More informationIntroduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
More information90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006
90 Algorithms in Bioinformatics I, WS 06, ZBIT, D. Huson, December 4, 2006 8 RNA Secondary Structure Sources for this lecture: R. Durbin, S. Eddy, A. Krogh und G. Mitchison. Biological sequence analysis,
More informationM. Phil. (Computer Science) Programme < >
M. Phil. (Computer Science) Programme Department of Information and Communication Technology, Fakir Mohan University, Vyasa Vihar, Balasore-756019, Odisha. MPCS11: Research Methodology Unit
More informationSmall Exon Finder User Guide
Small Exon Finder User Guide Author Wilson Leung wleung@wustl.edu Document History Initial Draft 01/09/2011 First Revision 08/03/2014 Current Version 12/29/2015 Table of Contents Author... 1 Document History...
More informationAnnotating the Genome (H)
Annotating the Genome (H) Annotation principles (H1) What is annotation? In general: annotation = explanatory note* What could be useful as an annotation of a DNA sequence? an amino acid sequence? What
More informationLesson Overview. Fermentation 13.1 RNA
13.1 RNA The Role of RNA Genes contain coded DNA instructions that tell cells how to build proteins. The first step in decoding these genetic instructions is to copy part of the base sequence from DNA
More informationWhy learn sequence database searching? Searching Molecular Databases with BLAST
Why learn sequence database searching? Searching Molecular Databases with BLAST What have I cloned? Is this really!my gene"? Basic Local Alignment Search Tool How BLAST works Interpreting search results
More informationReveal Motif Patterns from Financial Stock Market
Reveal Motif Patterns from Financial Stock Market Prakash Kumar Sarangi Department of Information Technology NM Institute of Engineering and Technology, Bhubaneswar, India. Prakashsarangi89@gmail.com.
More informationEnsembl workshop. Thomas Randall, PhD bioinformatics.unc.edu. handouts, papers, datasets
Ensembl workshop Thomas Randall, PhD tarandal@email.unc.edu bioinformatics.unc.edu www.unc.edu/~tarandal/ensembl handouts, papers, datasets Ensembl is a joint project between EMBL - EBI and the Sanger
More informationStudent Learning Outcomes (SLOS)
Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get
More informationSCHEDULING IN MANUFACTURING SYSTEMS
In process planning, the major issue is how to utilize the manufacturing system s resources to produce a part: how to operate the different manufacturing processes. In scheduling. The issue is when and
More informationEECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
More informationLecture 7 Motif Databases and Gene Finding
Introduction to Bioinformatics for Medical Research Gideon Greenspan gdg@cs.technion.ac.il Lecture 7 Motif Databases and Gene Finding Motif Databases & Gene Finding Motifs Recap Motif Databases TRANSFAC
More informationFinding Regulatory Motifs in DNA Sequences. Bioinfo I (Institut Pasteur de Montevideo) Algorithm Techniques -class2- July 12th, / 75
Finding Regulatory Motifs in DNA Sequences Bioinfo I (Institut Pasteur de Montevideo) Algorithm Techniques -class2- July 12th, 2011 1 / 75 Outline Implanting Patterns in Random Text Gene Regulation Regulatory
More informationAn introduction to RNA-seq. Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy
An introduction to RNA-seq Nicole Cloonan - 4 th July 2018 #UQWinterSchool #Bioinformatics #GroupTherapy The central dogma Genome = all DNA in an organism (genotype) Transcriptome = all RNA (molecular
More informationGenomic region (ENCODE) Gene definitions
DNA From genes to proteins Bioinformatics Methods RNA PROMOTER ELEMENTS TRANSCRIPTION Iosif Vaisman mrna SPLICE SITES SPLICING Email: ivaisman@gmu.edu START CODON STOP CODON TRANSLATION PROTEIN From genes
More informationScoring Alignments. Genome 373 Genomic Informatics Elhanan Borenstein
Scoring Alignments Genome 373 Genomic Informatics Elhanan Borenstein A quick review Course logistics Genomes (so many genomes) The computational bottleneck Python: Programs, input and output Number and
More informationVariant calling in NGS experiments
Variant calling in NGS experiments Jorge Jiménez jjimeneza@cipf.es BIER CIBERER Genomics Department Centro de Investigacion Principe Felipe (CIPF) (Valencia, Spain) 1 Index 1. NGS workflow 2. Variant calling
More informationHigh-Throughput Bioinformatics: Re-sequencing and de novo assembly. Elena Czeizler
High-Throughput Bioinformatics: Re-sequencing and de novo assembly Elena Czeizler 13.11.2015 Sequencing data Current sequencing technologies produce large amounts of data: short reads The outputted sequences
More informationMay 16. Gene Finding
Gene Finding j T[j,k] k i Q is a set of states T is a matrix of transition probabilities T[j,k]: probability of moving from state j to state k Σ is a set of symbols e j (S) is the probability of emitting
More informationGene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
More informationA Novel Approach to Clustering and Assembly of Large-Scale Roche 454 Transcriptome Data for Gene Validation and Alternative Splicing Analysis
A Novel Approach to Clustering and Assembly of Large-Scale Roche 454 Transcriptome Data for Gene Validation and Alternative Splicing Analysis Vitoantonio Bevilacqua 1,3,*, Fabio Stroppa 1, Stefano Saladino
More informationMachine Learning. HMM applications in computational biology
10-601 Machine Learning HMM applications in computational biology Central dogma DNA CCTGAGCCAACTATTGATGAA transcription mrna CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data is rapidly
More informationInferring Gene-Gene Interactions and Functional Modules Beyond Standard Models
Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Haiyan Huang Department of Statistics, UC Berkeley Feb 7, 2018 Background Background High dimensionality (p >> n) often results
More informationImproved Splice Site Detection in Genie
Improved Splice Site Detection in Genie Martin Reese Informatics Group Human Genome Center Lawrence Berkeley National Laboratory MGReese@lbl.gov http://www-hgc.lbl.gov/inf Santa Fe, 1/23/97 Database Homologies
More informationTextbook Reading Guidelines
Understanding Bioinformatics by Marketa Zvelebil and Jeremy Baum Last updated: January 16, 2013 Textbook Reading Guidelines Preface: Read the whole preface, and especially: For the students with Life Science
More informationGeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment
GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment Zhaojun Zhang, Shunping Huang, Jack Wang, Xiang Zhang, Fernando Pardo
More informationBioinformatics : Gene Expression Data Analysis
05.12.03 Bioinformatics : Gene Expression Data Analysis Aidong Zhang Professor Computer Science and Engineering What is Bioinformatics Broad Definition The study of how information technologies are used
More informationArray-Ready Oligo Set for the Rat Genome Version 3.0
Array-Ready Oligo Set for the Rat Genome Version 3.0 We are pleased to announce Version 3.0 of the Rat Genome Oligo Set containing 26,962 longmer probes representing 22,012 genes and 27,044 gene transcripts.
More informationIntroduction to BIOINFORMATICS
COURSE OF BIOINFORMATICS a.a. 2016-2017 Introduction to BIOINFORMATICS What is Bioinformatics? (I) The sinergy between biology and informatics What is Bioinformatics? (II) From: http://www.bioteach.ubc.ca/bioinfo2010/
More informationAssay Validation Services
Overview PierianDx s assay validation services bring clinical genomic tests to market more rapidly through experimental design, sample requirements, analytical pipeline optimization, and criteria tuning.
More informationRNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
More informationAdmission Exam for the Graduate Course in Bioinformatics. November 17 th, 2017 NAME:
1 Admission Exam for the Graduate Course in Bioinformatics November 17 th, 2017 NAME: This exam contains 30 (thirty) questions divided in 3 (three) areas (maths/statistics, computer science, biological
More informationOutline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018
Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT
More informationThousands of corresponding human and mouse genomic regions unalignable in primary sequence contain. Elfar Þórarinsson February 2006
Thousands of corresponding human and mouse genomic regions unalignable in primary sequence contain common RNA structure Elfar Þórarinsson February 2006 It s interesting to note that: Approximately half
More informationCHAPTER II SEQUENCING MODELS
CHAPTER II SEQUENCING MODELS The basic models in scheduling due to Johnson (1957) and owing to Maggu & Das (1977) T.P. Singh (1985, 86, 2005, 2006) are explained one by one which form a basis of scheduling
More informationGene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar
Gene Prediction Chengwei Luo, Amanda McCook, Nadeem Bulsara, Phillip Lee, Neha Gupta, and Divya Anjan Kumar Gene Prediction Introduction Protein-coding gene prediction RNA gene prediction Modification
More informationIntroduction to Next Generation Sequencing
The Sequencing Revolution Introduction to Next Generation Sequencing Dena Leshkowitz,WIS 1 st BIOmics Workshop High throughput Short Read Sequencing Technologies Highly parallel reactions (millions to
More informationAC Algorithms for Mining Biological Sequences (COMP 680)
AC-04-18 Algorithms for Mining Biological Sequences (COMP 680) Instructor: Mathieu Blanchette School of Computer Science and McGill Centre for Bioinformatics, 332 Duff Building McGill University, Montreal,
More informationSequencing Problem. Dr.S.S.Kulkarni
Sequencing Problem The selection of an appropriate order for a series of jobs to be done on a finite number of service facilities, in some preassigned order, is called sequencing. The general sequencing
More informationHow to design an HMM for a new problem. HMM model structure. Inherent limitation of HMMs. Duration modeling. Duration modeling
How to design an HMM for a new problem Architecture/topology design: What are the states, observation symbols, and the topology of the state transition graph? Learning/Training: Fully annotated or partially
More informationDNA is normally found in pairs, held together by hydrogen bonds between the bases
Bioinformatics Biology Review The genetic code is stored in DNA Deoxyribonucleic acid. DNA molecules are chains of four nucleotide bases Guanine, Thymine, Cytosine, Adenine DNA is normally found in pairs,
More informationRNA-Seq with the Tuxedo Suite
RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop The Basic Tuxedo Suite References Trapnell C, et al. 2009 TopHat: discovering splice junctions with
More informationTruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR)
tru TruSPAdes: analysis of variations using TruSeq Synthetic Long Reads (TSLR) Anton Bankevich Center for Algorithmic Biotechnology, SPbSU Sequencing costs 1. Sequencing costs do not follow Moore s law
More informationSSA Signal Search Analysis II
SSA Signal Search Analysis II SSA other applications - translation In contrast to translation initiation in bacteria, translation initiation in eukaryotes is not guided by a Shine-Dalgarno like motif.
More informationWhat is a Gene? Snyder and Gerstein, Science Gene Finding Questions
ues, Nov 28: ene Finding 1 Online FE s: hru Dec 11 hurs, Nov 30: ene Finding 2 ues, Dec 5: PS5 due in my office at 5pm. Project presentation preparation no class hurs, Dec 7 Final papers due Project presentations
More informationNovel Variant Discovery Tutorial
Novel Variant Discovery Tutorial Release 8.4.0 Golden Helix, Inc. August 12, 2015 Contents Requirements 2 Download Annotation Data Sources...................................... 2 1. Overview...................................................
More informationGenomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010
Genomic Annotation Lab Exercise By Jacob Jipp and Marian Kaehler Luther College, Department of Biology Genomics Education Partnership 2010 Genomics is a new and expanding field with an increasing impact
More informationDe novo meta-assembly of ultra-deep sequencing data
De novo meta-assembly of ultra-deep sequencing data Hamid Mirebrahim 1, Timothy J. Close 2 and Stefano Lonardi 1 1 Department of Computer Science and Engineering 2 Department of Botany and Plant Sciences
More informationAnnotation of a Drosophila Gene
Annotation of a Drosophila Gene Wilson Leung Last Update: 12/30/2018 Prerequisites Lecture: Annotation of Drosophila Lecture: RNA-Seq Primer BLAST Walkthrough: An Introduction to NCBI BLAST Resources FlyBase:
More informationGene Prediction 10/21/05
Gene Prediction 1/21/5 1/21/5 Gene Prediction Announcements Eam 2 - net Friday Posted online: Eam 2 Study Guide 544 Reading Assignment (2 papers) (formerly Gene Prediction - ) 1/21/5 D Dobbs ISU - BCB
More information