RNA-Seq with the Tuxedo Suite
|
|
|
- Marybeth Gilbert
- 6 years ago
- Views:
Transcription
1 RNA-Seq with the Tuxedo Suite Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 2015 Workshop
2 The Basic Tuxedo Suite References Trapnell C, et al TopHat: discovering splice junctions with RNA-Seq. Bioinformatics Trapnell C, et al Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnology Kim D, et al TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology Roberts A, et al Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biology Roberts A, et al Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics Cufflinks assembles transcripts Cuffdiff identifies differential expression of genes/ transcripts/promoters Trapnell C, et al Differential analysis of gene regulation at transcript resolution with RNA-Seq. Nature Biotechnology
3 Alignment and Differential Expression Read set(s) TopHat bam file(s) Existing annotation (GTF) We followed these steps with the single-end reads Toptables, etc. Cuffdiff
4 But, do we have all the genes? For organisms with genomes, gene models are stored in gtf files Assumptions: The gtf file contains annotation for ALL transcripts and genes All splice sites, start/stop codons, etc. are correct Are these assumptions correct for every sequenced organism? RNA-Seq reads can be used to independently construct genes and splice variants using limited or no annotation Method used depends on how much sequence information there is for the organism
5 Gene Construction (Alignment) vs. Assembly Genome- Sequenced Organisms Trinity software Novel or Non-Model Organisms Haas and Zody (2010) Nat. Biotech. 28:421-3
6 Gene / Transcriptome Construction Annotation can be improved even for well-annotated model organisms Identify all expressed exons Combine expressed exons into genes Find all splice variants for a gene Discover novel transcripts For newly sequenced organisms Validate ab initio annotation Comparison between different annotation sets Can assist in finding some types of contamination Reconstruction of rrna genes Genomic/mitochondrial DNA in RNA library preps.
7 Reference Annotation Based Transcript (RABT) Assembly Read set(s) TopHat bam file(s) Existing annotation (GTF) [optional] Cufflinks Cuffmerge Cuffcompare Read-set specific GTF(s) Merged GTF Final assembly (GTF and stats) Toptables, etc. Cuffdiff
8 TopHat Spliced Alignment to a Genome
9 Reference Annotation Based Transcript (RABT) Assembly
10 Cufflinks Identification of Incompatible Fragments Incompatible alignment
11 Cufflinks Minimum Paths to Transcripts
12 Cufflinks Abundance Estimation
13 Cufflinks Abundance Estimation
14 Merging Cufflinks Assemblies
15 So Now We ve Explored These Tools
16 We ve Used Other Software in Conjunction HTSeq-count Raw Counts edger (But HTSeq-count and edger are independent)
17 And Then Came Some Extensions
18 Modules Introduced in 2014 Cuffquant Improves efficiency of running multiple samples Stores data in.cxb compressed format, that can later be analyzed with cuffdiff or cuffnorm Cuffnorm Generate tables of expression values that are normalized for library size. Tables are used as input to Monocle Monocle Used to analyze single-cell expression data Trapnell, et al., 2014, Nat. Biotech. 32:381
19 But Software Continues to Evolve HISAT (Hierarchical Indexing for Spliced Alignment of Transcripts) Kim et al., 2015, Nat. Methods Planned to be Tophat3 Faster than other aligners More accurate on simulated reads.
20 But Software Continues to Evolve StringTie Pertea et al., 2015, Nat. Biotech Probable successor to Cufflinks2 Assembles more transcripts (based on simulated reads) Ballgown Frazee et al., 2015, Nat. Biotech Bioconductor R package Probable successor to Cuffdiff2 Includes useful Tablemaker preprocessor
21 A New Potential Game-Changer (2015) Kallisto ( Near-Optimal RNA-Seq Quantification ) Bray et al. ( Extremely fast, uses pseudo-alignment based on k-mers and debruijn graphs Speed Accuracy
22 A Few Words About Bacterial RNA-Seq
23 Eukaryotic and Bacterial Gene Structures are Different Eukaryotes Gene structure includes introns and exons Splicing, poly-adenylation Each mrna is a discrete molecule when translated Bacteria / Prokaryotes Individual genes and groups of genes in operons Generally, no splicing, no polya One mrna can contain coding sequences for multiple proteins
24 Bacterial RNA-Seq Considerations rrna depletion strategies may leave considerable amounts of non-coding RNA molecules Splicing-aware aligners (such as Tophat) may not be useful Reads from polycistronic mrna may overlap two genes How would HTSeq-Count handle this? Compare alignments to the genome to alignments to transcriptome. Some aligners, such as bwa-mem, will report secondary alignments Transcriptome alignments can be used to generate counts table for edger Specialized software, such as Rockhopper (stand-alone,
RNA-Seq Software, Tools, and Workflows
RNA-Seq Software, Tools, and Workflows Monica Britton, Ph.D. Sr. Bioinformatics Analyst September 1, 2016 Some mrna-seq Applications Differential gene expression analysis Transcriptional profiling Assumption:
Transcriptome Assembly, Functional Annotation (and a few other related thoughts)
Transcriptome Assembly, Functional Annotation (and a few other related thoughts) Monica Britton, Ph.D. Sr. Bioinformatics Analyst June 23, 2017 Differential Gene Expression Generalized Workflow File Types
10/06/2014. RNA-Seq analysis. With reference assembly. Cormier Alexandre, PhD student UMR8227, Algal Genetics Group
RNA-Seq analysis With reference assembly Cormier Alexandre, PhD student UMR8227, Algal Genetics Group Summary 2 Typical RNA-seq workflow Introduction Reference genome Reference transcriptome Reference
Introduction to RNA-Seq. David Wood Winter School in Mathematics and Computational Biology July 1, 2013
Introduction to RNA-Seq David Wood Winter School in Mathematics and Computational Biology July 1, 2013 Abundance RNA is... Diverse Dynamic Central DNA rrna Epigenetics trna RNA mrna Time Protein Abundance
Sequence Analysis 2RNA-Seq
Sequence Analysis 2RNA-Seq Lecture 10 2/21/2018 Instructor : Kritika Karri kkarri@bu.edu Transcriptome Entire set of RNA transcripts in a given cell for a specific developmental stage or physiological
RNA-sequencing. Next Generation sequencing analysis Anne-Mette Bjerregaard. Center for biological sequence analysis (CBS)
RNA-sequencing Next Generation sequencing analysis 2016 Anne-Mette Bjerregaard Center for biological sequence analysis (CBS) Terms and definitions TRANSCRIPTOME The full set of RNA transcripts and their
Quantifying gene expression
Quantifying gene expression Genome GTF (annotation)? Sequence reads FASTQ FASTQ (+reference transcriptome index) Quality control FASTQ Alignment to Genome: HISAT2, STAR (+reference genome index) (known
Introduction to RNAseq Analysis. Milena Kraus Apr 18, 2016
Introduction to RNAseq Analysis Milena Kraus Apr 18, 2016 Agenda What is RNA sequencing used for? 1. Biological background 2. From wet lab sample to transcriptome a. Experimental procedure b. Raw data
Eucalyptus gene assembly
Eucalyptus gene assembly ACGT Plant Biotechnology meeting Charles Hefer Bioinformatics and Computational Biology Unit University of Pretoria October 2011 About Eucalyptus Most valuable and widely planted
Experimental Design. Sequencing. Data Quality Control. Read mapping. Differential Expression analysis
-Seq Analysis Quality Control checks Reproducibility Reliability -seq vs Microarray Higher sensitivity and dynamic range Lower technical variation Available for all species Novel transcript identification
Analysis of RNA-seq Data. Bernard Pereira
Analysis of RNA-seq Data Bernard Pereira The many faces of RNA-seq Applications Discovery Find new transcripts Find transcript boundaries Find splice junctions Comparison Given samples from different experimental
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ),
Analysis of data from high-throughput molecular biology experiments Lecture 6 (F6, RNA-seq ), 2012-01-26 What is a gene What is a transcriptome History of gene expression assessment RNA-seq RNA-seq analysis
Analysis of RNA-seq Data
Analysis of RNA-seq Data A physicist and an engineer are in a hot-air balloon. Soon, they find themselves lost in a canyon somewhere. They yell out for help: "Helllloooooo! Where are we?" 15 minutes later,
Next Generation Sequencing
Next Generation Sequencing Complete Report Catalogue # and Service: IR16001 rrna depletion (human, mouse, or rat) IR11081 Total RNA Sequencing (80 million reads, 2x75 bp PE) Xxxxxxx - xxxxxxxxxxxxxxxxxxxxxx
Transcriptome analysis
Statistical Bioinformatics: Transcriptome analysis Stefan Seemann seemann@rth.dk University of Copenhagen April 11th 2018 Outline: a) How to assess the quality of sequencing reads? b) How to normalize
ChIP-seq and RNA-seq
ChIP-seq and RNA-seq Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions (ChIPchromatin immunoprecipitation)
Transcriptomics analysis with RNA seq: an overview Frederik Coppens
Transcriptomics analysis with RNA seq: an overview Frederik Coppens Platforms Applications Analysis Quantification RNA content Platforms Platforms Short (few hundred bases) Long reads (multiple kilobases)
ChIP-seq and RNA-seq. Farhat Habib
ChIP-seq and RNA-seq Farhat Habib fhabib@iiserpune.ac.in Biological Goals Learn how genomes encode the diverse patterns of gene expression that define each cell type and state. Protein-DNA interactions
RNA-SEQUENCING ANALYSIS
RNA-SEQUENCING ANALYSIS Joseph Powell SISG- 2018 CONTENTS Introduction to RNA sequencing Data structure Analyses Transcript counting Alternative splicing Allele specific expression Discovery APPLICATIONS
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Bioinformatics Analyst September 2014 Workshop Overview of Today s Activities Morning RNA-Seq Concepts, Terminology, and Work Flows Two-Condition Differential
Introduction to RNA-Seq
Introduction to RNA-Seq Monica Britton, Ph.D. Sr. Bioinformatics Analyst March 2015 Workshop Overview of RNA-Seq Activities RNA-Seq Concepts, Terminology, and Work Flows Using Single-End Reads and a Reference
RNA-Seq Workshop AChemS Sunil K Sukumaran Monell Chemical Senses Center Philadelphia
RNA-Seq Workshop AChemS 2017 Sunil K Sukumaran Monell Chemical Senses Center Philadelphia Benefits & downsides of RNA-Seq Benefits: High resolution, sensitivity and large dynamic range Independent of prior
NGS Data Analysis and Galaxy
NGS Data Analysis and Galaxy University of Pretoria Pretoria, South Africa 14-18 October 2013 Dave Clements, Emory University http://galaxyproject.org/ Fourie Joubert, Burger van Jaarsveld Bioinformatics
Bioinformatics Monthly Workshop Series. Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory
Bioinformatics Monthly Workshop Series Speaker: Fan Gao, Ph.D Bioinformatics Resource Office The Picower Institute for Learning and Memory Schedule for Fall, 2015 PILM Bioinformatics Web Server (09/21/2015)
CSE 549: RNA-Seq aided gene finding
CSE 549: RNA-Seq aided gene finding Finding Genes We ll break gene finding methods into 3 main categories. ab initio latin from the beginning w/o experimental evidence comparative make use of knowledge
Applications of short-read
Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ Sequencing applications RNA-Seq includes experiments
How to deal with your RNA-seq data?
How to deal with your RNA-seq data? Rachel Legendre, Thibault Dayris, Adrien Pain, Claire Toffano-Nioche, Hugo Varet École de bioinformatique AVIESAN-IFB 2017 1 Rachel Legendre Bioinformatics 27/11/2018
VM origin. Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE
VM origin Okeanos: Image Trinity_U16 (upgrade to Ubuntu16.04, thanks to Alexandros Dimopoulos) X2go: LXDE NGS intro + Genome-Based Transcript Reconstruction and Analysis Using RNA-Seq Data Based on material
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data
Benchmarking of RNA-seq data processing pipelines using whole transcriptome qpcr expression data Jan Hellemans 7th international qpcr & NGS Event - Freising March 24 th, 2015 Therapeutics lncrna oncology
RNAseq Differential Gene Expression Analysis Report
RNAseq Differential Gene Expression Analysis Report Customer Name: Institute/Company: Project: NGS Data: Bioinformatics Service: IlluminaHiSeq2500 2x126bp PE Differential gene expression analysis Sample
Canadian Bioinforma3cs Workshops
Canadian Bioinforma3cs Workshops www.bioinforma3cs.ca Module #: Title of Module 2 1 Module 3 Expression and Differen3al Expression (lecture) Obi Griffith & Malachi Griffith www.obigriffith.org ogriffit@genome.wustl.edu
SCALABLE, REPRODUCIBLE RNA-Seq
SCALABLE, REPRODUCIBLE RNA-Seq SCALABLE, REPRODUCIBLE RNA-Seq Advances in the RNA sequencing workflow, from sample preparation through data analysis, are enabling deeper and more accurate exploration
Sequencing applications. Today's outline. Hands-on exercises. Applications of short-read sequencing: RNA-Seq and ChIP-Seq
Sequencing applications Applications of short-read sequencing: RNA-Seq and ChIP-Seq BaRC Hot Topics March 2013 George Bell, Ph.D. http://jura.wi.mit.edu/bio/education/hot_topics/ RNA-Seq includes experiments
RNA-Seq Module 2 From QC to differential gene expression.
RNA-Seq Module 2 From QC to differential gene expression. Ying Zhang Ph.D, Informatics Analyst Research Informatics Support System (RISS) MSI Apr. 24, 2012 RNA-Seq Tutorials Tutorial 1: Introductory (Mar.
GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment
GeneScissors: a comprehensive approach to detecting and correcting spurious transcriptome inference owing to RNA-seq reads misalignment Zhaojun Zhang, Shunping Huang, Jack Wang, Xiang Zhang, Fernando Pardo
RNA-Seq Analysis. Simon Andrews, Laura v
RNA-Seq Analysis Simon Andrews, Laura Biggins simon.andrews@babraham.ac.uk @simon_andrews v2018-10 RNA-Seq Libraries rrna depleted mrna Fragment u u u u NNNN Random prime + RT 2 nd strand synthesis (+
Statistical Genomics and Bioinformatics Workshop. Genetic Association and RNA-Seq Studies
Statistical Genomics and Bioinformatics Workshop: Genetic Association and RNA-Seq Studies RNA Seq and Differential Expression Analysis Brooke L. Fridley, PhD University of Kansas Medical Center 1 Next-generation
RNA-Seq. Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University
RNA-Seq Joshua Ainsley, PhD Postdoctoral Researcher Lab of Leon Reijmers Neuroscience Department Tufts University joshua.ainsley@tufts.edu Day five Alternative splicing Assembly RNA edits Alternative splicing
NGS part 2: applications. Tobias Österlund
NGS part 2: applications Tobias Österlund tobiaso@chalmers.se NGS part of the course Week 4 Friday 13/2 15.15-17.00 NGS lecture 1: Introduction to NGS, alignment, assembly Week 6 Thursday 26/2 08.00-09.45
Introduction to RNA sequencing
Introduction to RNA sequencing Bioinformatics perspective Olga Dethlefsen NBIS, National Bioinformatics Infrastructure Sweden November 2017 Olga (NBIS) RNA-seq November 2017 1 / 49 Outline Why sequence
Background Wikipedia Lee and Mahadavan, JCB, 2009 History (Platform Comparison) P Park, Nature Review Genetics, 2009 P Park, Nature Reviews Genetics, 2009 Rozowsky et al., Nature Biotechnology, 2009
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12
Galaxy for Next Generation Sequencing 初探次世代序列分析平台 蘇聖堯 2013/9/12 What s Galaxy? Bringing Developers And Biologists Together. Reproducible Science Is Our Goal An open, web-based platform for data intensive
RNA Seq: Methods and Applica6ons. Prat Thiru
RNA Seq: Methods and Applica6ons Prat Thiru 1 Outline Intro to RNA Seq Biological Ques6ons Comparison with Other Methods RNA Seq Protocol RNA Seq Applica6ons Annota6on Quan6fica6on Other Applica6ons Expression
Long and short/small RNA-seq data analysis
Long and short/small RNA-seq data analysis GEF5, 4.9.2015 Sami Heikkinen, PhD, Dos. Topics 1. RNA-seq in a nutshell 2. Long vs short/small RNA-seq 3. Bioinformatic analysis work flows GEF5 / Heikkinen
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
Introduction of RNA-Seq Analysis
Introduction of RNA-Seq Analysis Jiang Li, MS Bioinformatics System Engineer I Center for Quantitative Sciences(CQS) Vanderbilt University September 21, 2012 Goal of this talk 1. Act as a practical resource
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Mapping strategies for sequence reads
Mapping strategies for sequence reads Ernest Turro University of Cambridge 21 Oct 2013 Quantification A basic aim in genomics is working out the contents of a biological sample. 1. What distinct elements
Outline. Introduction to ab initio and evidence-based gene finding. Prokaryotic gene predictions
Outline Introduction to ab initio and evidence-based gene finding Overview of computational gene predictions Different types of eukaryotic gene predictors Common types of gene prediction errors Wilson
Course Presentation. Ignacio Medina Presentation
Course Index Introduction Agenda Analysis pipeline Some considerations Introduction Who we are Teachers: Marta Bleda: Computational Biologist and Data Analyst at Department of Medicine, Addenbrooke's Hospital
Genome annotation & EST
Genome annotation & EST What is genome annotation? The process of taking the raw DNA sequence produced by the genome sequence projects and adding the layers of analysis and interpretation necessary
CBC Data Therapy. Metatranscriptomics Discussion
CBC Data Therapy Metatranscriptomics Discussion Metatranscriptomics Extract RNA, subtract rrna Sequence cdna QC Gene expression, function Institute for Systems Genomics: Computational Biology Core bioinformatics.uconn.edu
Themes: RNA and RNA Processing. Messenger RNA (mrna) What is a gene? RNA is very versatile! RNA-RNA interactions are very important!
Themes: RNA is very versatile! RNA and RNA Processing Chapter 14 RNA-RNA interactions are very important! Prokaryotes and Eukaryotes have many important differences. Messenger RNA (mrna) Carries genetic
De novo assembly in RNA-seq analysis.
De novo assembly in RNA-seq analysis. Joachim Bargsten Wageningen UR/PRI/Plant Breeding October 2012 Motivation Transcriptome sequencing (RNA-seq) Gene expression / differential expression Reconstruct
RNA-seq differential expression analysis. bioconnector.org/workshops
RNA-seq differential expression analysis bioconnector.org/workshops Agenda Our data: source, pre-processing, structure Importing & exploring data Processing and analysis with DESeq2 - Structuring the count
Computational & Quantitative Biology Lecture 6 RNA Sequencing
Peter A. Sims Dept. of Systems Biology Dept. of Biochemistry & Molecular Biophysics Sulzberger Columbia Genome Center October 27, 2014 Computational & Quantitative Biology Lecture 6 RNA Sequencing We Have
Sanger vs Next-Gen Sequencing
Tools and Algorithms in Bioinformatics GCBA815/MCGB815/BMI815, Fall 2017 Week-8: Next-Gen Sequencing RNA-seq Data Analysis Babu Guda, Ph.D. Professor, Genetics, Cell Biology & Anatomy Director, Bioinformatics
02 Agenda Item 03 Agenda Item
01 Agenda Item 02 Agenda Item 03 Agenda Item SOLiD 3 System: Applications Overview April 12th, 2010 Jennifer Stover Field Application Specialist - SOLiD Applications Workflow for SOLiD Application Application
1. Introduction Gene regulation Genomics and genome analyses
1. Introduction Gene regulation Genomics and genome analyses 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites Databases 3. Technologies Microarrays Deep sequencing
RNA Ribonucleic Acid. Week 14, Lecture 28. RNA- seq is a new, emerging field. Two major domains applica:on 12/4/ When the transcriptome is known
2014 - BMMB 852D: Applied Bioinforma:cs RNA Ribonucleic Acid Week 14, Lecture 28 István Albert Biochemistry and Molecular Biology and Bioinforma:cs Consul:ng Center Penn State Two major domains applica:on
Accurate, Fast, and Model-Aware Transcript Expression Quantification
Accurate, Fast, and Model-Aware Transcript Expression Quantification Carl Kingsford Associate Professor, Computational Biology Department Joint work with Rob Patro & Geet Duggal Challenge of Large-Scale
How to Use This Presentation
How to Use This Presentation To View the presentation as a slideshow with effects select View on the menu bar and click on Slide Show. To advance through the presentation, click the right-arrow key or
Wheat CAP Gene Expression with RNA-Seq
Wheat CAP Gene Expression with RNA-Seq July 9 th -13 th, 2018 Overview of the workshop, Alina Akhunova http://www.ksre.k-state.edu/igenomics/workshops/ RNA-Seq Workshop Activities Lectures Laboratory Molecular
RNA-Seq Blog Poll Results
RNA-Seq Blog Poll Results What is the greatest immediate need facing the RNA Sequencing community? More sequencing capacity Further advancement in sequencing technology Continued cost reduction Better
From reads to results: differential. Alicia Oshlack Head of Bioinformatics
From reads to results: differential expression analysis with ihrna seq Alicia Oshlack Head of Bioinformatics Murdoch Childrens Research Institute Benefits and opportunities ii of RNA seq All transcripts
Whole Transcriptome Analysis of Illumina RNA- Seq Data. Ryan Peters Field Application Specialist
Whole Transcriptome Analysis of Illumina RNA- Seq Data Ryan Peters Field Application Specialist Partek GS in your NGS Pipeline Your Start-to-Finish Solution for Analysis of Next Generation Sequencing Data
Next Generation Genome Annotation with mgene.ngs
Next Generation Genome Annotation with mgene.ngs Jonas Behr, 1 Regina Bohnert, 1 Georg Zeller, 1,2 Gabriele Schweikert, 1,2,3 Lisa Hartmann, 1 and Gunnar Rätsch 1 1 Friedrich Miescher Laboratory of the
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data
Transcriptome Assembly and Evaluation, using Sequencing Quality Control (SEQC) Data Introduction The US Food and Drug Administration (FDA) has coordinated the Sequencing Quality Control project (SEQC/MAQC-III)
SCIENCE CHINA Life Sciences. Comparative analysis of de novo transcriptome assembly
SCIENCE CHINA Life Sciences SPECIAL TOPIC February 2013 Vol.56 No.2: 156 162 RESEARCH PAPER doi: 10.1007/s11427-013-4444-x Comparative analysis of de novo transcriptome assembly CLARKE Kaitlin 1, YANG
Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction
Machine Learning Methods for RNA-seq-based Transcriptome Reconstruction Gunnar Rätsch Friedrich Miescher Laboratory Max Planck Society, Tübingen, Germany NGS Bioinformatics Meeting, Paris (March 24, 2010)
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. Evidence Based Annotation. GEP goals: Evidence for Gene Models 08/22/2017
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
Consensus Ensemble Approaches Improve De Novo Transcriptome Assemblies
University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Computer Science and Engineering: Theses, Dissertations, and Student Research Computer Science and Engineering, Department
Differential gene expression analysis using RNA-seq
https://abc.med.cornell.edu/ Differential gene expression analysis using RNA-seq Applied Bioinformatics Core, August 2017 Friederike Dündar with Luce Skrabanek & Ceyda Durmaz Day 3 QC of aligned reads
Collect, analyze and synthesize. Annotation. Annotation for D. virilis. GEP goals: Evidence Based Annotation. Evidence for Gene Models 12/26/2018
Annotation Annotation for D. virilis Chris Shaffer July 2012 l Big Picture of annotation and then one practical example l This technique may not be the best with other projects (e.g. corn, bacteria) l
oqtans A Galaxy-Integrated Workflow for Quantitative Transcriptome Analysis from NGS Data
oqtans A Galaxy-Integrated Workflow for Quantitative Transcriptome Analysis from NGS Data Géraldine Jean Sebastian J. Schultheiss Machine Learning in Biology, Rätsch
Genomic resources. for non-model systems
Genomic resources for non-model systems 1 Genomic resources Whole genome sequencing reference genome sequence comparisons across species identify signatures of natural selection population-level resequencing
RNA-Seq Tutorial 1. Kevin Silverstein, Ying Zhang Research Informatics Solutions, MSI October 18, 2016
RNA-Seq Tutorial 1 Kevin Silverstein, Ying Zhang Research Informatics Solutions, MSI October 18, 2016 Slides available at www.msi.umn.edu/tutorial-materials RNA-Seq Tutorials Lectures RNA-Seq experiment
measuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
Workflows and Pipelines for NGS analysis: Lessons from proteomics
Workflows and Pipelines for NGS analysis: Lessons from proteomics Conference on Applying NGS in Basic research Health care and Agriculture 11 th Sep 2014 Debasis Dash Where are the protein coding genes
RNA
RNA sequencing Michael Inouye Baker Heart and Diabetes Institute Univ of Melbourne / Monash Univ Summer Institute in Statistical Genetics 2017 Integrative Genomics Module Seattle @minouye271 www.inouyelab.org
Proteogenomics Workflow for Neoantigen Discovery
Proteogenomics Workflow for Neoantigen Discovery XIE Lu, Shanghai Center for Bioinformation Technology August 29-31, 2018. The 16th KJC Bioinformatics Symposium, Hayama, Japan Proteogenomics 目录 CONTENTS
Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads
The Iso-Seq Method: Transcriptome Sequencing Using Long Reads Elizabeth Tseng, Ph.D. Senior Staff Scientist FIND MEANING IN COMPLEXITY For Research Use Only. Not for use in diagnostic procedures. Copyright
res2)=)colocalisation(eqtl_file="icoslg_eqtl.txt",) gwas_file="uc_gwas_icoslg_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$
Homework 7 res1)=)colocalisation(eqtl_file="ptk2b_eqtl.txt",) gwas_file="ad_gwas_ptk2b_locus.txt",)p1)=)1e+4,)p2)=)1e+4,)p12)=)1e+5,) region)=)200000)$ ##))1.02e+06))2.43e+05))6.80e+04))1.51e+02))9.84e+01)$
Gene Regulation 10/19/05
10/19/05 Gene Regulation (formerly Gene Prediction - 2) Gene Prediction & Regulation Mon - Overview & Gene structure review: Eukaryotes vs prokaryotes Wed - Regulatory regions: Promoters & enhancers -
Chapter 13. From DNA to Protein
Chapter 13 From DNA to Protein Proteins All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequenceof a gene The Path From Genes to
Videos. Lesson Overview. Fermentation
Lesson Overview Fermentation Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast
Form for publishing your article on BiotechArticles.com this document to
Your Article: Article Title (3 to 12 words) Article Summary (In short - What is your article about Just 2 or 3 lines) Category Transcriptomics sequencing and lncrna Sequencing Analysis: Quality Evaluation
Genomics and Transcriptomics of Spirodela polyrhiza
Genomics and Transcriptomics of Spirodela polyrhiza Doug Bryant Bioinformatics Core Facility & Todd Mockler Group, Donald Danforth Plant Science Center Desired Outcomes High-quality genomic reference sequence
EECS730: Introduction to Bioinformatics
EECS730: Introduction to Bioinformatics Lecture 08: Gene finding aatgcatgcggctatgctaatgcatgcggctatgctaagctgggatccgatgacaatgcatgcggctatgctaatgcatgcggc tatgcaagctgggatccgatgactatgctaagctgggatccgatgacaatgcatgcggctatgctaatgaatggtcttgggatt
ANAQUIN : USER MANUAL
ANAQUIN : USER MANUAL GUIDE TO ANALYZING SEQUINS IN NEXT-GENERATION SEQUENCING DATA BY TED WONG & TIM MERCER sequin@garvan.org.au VERSION 2.0.1 NOVEMBER 2017 Garvan Institute of Medical Research 2016,
Analysis of RNA-seq Data. Feb 8, 2017 Peikai CHEN (PHD)
Analysis of RNA-seq Data Feb 8, 2017 Peikai CHEN (PHD) Outline What is RNA-seq? What can RNA-seq do? How is RNA-seq measured? How to process RNA-seq data: the basics How to visualize and diagnose your
Bacterial Genome Annotation
Bacterial Genome Annotation Bacterial Genome Annotation For an annotation you want to predict from the sequence, all of... protein-coding genes their stop-start the resulting protein the function the control
RNA-Seq analysis using R: Differential expression and transcriptome assembly
RNA-Seq analysis using R: Differential expression and transcriptome assembly Beibei Chen Ph.D BICF 12/7/2016 Agenda Brief about RNA-seq and experiment design Gene oriented analysis Gene quantification
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
Deep sequencing of transcriptomes
1 / 40 Deep sequencing of transcriptomes An introduction to RNA-seq Michael Dondrup UNI BCCS 2. november 2010 2 / 40 Transcriptomics by Ultra-Fast Sequencing Microarrays have been the primary transcriptomics
Videos. Bozeman Transcription and Translation: Drawing transcription and translation:
Videos Bozeman Transcription and Translation: https://youtu.be/h3b9arupxzg Drawing transcription and translation: https://youtu.be/6yqplgnjr4q Objectives 29a) I can contrast RNA and DNA. 29b) I can explain
Single-Cell Whole Transcriptome Profiling With the SOLiD. System
APPLICATION NOTE Single-Cell Whole Transcriptome Profiling Single-Cell Whole Transcriptome Profiling With the SOLiD System Introduction The ability to study the expression patterns of an individual cell