Student Learning Outcomes (SLOS)
|
|
|
- Pauline Cook
- 6 years ago
- Views:
Transcription
1 Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use BLAST to compare sequences - how to get exon map of a cdna - how to identify specific domains within a cdna INDEPENDENT JUDGEMENT COMMUNICATION SKILLS
2 Preliminary study of NRG1 sequences you had to compare rat NRG1 type III sequences to identify alpha and beta domains, the EGF-like domain and domains 1 and 3 Only for teaching purposes - not for reproduction or sale
3 Only for teaching purposes - not for reproduction or sale exon α? exon β + exon 1?
4 Only for teaching purposes - not for reproduction or sale exon α = on sequence AF exon β + exon 1 = on sequence AF194438
5 exon α = on sequence AF194439
6 exon α = on sequence AF exon β + exon 1 = on sequence AF exon β? exon 1? Exon3? Only for teaching purposes - not for reproduction or sale
7 exon α = on sequence AF exon β + exon 1 = on sequence AF exon β = on sequences AF and DQ exon 1 = on sequence AF Exon3 = /894 on sequence DQ Only for teaching purposes - not for reproduction or sale
8 exon β = on sequences AF194438
9 exon 1 = on sequence AF194438
10 Exon3 = /894 on sequence DQ
11
12
13
14 Preliminary study of NRG1 sequences you had to compare rat NRG1 type III sequences to identify alpha and beta domains and the EGF-like domain where would you put primer pairs to identify α and β isoforms in your tissue samples? Only for teaching purposes - not for reproduction or sale
15 rat type III NRG1 sequences Only for teaching purposes - not for reproduction or sale
16 Where do we have to design primers to identify different isoforms? If you want to identify α and β isoforms, where can you put primers for RT-PCR? Only for teaching purposes - not for reproduction or sale
17 PCR & primer orientation - sense primer - antisense primer - Annhyb - primer secondary structure Only for teaching purposes - not for reproduction or sale
18 Only for teaching purposes - not for reproduction or sale
19 Please design primers to amplify this region. sense primer =? antisense primer =? Only for teaching purposes - not for reproduction or sale
20 sense primer = 5 -catccgtta-3 antisense primer = 5 -tacgatcgg-3 Only for teaching purposes - not for reproduction or sale
21 Only for teaching purposes - not for reproduction or sale
22 Only for teaching purposes - not for reproduction or sale
23 Only for teaching purposes - not for reproduction or sale
24 Only for teaching purposes - not for reproduction or sale
25 Only for teaching purposes - not for reproduction or sale
26 Only for teaching purposes - not for reproduction or sale
27 If I ask you to amplify the cdna starting from ATG, where do you put the sense primer?
28 If I ask you to amplify the cdna starting from ATG, you have to identify the first ATG (the start codon ) of the coding sequence!
29 PCR amplification 1 - to clone the full length cdna to express the protein 2 - to verify the expression of a gene
30 1 where do you put primers if you want to amplify & clone the full length cdna to express the corresponding full length protein? Genomic Gene DNA endogeno Promoter cdna ATG STOP Exon 1 Intron1 Exon 2, ATG STOP mrna polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
31 1 where do you put primers if you want to amplify & clone the full length cdna to express the corresponding full length protein? Genomic Gene DNA endogeno Promoter cdna ATG STOP Exon 1 Intron1 Exon 2, ATG STOP mrna polia RT (reverse transcriptase) ATG STOP PCR ATG STOP PCR product Only for teaching purposes - not for reproduction or sale
32 2 where do you put primers if you want to verify & quantify the expression of a gene? Genomic Gene DNA endogeno Promoter cdna ATG STOP Exon 1 Intron1 Exon 2, ATG STOP mrna polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
33 2 where do you put primers if you want to verify & quantify the expression of a gene? Genomic Gene DNA endogeno Promoter cdna ATG STOP Exon1 Intron1 Exon 2, mrna polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
34 sometime you have genomic DNA contamination. How can you amplify only cdna and not contaminant genomic DNA? Genomic DNA Gene endogeno mrna Promoter cdna ATG STOP Exon1 Intron1 Exon 2, PCR PCR polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
35 1- one strategy could be to design primers on different exons separated by a big intron ( 1000 bp) Genomic DNA Promoter mrna cdna Exon1 Exons 2,3... Intron RNA polimerase RNA PCR RNA splicing polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
36 which strategy could you use if intron is too small (<1000bp)? Genomic DNA Promoter mrna cdna Exon1 Exons 2,3... Intron RNA polimerase RNA RNA splicing polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
37 2 - if introns are too small (< 1000 bp) a second strategy could be to design primers across two exons Genomic DNA Promoter mrna cdna Exon1 Exons 2,3... Intron RNA polimerase RNA RNA splicing PCR polia RT (reverse transcriptase) Only for teaching purposes - not for reproduction or sale
38 How to use Annhyb to design primers Only for teaching purposes - not for reproduction or sale
39 Only for teaching purposes - not for reproduction or sale
40 Only for teaching purposes - not for reproduction or sale
41 ? Only for teaching purposes - not for reproduction or sale
42 Only for teaching purposes - not for reproduction or sale
43 primer sense (create oligo with the clipboard sequence) primer antisense (DO NOT create oligo with the clipboard sequence, you have to copy and paste the sequence here!! ) Pay attention! The sequence in Annhyb is single strand!
44 Pay attention! The sequence in Annhyb (and in ncbi) is single strand!
45 Only for teaching purposes - not for reproduction or sale
46 Only for teaching purposes - not for reproduction or sale
47 Only for teaching purposes - not for reproduction or sale
48 Only for teaching purposes - not for reproduction or sale
49 Only for teaching purposes - not for reproduction or sale
50 Only for teaching purposes - not for reproduction or sale
51 Only for teaching purposes - not for reproduction or sale
52 Design primer pairs to quantify expression of NRG1 α and β isoforms in your samples: primer pairs must meet the following criteria: 1- to have similar Tm (about 60 C according to Allawi) 2- to finish with G or C 3- to have a content of G and C 50% 4- not to form secondary structures (use Annhyb: tools -> test for dimers and hairpin loops). Test each primer against himself and against the other primer: you want to have 4 consecutive pairings: if you have 5 you have to design a new primer Only for teaching purposes - not for reproduction or sale
53 Summary for today you have already identified the exons corresponding to rat NRG1 EGF-like domain, α and β, 1 and 3 on rat genomic DNA compare EGF-like domain, α and β with the genomic exon sequences to identify the corresponding exons and to measure the intron length calculate the intron length design primer for NRG1 α and β amplification (using criteria of the previous slide) calculate: the amplicon length prepare a slide or a doc file containing: - the sequences including EGF-like-α and EGF-like β with highlighted in yellow se position of sense and antisense primers - the sequences of the primers sense and antisense that you want to buy written from the 5 position - the intron length - the amplicon length - submit the file to moodle.
54 I exon green, II exon pink position of primer sense position of primer antisense Then, you have to write the primer sequence to order them to a company: Primer sense: Primer antisense: Amplicon length: Intron length:
55 Student Learning Outcomes (SLOS) KNOWLEDGE AND LEARNING SKILLS USE OF KNOWLEDGE AND LEARNING SKILLS - how to use Annhyb to save and manage sequences - how to use Annhyb to prepare primers for PCR - how to design and order primers for PCR - how to use BLAST to compare sequences - how to get exon map of a cdna - how to identify specific domains within a cdna INDEPENDENT JUDGEMENT COMMUNICATION SKILLS
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin)
PrimePCR Assay Validation Report
Gene Information Gene Name collagen, type IV, alpha 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID COL4A1 Human This gene encodes the major type IV alpha
PrimePCR Assay Validation Report
Gene Information Gene Name transforming growth factor, beta 1 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID TGFB1 Human This gene encodes a member of the
Quantitative Real Time PCR USING SYBR GREEN
Quantitative Real Time PCR USING SYBR GREEN SYBR Green SYBR Green is a cyanine dye that binds to double stranded DNA. When it is bound to D.S. DNA it has a much greater fluorescence than when bound to
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
REAL TIME PCR USING SYBR GREEN
REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM
Construction of plant complementation vector and generation of transgenic plants
MATERIAL S AND METHODS Plant materials and growth conditions Arabidopsis ecotype Columbia (Col0) was used for this study. SALK_072009, SALK_076309, and SALK_027645 were obtained from the Arabidopsis Biological
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist
INTRODUCTION TO REVERSE TRANSCRIPTION PCR (RT-PCR) ABCF 2016 BecA-ILRI Hub, Nairobi 21 st September 2016 Roger Pelle Principal Scientist Objective of PCR To provide a solution to one of the most pressing
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Alternative Cleavage and Polyadenylation of RNA
Developmental Cell 18 Supplemental Information The Spen Family Protein FPA Controls Alternative Cleavage and Polyadenylation of RNA Csaba Hornyik, Lionel C. Terzi, and Gordon G. Simpson Figure S1, related
Recombinant DNA Technology
History of recombinant DNA technology Recombinant DNA Technology (DNA cloning) Majid Mojarrad Recombinant DNA technology is one of the recent advances in biotechnology, which was developed by two scientists
Assay Design Considerations, Optimization and Validation
Assay Design Considerations, Optimization and Validation Ray Meng, Ph.D. International Field Applications Specialist Gene Expression Division Bio-Rad Laboratories, Inc. Assay Design Considerations Experiment
Functional Genomics Research Stream. Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update
Functional Genomics Research Stream Research Meeting: June 19, 2012 SYBR Green qpcr, Research Update Updates Alternate Lab Meeting Fridays 11:30-1:00 WEL 4.224 Welcome to attend either one Lab Log thanks
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 2007)
QUANTITATIVE RT-PCR PROTOCOL (SYBR Green I) (Last Revised: April, 007) Please contact Center for Plant Genomics (CPG) facility manager Hailing Jin (hljin@iastate.edu) regarding questions or corrections.
The Polymerase Chain Reaction. Chapter 6: Background
The Polymerase Chain Reaction Chapter 6: Background Invention of PCR Kary Mullis Mile marker 46.58 in April of 1983 Pulled off the road and outlined a way to conduct DNA replication in a tube Worked for
Technical Review. Real time PCR
Technical Review Real time PCR Normal PCR: Analyze with agarose gel Normal PCR vs Real time PCR Real-time PCR, also known as quantitative PCR (qpcr) or kinetic PCR Key feature: Used to amplify and simultaneously
3.1.4 DNA Microarray Technology
3.1.4 DNA Microarray Technology Scientists have discovered that one of the differences between healthy and cancer is which genes are turned on in each. Scientists can compare the gene expression patterns
Chapter 17. PCR the polymerase chain reaction and its many uses. Prepared by Woojoo Choi
Chapter 17. PCR the polymerase chain reaction and its many uses Prepared by Woojoo Choi Polymerase chain reaction 1) Polymerase chain reaction (PCR): artificial amplification of a DNA sequence by repeated
PCR settings, pitfalls and artefacts
De gekoppelde afbeelding kan niet worden weergegeven. Het bestand is mogelijk verplaatst, heeft een andere naam gekregen of is verwijderd. Controleer of de koppeling verwijst naar het juiste bestand en
Supplementary Data: Fig. 1S Detailed description of In vivo experimental design
1 2 Supplementary Data: Fig. 1S Detailed description of In vivo experimental design 3 4 5 6 7 8 9 Relative Expression Studies 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 The
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Quant One Step RT-PCR Kit
1. Quant One Step RT-PCR Kit For fast and sensitive one-step RT-PCR www.tiangen.com/en RT121221 Quant One Step RT-PCR Kit Kit Contents Cat. no. KR113 Contents Hotmaster Taq Polymerase (2.5 U/μl) Quant
Bio 101 Sample questions: Chapter 10
Bio 101 Sample questions: Chapter 10 1. Which of the following is NOT needed for DNA replication? A. nucleotides B. ribosomes C. Enzymes (like polymerases) D. DNA E. all of the above are needed 2 The information
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
M1D2: Diagnostic Primer Design 2/10/15
M1D2: Diagnostic Primer Design 2/10/15 Announcements 1. Expanded office hours for this week: Wednesday, 3-5pm in 16-319 Friday, 3-5pm in 16-319 Sunday, 3-5pm in 16-319 2. Weekly office hours (starting
Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
USB HotStart-IT. for increased specificity and consistent results. PCR, qpcr and qrt-pcr
USB HotStart-IT for increased specificity and consistent results PCR, qpcr and qrt-pcr USB PCR Reagents Choose USB HotStart-IT products for increased specificity and consistent results. Long and Accurate
CHAPTER 21 LECTURE SLIDES
CHAPTER 21 LECTURE SLIDES Prepared by Brenda Leady University of Toledo To run the animations you must be in Slideshow View. Use the buttons on the animation to play, pause, and turn audio/text on or off.
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
measuring gene expression December 5, 2017
measuring gene expression December 5, 2017 transcription a usually short-lived RNA copy of the DNA is created through transcription RNA is exported to the cytoplasm to encode proteins some types of RNA
QuickExtract RNA Extraction Kit
Cat. Nos. QER09015 and QER090150 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 299 12/2012 1
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time
qpcr qpcr Quantitative PCR or Real-time PCR Gives a measurement of PCR product at end of each cycle real time Differs from endpoint PCR gel on last cycle Used to determines relative amount of template
RNA-Sequencing analysis
RNA-Sequencing analysis Markus Kreuz 25. 04. 2012 Institut für Medizinische Informatik, Statistik und Epidemiologie Content: Biological background Overview transcriptomics RNA-Seq RNA-Seq technology Challenges
Computational Biology I LSM5191
Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA
Introduction to Real-Time PCR: Basic Principles and Chemistries
Introduction to Real-Time PCR: Basic Principles and Chemistries Leta Steffen, PhD Applications Scientist Promega Corporation Outline I. Real-Time PCR overview Basics of Real-Time PCR Understanding the
Quant-X One-Step qrt-pcr TB Green Kit User Manual
Takara Bio USA Quant-X One-Step qrt-pcr TB Green Kit User Manual Cat. No. 638317 PT5058-1 (022818) 1290 Terra Bella Avenue, Mountain View, CA 94043, USA U.S. Technical Support: techus@takarabio.com United
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04
Bauer Core Standard Protocol Title: Guidelines for Designing Real Time PCR Experiments Pages: 5 Revision: 1.1 Date: 4/15/04 Author(s): Claire Reardon Reviewers: Christian Daly Contact: claire@cgr.harvard.edu
Score winning cdna yields with SuperScript III RT
Score winning cdna yields with RT SuperScript III offers: Higher cdna yields Higher thermal stability Longer half-life than any other RT you could use Announcing SuperScript III Reverse Transcriptase How
Lecture #1. Introduction to microarray technology
Lecture #1 Introduction to microarray technology Outline General purpose Microarray assay concept Basic microarray experimental process cdna/two channel arrays Oligonucleotide arrays Exon arrays Comparing
Protein Synthesis Notes
Protein Synthesis Notes Protein Synthesis: Overview Transcription: synthesis of mrna under the direction of DNA. Translation: actual synthesis of a polypeptide under the direction of mrna. Transcription
PCR-SSP primer mixes for KIR3DL3 non-synonymous polymorphism, and SNP linkage (L) reactions.
PCR-SSP primer mixes for KIR3DL3 non-synonymous polymorphism, and SNP linkage (L) reactions. Reaction KIR3DL3 Polymorphism Sense primers Antisense primers Amplicon Control no size (bp) Product 1 b Exon
Genome Sequence Assembly
Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual MyBioSource.com Catalog # MBS826230
mmu-mir-200a-3p Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # MBS826230 For the detection and quantification of mirnas mmu-mir-200a-3p normalized by U6 snrna using Real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR
SOP: SYBR Green-based real-time RT-PCR By Richard Yu Research fellow Centre for Marine Environmental Research and Innovative Technology (MERIT) Department of Biology and Chemistry City University of Hong
Product Name : Simple mirna Detection Kit
Product Name : Simple mirna Detection Kit Code No. : DS700 This product is for research use only Kit Contents This kit provides sufficient reagents to perform 20 reactions for detecting microrna. Components
P HENIX. PHENIX PCR Enzyme Guide Tools For Life Science Discovery RESEARCH PRODUCTS
PHENIX PCR Enzyme Guide PHENIX offers a broad line of premium quality PCR Enzymes. This PCR Enzyme Guide will help simplify your polymerase selection process. Each DNA Polymerase has different characteristics
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Principals of Real-Time PCR. Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt
Principals of Real-Time PCR Amira A. T. AL-Hosary Lecturer of Infectious Diseases, Faculty of Veterinary Medicine, Assiut University, Egypt What Is Real-Time PCR? Nucleic acid (DNA) amplification and detection
scgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
Host : Dr. Nobuyuki Nukina Tutor : Dr. Fumitaka Oyama
Method to assign the coding regions of ESTs Céline Becquet Summer Program 2002 Structural Neuropathology Lab Molecular Neuropathology Group RIKEN Brain Science Institute Host : Dr. Nobuyuki Nukina Tutor
REAL-TIME PCR: FROM THEORY TO PRACTICE REAL-TIME PCR.
REAL-TIME PCR: FROM THEORY TO PRACTICE REAL-TIME PCR Put the odds in your favor with SuperScript RT. Engineered to be RNase H and incredibly thermostable, SuperScript III RT delivers robust first-strand
Table of Contents. PrimeScript TM RT-PCR Kit. I. Kit Contents...2. Storage...3. Principle...4. Features...5. V. Notes...5. Protocol...
Table of Contents I. Kit Contents...2 II. III. IV. Storage...3 Principle...4 Features...5 V. Notes...5 VI. Protocol...6 VII. PCR Condition...8 VIII. Application...8 IX. Preparation of RNA sample...10 X.
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes
Higher Human Biology Unit 1: Human Cells Pupils Learning Outcomes 1.1 Division and Differentiation in Human Cells I can state that cellular differentiation is the process by which a cell develops more
Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix
Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR
DNA Structure and Analysis. Chapter 4: Background
DNA Structure and Analysis Chapter 4: Background Molecular Biology Three main disciplines of biotechnology Biochemistry Genetics Molecular Biology # Biotechnology: A Laboratory Skills Course explorer.bio-rad.com
PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE INDIA
PCR PRIMER DESIGN SARIKA GARG SCHOOL OF BIOTECHNOLGY DEVI AHILYA UNIVERSITY INDORE-452017 INDIA BIOINFORMATICS Bioinformatics is considered as amalgam of biological sciences especially Biotechnology with
GeneCopoeia TM. All-in-One qpcr Mix For universal quantitative real-time PCR. User Manual
GeneCopoeia TM Expressway to Discovery All-in-One qpcr Mix For universal quantitative real-time PCR Cat. No. AOPR-0200 (200 qpcr reactions) Cat. No. AOPR-0600 (600 qpcr reactions) Cat. No. AOPR-1000 (1000
One Step SYBR PrimeScript RT-PCR Kit II (Perfect Real Time)
Cat. # RR086A For Research Use One Step SYBR PrimeScript RT-PCR Kit II Product Manual Table of Contents I. Description...3 II. III. IV. Principle...3 Components...5 Storage...6 V. Features...6 VI. VII.
Genes and gene finding
Genes and gene finding Ben Langmead Department of Computer Science You are free to use these slides. If you do, please sign the guestbook (www.langmead-lab.org/teaching-materials), or email me (ben.langmead@gmail.com)
PrimeScript RT Master Mix (Perfect Real Time)
Cat. # RR036A For Research Use PrimeScript RT Master Mix (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Kit Components... 3 III. Materials Required but not Provided... 3 IV.
Learning Objectives :
Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual
mmu-mir-34a Real-time RT-PCR Detection Kit User Manual Catalog # CPK1272 For the detection and quantification of mirna mmu-mir-34a using Real-Time RT-PCR detection instruments. For research use only. Not
Introduction To Real-Time Quantitative PCR (qpcr)
Introduction To Real-Time Quantitative PCR (qpcr) Samuel Rulli, Ph.D. Samuel.Rulli@QIAGEN.com Technical Support: BRCsupport@qiagen.com The products described in this webinar are intended for molecular
ProtoScript. First Strand cdna Synthesis Kit DNA AMPLIFICATION & PCR. Instruction Manual. NEB #E6300S/L 30/150 reactions Version 2.
DNA AMPLIFICATION & PCR ProtoScript First Strand cdna Synthesis Kit Instruction Manual NEB #E6300S/L 30/150 reactions Version 2.2 11/16 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
AMV First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR AMV First Strand cdna Synthesis Kit Instruction Manual NEB #E6550S Store at 20 C ISO 9001 Registered Quality Management ISO 14001 Registered Environmental Management ISO 13485 Registered
601 CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTT GACAGGTGTGTTAGACGGGAAAGCTTTCTAGGGTTGCTTTTCTCTCTGGTGTACCAGGAA >>>>>>>>>>>>>>>>>>
BIO450 Primer Design Tutorial The most critical step in your PCR experiment will be designing your oligonucleotide primers. Poor primers could result in little or even no PCR product. Alternatively, they
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang
Chimp Chunk 3-14 Annotation by Matthew Kwong, Ruth Howe, and Hao Yang Ruth Howe Bio 434W April 1, 2010 INTRODUCTION De novo annotation is the process by which a finished genomic sequence is searched for
TUTORIAL: PCR ANALYSIS AND PRIMER DESIGN
C HAPTER 8 TUTORIAL: PCR ANALYSIS AND PRIMER DESIGN Introduction This chapter introduces you to tools for designing and analyzing PCR primers and procedures. At the end of this tutorial session, you will
BioBank TM cdna Kit. Instructions for the use of BioBank TM cdna in real-time PCR. BioBank control cdna
BioBank TM cdna Kit Instructions for the use of BioBank TM cdna in real-time PCR BB BioBank control cdna Contents Introduction 3 Kit Contents 4 Reagents and Equipment to Be Supplied by User 4 PrimerDesign
Chimp Sequence Annotation: Region 2_3
Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker
ReverTra Ace qpcr RT Master Mix
Instruction manual ReverTra Ace qpcr RT Master Mix 1203 F1173K ReverTra Ace qpcr RT Master Mix FSQ-201 200 reactions Store at -20 C Contents [1] Introduction [2] Components [3] Protocol 1. RNA template
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues
An improved quantitative real-time PCR protocol for precisely measuring D-amino acid oxidase mrna in rat tissues Yoshikazu Nishiguchi 1*, Koichi Kitamura 1, Naoko Watanabe 2, Anna Kozaki 3, Hayato Otani
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
Introduction to Microarray Data Analysis and Gene Networks. Alvis Brazma European Bioinformatics Institute
Introduction to Microarray Data Analysis and Gene Networks Alvis Brazma European Bioinformatics Institute A brief outline of this course What is gene expression, why it s important Microarrays and how
DNA makes RNA makes Proteins. The Central Dogma
DNA makes RNA makes Proteins The Central Dogma TRANSCRIPTION DNA RNA transcript RNA polymerase RNA PROCESSING Exon RNA transcript (pre-mrna) Intron Aminoacyl-tRNA synthetase NUCLEUS CYTOPLASM FORMATION
LightCycler 480 qpcr Tools. Meeting the Challenge of Your Research
LightCycler 480 qpcr Tools Meeting the Challenge of Your Research Find the Optimal LightCycler 480 Reagents for Your Research Application: Are you analyzing DNA DNA Nucleic acid isolation Manual processing
Protein Synthesis & Gene Expression
DNA provides the instructions for how to build proteins Each gene dictates how to build a single protein in prokaryotes The sequence of nucleotides (AGCT) in DNA dictates the order of amino acids that
Table of content. One Step SYBR R PrimeScript TM RT-PCR Kit II (Perfect Real Time) I. Description...2. II. Principle III. Kit Contents...
Table of content I. Description...2 II. Principle... 2 III. Kit Contents...4 IV. Storage...5 V. Features...5 VI. Note...5 VII. Protocol...6 VIII. Experiment Example...11 IX. Appendix...12 X. Guideline
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna
Supplementary Figure 1: sgrna library generation and the length of sgrnas for the functional screen. (a) A diagram of the retroviral vector for sgrna expression. It contains a U6-promoter-driven sgrna
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application
Supplemental Table S1. Primers used for relevant analysis. Gene Accession# Forward primer (5 -) Reverse primer (5 -) Application SCD1 NM_173959.4 CACGCAAAAGCAGGCTCAGGA GCATCTGGGCTCTCAGACACT RT-qPCR ACC1
Bio 121 Practice Exam 3
The material covered on Exam 3 includes lecture since the last exam and text chapters 13-21. Be sure that you read chapter 19, which was not represented in the notes. 1. Which of the following is an enveloped
II First Strand cdna Synthesis Kit
DNA AMPLIFICATION & PCR ProtoScript II First Strand cdna Synthesis Kit Instruction Manual NEB #E6560S/L 30/150 reactions Version 1.5 12/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
PrimeScript RT reagent Kit (Perfect Real Time)
Cat. # RR037A For Research Use PrimeScript RT reagent Kit (Perfect Real Time) Product Manual Table of Contents I. Description... 3 II. Components... 3 III. Storage... 3 IV. Features... 4 V. Precautions...
Targeted Sequencing Using Droplet-Based Microfluidics. Keith Brown Director, Sales
Targeted Sequencing Using Droplet-Based Microfluidics Keith Brown Director, Sales brownk@raindancetech.com Who we are: is a Provider of Microdroplet-based Solutions The Company s RainStorm TM Technology
Make the protein through the genetic dogma process.
Make the protein through the genetic dogma process. Coding Strand 5 AGCAATCATGGATTGGGTACATTTGTAACTGT 3 Template Strand mrna Protein Complete the table. DNA strand DNA s strand G mrna A C U G T A T Amino
The Genetic Code and Transcription. Chapter 12 Honors Genetics Ms. Susan Chabot
The Genetic Code and Transcription Chapter 12 Honors Genetics Ms. Susan Chabot TRANSCRIPTION Copy SAME language DNA to RNA Nucleic Acid to Nucleic Acid TRANSLATION Copy DIFFERENT language RNA to Amino
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design
Optimize Your qpcr and RT-qPCR Assays with Careful Planning and Design Nadine Nassif, January 2013 Outline Real-Time PCR overview / Understanding qpcr data qpcr detection strategies: dye-based versus label-based
Roche Molecular Biochemicals Technical Note No. LC 10/2000
Roche Molecular Biochemicals Technical Note No. LC 10/2000 LightCycler Overview of LightCycler Quantification Methods 1. General Introduction Introduction Content Definitions This Technical Note will introduce
Chapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
LATE-PCR. Linear-After-The-Exponential
LATE-PCR Linear-After-The-Exponential A Patented Invention of the Laboratory of Human Genetics and Reproductive Biology Lab. Director: Lawrence J. Wangh, Ph.D. Department of Biology, Brandeis University,
UCSC Genome Browser. Introduction to ab initio and evidence-based gene finding
UCSC Genome Browser Introduction to ab initio and evidence-based gene finding Wilson Leung 06/2006 Outline Introduction to annotation ab initio gene finding Basics of the UCSC Browser Evidence-based gene
REAL TIME PCR. 1 of 12 12/30/2013 8:17 PM. PowerPoint version of this page. Dr Margaret Hunt
1 of 12 12/30/2013 8:17 PM x x x PowerPoint version of this page x To see larger images, click on the image which will be enlarged in a pop-up window. You must close this window before opening another.
REAL TIME PCR. PowerPoint version of this page
REAL TIME PCR Dr Margaret Hunt PowerPoint version of this page To see larger images, click on the image which will be enlarged in a pop-up window. You must close this window before opening another. This
DyNAmo HS SYBR Green qpcr Kit
DyNAmo HS SYBR Green qpcr Kit Instruction manual F-410S Sufficient for 40 reactions (50 µl each) F-410L Sufficient for 200 reactions (50 µl each) Description... 2 Applications... 2 Kit Components... 2
DyNAmo Flash SYBR Green qpcr Kit
DyNAmo Flash SYBR Green qpcr Kit Instruction manual F-415S F-415L 40 reactions (50 µl each) or 100 reactions (20 µl each) 200 reactions (50 µl each) or 500 reactions (20 µl each) Description... 2 Kit Components...