COMPARISON OF DETECTION THRESHOLD OF DIFFERENT PASTEURELLA MULTOCIDA SPECIFIC PCRs

Transcription

1 Indian J. Anim. Res., 46 (1) : 28-33, 2012 AGRICULTURAL RESEARCH COMMUNICATION CENTRE / indianjournals.com COMPARISON OF DETECTION THRESHOLD OF DIFFERENT PASTEURELLA MULTOCIDA SPECIFIC PCRs Lalsiamthara Jonathan and Anil Kumar Arora College of Veterinary Science, G. A. D. Veterinary and Animal Sci. Univ., Ludhiana , India Received : Accepted : ABSTRACT The present study was undertaken to determine the detection threshold of five different Pasteurella multocida PCRs using a standard vaccine strain P52 as DNA template. The purified genomic DNA was diluted ten-fold serially and then subject to polymerase chain reaction. Among the primers assessed, IPFWD or IPREV primers showed the highest sensitivity, detecting purified DNA at 5 fg concentration (~2 bacterial cells). KMT1T7 & KMT1SP6, KTSP61 & KTT72 and PSL-(forward & reverse) primers could detect P52 DNA at the levels of 500, 50 and 50 pg respectively. PM23F1 & PM23R2 primers were the least sensitive and could detect P52 DNA at 5 ng concentration only. Key Words: Pasteurella multocida, Polymerase chain reaction (PCR), Detection threshold. INTRODUCTION Pasteurella multocida the causative agent of haemorrhagic septicaemia is an important veterinary and human opportunistic pathogen. Haemorrhagic septicaemia (HS) has a wide distribution particularly in tropical countries in Asia and Africa. Haemorrhagic septicaemia is a disease of utmost economic importance particularly in Asia due to large population of buffalo which are having high susceptibility and high case fatality (Benkirane and De Alwis 2002). HS is an acute disease that requires a quick and accurate diagnosis. Enrichment of the organism from clinical samples i.e. nasal swab and blood in broths give satisfactory PCR result but this step must be avoided for rapid confirmation of the disease especially in peracute cases where the course of treatment for the herd depends on laboratory test results. Detection of P. m u lt o c i d a nucleic acids in a whole blood collected from a suspected HS animal assures the confirmation of the disease. Polymerase Chain Reaction (PCR) based techniques are specific, highly sensitive, rapid and efficient. Identification of P. m u l t o c i d a isolates with PCR assay targeting different genes have been developed (Kasten et al 1997; Brickell et al 1998; Townsend et al 1998; Miflin and Blackall 2001). It is therefore necessary to evaluate and compare the detection threshold of these PCR-primers. MATERIALS AND METHODS DNA Template: Standard P. m u l t o c i d a vaccine strain (P52) was available in the Department of Veterinary Microbiology, GADVASU, Ludhiana, Punjab. Extraction of genomic DNA: The genomic DNA of P. m u l t o c i d a strains was extracted by the method described by Wilson (1987) with some modifications. The integrity of the DNA sample was determined on 0.8% Agarose gel containing ethidium 0.05µl/ml by the presence or absence of smearing along the length of the gel. Concentration and Purity of DNA: The concentration and purity of the extracted DNA was determined using Spectrophotometer (Nanodrop, Thermo-Scientifics). DNA dilution for determination of sensitivity: The purified genomic DNA of P52

2 was diluted with sterile TE buffer to yield 10ng/ µl of DNA and then the accuracy of the concentration was checked using NanoDrop. From the 10ng/µl DNA concentration stock, dilution was made to yield DNA concentration of 1ng/µl. From this concentration a 10-fold serial dilutions were made. The primers (Sigma- Aldrich Chemical Pvt. Ltd., Bengaluru.) used for the study were shown in (Table 1):- PCR programme for each primers were standardized in the laboratory and the PCR reaction mixture were optimized and calculated accordingly as shown in the tables. RESULTS AND DISCUSSION Standard P. m u l t o ci d a Vaccine strain (P52) was used for determining the sensitivity of different P. m u l t o c i d a specific PCR-primers. 10 fold serial dilution of the purified DNA were made, starting from 1ng/µl DNA concentration Vol. 46, No. 1, to the 7th serial dilution giving 1 fg/µl. From each dilution, 5 µl was used for PCR reactions. The study was designed to compare the primers sensitivity under optimum reaction condition. The detection thresholds of different primers are depicted in Table 10. The most widely used primers namely PM specific primers (KMT1T7 & KMT1SP6) and HSB (B:2) specific primers (KTSP61 & KTT72) developed by Townsend et al (1998) could detect DNA at the amount of 500 pg and 50 pg respectively (Fig. 1 and 2). The PSL primers (Kasten et al 1997) could moderately detect P52 DNA at the amount of 50pg and could not detect beyond this dilution (Fig. 3). The primers PM23F1 and PM23R2 designed by Miflin and Blackall (2001) showed the least sensitivity (Fig. 5) and could only detect P52 DNA at 5ng concentration. However, the primers IPFWD and IPREV developed by Brickell et al (1998) gave the TABLE 1: The list primers used for detection of P. multocida Sequence Product Size Reference PM- KMT1T7 5 - GCTGTAAACGAACTCGCCAC-3 KMT1SP6 5 ACTCGCTATTTACCCAGTGG bp Townsend et al 1998 HSB- KTSP61 KTT72 5` ATC CGC TAA CAC ACT CTC 3` 5` AGG CTC GTT TGG ATT ATG AAG 3` 590 bp Townsend et al 1998 PSL- Forward Reverse 5` TCT GGA TCC ATG AAA AAA CTA ACT AAA GTA 3` 5` AAG GAT CCT TAG TAT GCT AAC ACA GCA CGA CG 3` 480 bp Kasten et al 1997 Brickell IPFWD IPREV 5` CGA AAG AAA CCC AAG GCG AA 3` 5` ACA ATC GAA TAA CCG TGA GAC 3` 334 bp Brickell et al 1998 Miflin PM23F1 PM23R2 5` GGC TGG GAA GCC AAA TCA AAG 3` 5` CGA GGG ACT ACA ATT ACT GTA A 3` 1432 bp Miflin and Blackall 2001

3 30 INDIAN JOURNAL OF ANIMAL RESEARCH TABLE 2: PM & HSB PCR Reaction Mixture H2O 13.3 PCR Buffer 10X PCR Buffer 1X 2.5 MgCl2 25 mm 1.5 mm1.5 dntps 10 mm 200 µm pmol/µl 20 pmol/µl 1 X 2 Taq 5 U/µl 1 U/µl 0.2 Total Volume 25 TABLE 3: PM & HSB PCR Program Stage Step Temperature C Duration No. of Cycles I Initial Denaturation 95 4 min 1 II Denaturation s Annealing s 30 Extension s III Final Extension 72 6 min 1 TABLE 4: PSL PCR Reaction Mixture H2O PCR Buffer 10X PCR Buffer 1X 2.5 MgCl2 25 mm 1 mm 1.0 dntps 10 mm 200 µm pmol/µl 25 pmol/µl 1 x 2 Taq 5 U/µl 1.25 U/µl 0.25 Total Volume 25 TABLE 5: PSL PCR Program Stage Step Temperature C Duration No. of Cycles I Initial Denaturation 94 2 min 1 II Denaturation 94 1 min 35 Annealing s Extension 72 3 min III Final Extension 72 7 min 1 TABLE 6: Brickell PCR Reaction Mixture H2O 9.9 PCR Buffer 10X PCR Buffer 1X 2.0 MgCl2 25 mm 1.5 mm 1.2 dntps 10 mm 200 µm pmol/µl 0.25 µm 0.5 X 2 Taq 5 U/µl 2.5 U/µl 0.5 Total Volume 20

4 Vol. 46, No. 1, 2012 TABLE 7: Brickell PCR Program Stage Steps Temperature C Duration No. of Cycles I Initial Denaturation 94 4 min 1 II Denaturation s 35 Annealing s Extension s III Final Extension 72 5 min 1 TABLE 8: Miflin PCR Reaction Mixture H2O 12.0 PCR Buffer 10X PCR Buffer 1X 2.5 MgCl2 25 mm 1.5 mm 1.5 dntps 10 mm 400 µm pmol/µl 0.5 µm 1.25 X 2 Taq 5 U/µl 2.5 U/µl 0.5 Total Volume 25 TABLE 9: Miflin PCR Program Stage Steps Temperature C Duration No. of Cycles I Initial Denaturation 95 3 min 1 II Denaturation 94 1 min 30 Annealing 69 1 min Extension 72 1 min III Final Extension min 1 TABLE 10: Detection Threshold of different PCRs. 31 +: Positive result : Negative result PCR (Expected Band Size) PM-PCR (460 bp) HSB- PCR (590 bp) PSL-PCR (480 bp) Brickell PCR (334 bp) Miflin PCR (1432 bp) KMT1T7 KMT1SP6 KTSP61 KTT72 Forward Reverse IPFWD IPREV PM23F1 PM2 3R2 Concentrations of P52 DNA/reaction 5 ng 500 pg 50 pg 5 pg 500 fg 50 fg 5 fg maximum sensitivity of detection as low as 5 fg of P52 DNA (Fig. 4), which is equivalent to ~2 P. m u l t o c i d a bacterial cell. In overall, the primers selected for the study are fairly sensitive and all could detect P52 DNA at 5ng concentration. The present study is not directly comparable to the work of other authors due

5 32 INDIAN JOURNAL OF ANIMAL RESEARCH FIG 1: Agarose gel image of PM-PCR showing 460bp bands at lane 2 &3. FIG 3: Agarose gel image of PSL-PCR showing 480bp bands at lane 2, 3 and 4. FIG 2: Agarose gel image of HSB-PCR showing 590bp bands at lane 2, 3 & 4. FIG 4: Agarose gel image of Brickell-PCR showing 334bp bands at lane 2-8. *MM - Molecular Weight Marker bp - base pair ng - nanogram pg picogram fg femtogram *MM - Molecular Weight Marker bp - base pair ng - nanogram pg picogram fg femtogram to the design of experiment. The PSL-PCR, as reported by Kasten et al (1997), using the PCR and hybridization has the detection limit 24 femtograms of purified P. m ul t o c i d a DNA. The PM-PCR developed by Townsend et al (1998) demonstrated a sensitivity of less than 10 organisms (Lee et al 2000) without the need for additional hybridization. Further, Lee et al (2000) reported that the PM-PCR have a high sensitivity, with the assay being able to detect as few as 100 cells of P. mult o cid a in seeded, autoclaved chicken intestinal contents. However, this detection was not achieved by direct detection. Rather, the 100 cells of P. mult o cid a were mixed in the autoclaved colon contents and then incubated in brain heart infusion broth overnight and the PCR then used on the subsequent growth.

6 FIG 5: Agarose gel image of Miflin-PCR showing 1432bp band at lane 2. *MM - Molecular Weight Marker bp - base pair ng nanogram pg picogram fg femtogram Vol. 46, No. 1, Confirmation of HS case can be done within 6hrs right from the collection of blood sample to laboratory test i.e. DNA extraction-pcr-gel running and analysis. However, the detection of the P. multocida nucleic acid from blood requires a highly sensitive PCR since the number of the organism may be less without prior enrichment. In some cases, the number of the organism in blood may be further decreased due to the administration of antibiotics before blood collection, in such instances running a secondary PCR using amplicons from primary may be required. The advantage of using IPFWD and IPREV primers (Brickell et al 1998) not only depends on the sensitivity but also that they are B:2 specific primers; the most common P. multocida serotype causing HS in buffaloes and cattles in India. Hence, this PCR helps in confirmation of genus as well as the serotype of the organism. REFERENCES Benkirane A and De Alwis M C L. (2002). Veterinary Medicine - Czech 47: Brickell S K, Thomas L M, Long K A, Panaccio M and Widders P R. (1998). Veterinary Microbiology 59: Kasten R W, Carpenter T E, Snipes K P and Hirsch D C. (1997). Avian Diseases 41: Lee C W, Wilkie I W, Townsend K M and Frost A J. (2000). Veterinary Microbiology 72: Miflin J K and Blackall P J. (2001). Letters in Applied Microbiology 33: Townsend K M, Frost A J, Lee C W, Papadimitriou J M and Dawkins H J S. (1998). Journal of Clinical Microbiology 36: Wilson K (1987). Preparation of genomic DNA from bacteria. In: F.M. Ausubal, R. Brent, R.L. Kirston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhl (Eds.), Current Protocols in Molecular Biology Vol. 1. John Wiley and Sons, New York pp