an innovation in high throughput single cell profiling
|
|
|
- Scot Lane
- 5 years ago
- Views:
Transcription
1 an innovation in high throughput single cell profiling
2 Why use high throughput single cell profiling? Techniques such as high throughput scrna-seq (single cell RNA sequencing) offer an unprecedented combination of quality and quantity of single cell data For example, heterogeneous samples from tissue, blood etc. containing thousands of cells can be rapidly profiled at the single cell level. This enables the quantification of gene expression and in turn the identification and quantification of individual cell types. High throughput profiling of paired V(D)J transcripts from B cells and T cells enables the investigation of diversity and clonality in an antibody or TCR repertoire. This offers useful insights into immune responses and reactions. Why choose Nadia? Nadia, developed by Dolomite Bio, takes high throughput scrna-seq to the next level by using innovation to solve a vast range of industry-wide challenges see Nadia Technology Highlights on page 8. By automatically encapsulating single cells in microfluidic droplets with mrna capture beads, Nadia generates up to 8,000 barcoded single cell mrna libraries in minutes. After sequencing, this enables detailed profiling of large heterogeneous cell populations. Adding the Nadia Innovate upgrade to the Nadia Instrument transforms it into a system for the development of novel protocols and applications. Dolomite Bio s in-house team of biologists and worldwide network of local specialists work with you to provide advice for your application, product demonstrations, installation, training and support.
3 scrna-seq Workflow SAMPLE PREPARATION. Upstream Prepare suspension of single cells or nuclei from virtually any eukaryotic sample e.g. tissues, blood, biopsies, tumours, cultured cells, plants, yeasts, protoplasts, etc. Bead Cell CELL LYSIS AND mrna CAPTURE Inside a given droplet, an individual cell is lysed and its mrna is captured on a single uniquely barcoded bead. The droplets are collected in the on-chip reservoir. Droplet Barcode MICROFLUIDIC COMPARTMENTALIZATION OF CELLS WITH BARCODED mrna CAPTURE BEADS Thousands of single cells are individually compartmentalized with barcoded oligo beads in droplets. To achieve this, separate suspensions of cells and beads are combined before being dropletized in oil on a microfluidic chip. Structure of the Barcoded Oligonucleotide '. Nadia Instrument Primer Binding Site Cell Barcode UMI T T T T T T Droplet Bead Barcode mrna Structure of the Barcoded Oligonucleotide ' Primer Binding Site Cell Barcode UMI T T T T T T FIRST STRAND cdna SYNTHESIS Off chip, the droplets are broken and the single cell mrna barcoded beads are recovered in bulk. The barcoded oligo on the bead primes reverse transcription of the mrna. The resulting bead-bound single cell cdna libraries are uniquely barcoded by cell-of-origin. BC NGS SEQUENCING. Downstream LIBRARY AMPLIFICATION Cell:... N GENE GENE 7 8 GENE GENE M 0 BIOINFORMATICS PIPELINE The pooled Structure barcoded of the cdna Barcoded libraries Oligonucleotide are A digital gene expression matrix is generated typically processed with a Nextera kit and using an established pipeline: ) Sequences sequenced using an Illumina sequencer are assigned to genes by aligning to the i.e. HiSeq 000/00/NextSeq /MiSeq. genome and the results grouped by barcode The libraries may be Primer also be Binding processed Site for Cell Barcode (cell). ) UMI Unique Molecular Identifiers sequencing on other platforms e.g. for full length are counted for each gene in each cell to sequencing for analysis of alternate splicing. determine transcript abundance. ' The barcoded cdnas are amplified in bulk with primers annealing to the primer binding sites on the bead oligo sequence and the Template Switch Oligo (TSO) sequence. This results in a pool of the thousands of single cell cdna libraries. T T T T T T DATA VISUALIZATION A typical approach includes t-stochastic neighbour embedding (t-sne), a nonlinear dimensionality reduction technique to enable D (or D) visualization of single cell clusters. ' ' TSO
4 The Nadia Instrument The Nadia Instrument is a microfluidic droplet based platform for single cell research that automatically runs,, or 8 cell samples in parallel in ~ mins. Each sample generates up to,000 high quality single cell libraries. After automatically detecting an application-specific microfluidic cartridge e.g. for Drop-seq, the Nadia Instrument guides users through sample loading via the touchscreen user interface and runs the samples automatically. Benefits: Flexibly Configurable: The Nadia Instrument can run standard protocols, or be transformed into a configurable system, when used with Nadia Innovate Easy to use: Automatic detection of applicationspecific cartridges of chips, touch screen interface and sample loading guide lights under the chip Truly single cell: Ultra low cell doublet rates due to gentle cell agitation Variable sample size: Run,, or 8 samples in parallel High throughput: Run up to 8 samples in parallel with automation in ~ mins High quality results: Automated sample chilling maintains transcriptome state No cross contamination: Uses disposable microfluidic chips and has no wetted instrument parts Wide range of applications: Instrument is designed for a wide variety of applications, automatically controlling flow rate, temperature, agitation and timings dependent upon the application Automated: Fully automated sample encapsulation steps Elegant user interface: Guides the user through sample loading steps 7
5 Nadia Technology Highlights The Nadia product family elegantly solves the range of industry-wide single cell profiling challenges by implementing a range of technological innovations. OIL U-BEND The oil well U-bend is proprietary technology that avoids unwanted oil wicking into the microfluidic channel before the run starts This ensures the highest quality droplets and minimizes cell doublets. Also, by a novel automated oil priming step, wicking of aqueous fluids is also avoided. SAMPLE LOADING PORTS Easy sample loading is achieved by ports designed to accept standard pipette tips. BARCODED mrna CAPTURE BEADS are needed with unique bead barcodes and UMIs (Unique Molecular Identifiers) to ensure barcoding of cdna and elimination of the effects of amplification bias. HIGH THROUGHPUT DROPLET JUNCTION Approximately 000 cells are co-encapsulated with a bead per channel. Live junction visualisation is enabled when using the Nadia Innovate. MULTIPLE CHIPS,, or 8 identical chips can be held in one cartridge. Multiple separate chips ensure greater runto-run consistency by ensuring the microfluidic pathways are identical. Above: Nadia cartridge chip Right: Cross-section of Nadia cartridge chip PRESSURE PUMPS OIL AND SURFACTANT CELL STIRRER BEAD STIRRERS TEMPERATURE CONTROLLER The ultra-smooth pressure pumps ensure Biocompatible oil and emulsion In built stirrers gently agitate the cell samples are stirred to ensure singulation and an the most monodisperse droplets possible, stabiliser are needed to enable during the run. This proprietary technology even distribution of beads throughout the run. The inbuilt temperature controller thereby maximizing the number of single droplet formation. maximizes data quality (by minimizing cell maintains the cell transcription profile cells captured. This is achieved by avoiding doublets and ensuring an even distribution by chilling samples throughout the doublets in larger droplets and avoiding FILTERS of single cells throughout the run) and GUIDE LIGHTS run. It also minimizes cell doublets cells not encapsulated with a bead in On-chip filters allow cells and maximizes successful runs by avoiding Under-chip guide lights and a wizard-style by eliminating the effect of ambient smaller droplets. beads through but filter out blockages. The stirrers avoid cell damage by touchscreen user interface indicate which temperature changes and hence fibres and other particulates, rotating gently and away from walls or bottom wells to fill at each step, avoiding potential changes in droplet size. maximizing successful runs. of the well. user errors. 8 9
6 Nadia Instrument Features: independent ultra-smooth pressure pumps each up to bar Step-by-step tutorial software Chip temperature control from C to 0 C Disposable cartridges prevent cross contamination Independent gentle stirring of beads and cells prior to encapsulation Automatic detection of application-specific cartridges of microfluidic chips Easy to use integrated touch screen interface 0
7 Nadia Innovate Nadia Innovate is a protocol development module which is easily connected to the Nadia Instrument, allowing the user to develop new single cell protocols and applications. Once validated using Nadia Innovate, protocols can be transferred to the Nadia Instrument for high throughput parallel operation. By allowing user control of parameters (such as droplet size, droplet frequency, temperature, agitation and timings), innovation is unlocked. Benefits: Open development system: Turns the Nadia Instrument into a system for development of new protocols and applications Scalable: Enables scalability from a single chip to, or 8 chips in parallel when transferring protocol to the Nadia Instrument Quick and easy set-up of experiments Rapid protocol optimization: Quickly vary droplet size, frequency, droplet components, temperature, times and agitation Easy visualization of process: Use the high-speed microscope and camera to see real-time droplet formation Flexible PC software: After automating one experiment at a time, the software can apply the same conditions to many experiments in parallel
8 Nadia Innovate Features: Integrated temperature control from 0 C Integrated stirring of aqueous reservoirs Ability to visualise droplet formation at the junction P-pump control of independent channels up to bar Option for viewing of whole chip from underside when used with an inverted microscope High speed camera allows imaging and capture of droplet formation Use single chips on the Nadia Innovate Module to optimize protocol, then run, or 8 samples in parallel on the Nadia Instrument
9 Get in touch... Join us on UK Head Office (Europe, S.E. Asia, Australasia, China, Middle East, Africa) t: + (0)7 0 North America Office t: Japan Office t: +8 8 India Office t:
working with scientists to advance single cell research
working with scientists to advance single cell research 4 introduction Why choose Nadia? 6 nadia instrument Nadia Instrument features Why use high throughput single cell profiling? Working with scrna-seq
High throughput analysis of single cell transcriptomes with Dolomite Bio s Nadia Instrument
High throughput analysis of single cell transcriptomes with Dolomite Bio s Nadia Instrument Encapsulating single cells with barcoded mrna capture beads on the Nadia Instrument Version: 3.0 Issue Date:
Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit
be INSPIRED drive DISCOVERY stay GENUINE TECHNICAL NOTE Increased transcription detection with the NEBNext Single Cell/Low Input RNA Library Prep Kit Highly sensitive, robust generation of high quality
Overcome limitations with RNA-Seq
Buyer s Guide Simple, customized RNA-Seq workflows Evaluating options for next-generation RNA sequencing Overcome limitations with RNA-Seq Next-generation sequencing (NGS) has revolutionized the study
TECH NOTE SMARTer T-cell receptor profiling in single cells
TECH NOTE SMARTer T-cell receptor profiling in single cells Flexible workflow: Illumina-ready libraries from FACS or manually sorted single cells Ease of use: Optimized indexing allows for pooling 96 cells
Throughput cells cells. Methodology Full transcript or end-counting end-counting. Chemistry SMARTer V SMARTer V. Run time hours.
PN 101-0984 A1 DATASHEET C1 mrna Sequencing Rapidly characterize heterogeneity, identify critical cell populations. Individual cells are unique they differ by size, protein levels, and expressed mrna transcripts.
TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries
TECHNICAL NOTE Assay Scheme and Configuration of Chromium Single Cell V(D)J Libraries INTRODUCTION The Chromium Single Cell V(D)J Solution produces Illumina sequencer-ready libraries for profiling T-cell
Introduction into single-cell RNA-seq. Kersti Jääger 19/02/2014
Introduction into single-cell RNA-seq Kersti Jääger 19/02/2014 Cell is the smallest functional unit of life Nucleus.ATGC.UACG. A Cell KLTSH. The complexity of biology How many cell types? How many cells?
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA
SMARTer Ultra Low RNA Kit for Illumina Sequencing Two powerful technologies combine to enable sequencing with ultra-low levels of RNA The most sensitive cdna synthesis technology, combined with next-generation
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide
Protein and transcriptome quantitation using BD AbSeq Antibody-Oligonucleotide technology and the 10X Genomics Chromium Single Cell Gene Expression Solution Jocelyn G. Olvera, Brigid S. Boland, John T.
Single-cell sequencing
Single-cell sequencing Harri Lähdesmäki Department of Computer Science Aalto University December 5, 2017 Contents Background & Motivation Single cell sequencing technologies Single cell sequencing data
Basics of RNA-Seq. (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly, PhD Team Lead, NCI Single Cell Analysis Facility
2018 ABRF Meeting Satellite Workshop 4 Bridging the Gap: Isolation to Translation (Single Cell RNA-Seq) Sunday, April 22 Basics of RNA-Seq (With a Focus on Application to Single Cell RNA-Seq) Michael Kelly,
Novel methods for RNA and DNA- Seq analysis using SMART Technology. Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc.
Novel methods for RNA and DNA- Seq analysis using SMART Technology Andrew Farmer, D. Phil. Vice President, R&D Clontech Laboratories, Inc. Agenda Enabling Single Cell RNA-Seq using SMART Technology SMART
Development of quantitative targeted RNA-seq methodology for use in differential gene expression
Development of quantitative targeted RNA-seq methodology for use in differential gene expression Dr. Jens Winter, Market Development Group Biological Biological Research Content EMEA QIAGEN Universal Workflows
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA. March 2, Steven R. Kain, Ph.D. ABRF 2013
Integrated NGS Sample Preparation Solutions for Limiting Amounts of RNA and DNA March 2, 2013 Steven R. Kain, Ph.D. ABRF 2013 NuGEN s Core Technologies Selective Sequence Priming Nucleic Acid Amplification
Introducing QIAseq. Accelerate your NGS performance through Sample to Insight solutions. Sample to Insight
Introducing QIAseq Accelerate your NGS performance through Sample to Insight solutions Sample to Insight From Sample to Insight let QIAGEN enhance your NGS-based research High-throughput next-generation
HiSeqTM 2000 Sequencing System
IET International Equipment Trading Ltd. www.ietltd.com Proudly serving laboratories worldwide since 1979 CALL +847.913.0777 for Refurbished & Certified Lab Equipment HiSeqTM 2000 Sequencing System Performance
scrna-seq and Single Cell Droplet Microfluidics Workshop CGS, Hong Kong 1 st November 2016
scrna-seq and Single Cell Droplet Microfluidics Workshop CGS, Hong Kong 1 st November 2016 1 Welcome! THANKS to CGS for hosting this workshop Thanks to UATIL for the organisation Overview of day Introduction
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA
TECH NOTE Pushing the Limit: A Complete Solution for Generating Stranded RNA Seq Libraries from Picogram Inputs of Total Mammalian RNA Stranded, Illumina ready library construction in
Single Cell Transcriptomics scrnaseq
Single Cell Transcriptomics scrnaseq Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Purpose The sequencing of
NextGen Sequencing Technologies Sequencing overview
Outline Conventional NextGen High-throughput sequencing (Next-Gen sequencing) technologies. Illumina sequencing in detail. Quality control. Sequence coverage. Multiplexing. FASTQ files. Shendure and Ji
Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time
TECHNICAL NOTE Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time INTRODUCTION RNA-seq is a next-generation sequencing technique that
Single-Cell. Defy the Law of Averages
Single-Cell AnalysiS Defy the Law of Averages An entirely new approach Single-Cell AnalysiS that Defies the Law of Averages Get Accurate, Reliable Gene expression Data with the fluidigm Single-Cell Workflow
solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome
solid S Y S T E M s e q u e n c i n g See the Difference Discover the Quality Genome See the Difference With a commitment to your peace of mind, Life Technologies provides a portfolio of robust and scalable
Overview of Next Generation Sequencing technologies. Céline Keime
Overview of Next Generation Sequencing technologies Céline Keime keime@igbmc.fr Next Generation Sequencing < Second generation sequencing < General principle < Sequencing by synthesis - Illumina < Sequencing
QIAseq mirna Library Kit The next-generation in mirna sequencing products
QIAseq mirna Library Kit The next-generation in mirna sequencing products What challenges are there with mirna Sequencing? Sample input is one of many challenges facing mirna sequencing reactions. Kits
DEFY THE LAW OF AVERAGES. Single-Cell Targeted Gene Expression Analysis
DEFY THE LAW OF AVERAGES Single-Cell Targeted Gene Expression Analysis SINGLE-CELL ANALYSIS THAT DEFIES THE LAW OF AVERAGES GET ACCURATE, RELIABLE GENE EXPRESSION DATA WITH THE FLUIDIGM SINGLE-CELL WORKFLOW
APPLICATION NOTE. Abstract. Introduction
From minuscule amounts to magnificent results: reliable ChIP-seq data from 1, cells with the True MicroChIP and the MicroPlex Library Preparation kits Abstract Diagenode has developed groundbreaking solutions
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
Isolation of total nucleic acids from FFPE tissues using FormaPure DNA
APPLICATION NOTE Isolation of total nucleic acids from FFPE tissues using FormaPure DNA Jung Hoon Doh, Ph.D. Senior Application Scientist Beckman Coulter Life Sciences, Indianapolis, IN USA Summary Extensive
Implementing the Drop-Seq Protocol on Bio-Rad s ddseq Single-Cell Isolator
Implementing the Drop-Seq Protocol on Bio-Rad s ddseq Single-Cell Isolator Kelly Kaihara and Jeremy Agresti Digital Biology Center, Bio-Rad Laboratories, Inc., 5731 W Las Positas Blvd, Pleasanton, CA Single-Cell
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd
QIAGEN s NGS Solutions for Biomarkers NGS & Bioinformatics team QIAGEN (Suzhou) Translational Medicine Co.,Ltd 1 Our current NGS & Bioinformatics Platform 2 Our NGS workflow and applications 3 QIAGEN s
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protoc ol Note Single cell 3 mrna-seq cell lysis/rt/library prep $2460/Sample 10X Genomics Chromium 500-10,000 cells/sample Single cell 5 V(D)J mrna-seq cell
SEQUENCING FROM SAMPLE TO SEQUENCE READY
SEQUENCING FROM SAMPLE TO SEQUENCE READY ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES NOT ONCE, BUT EVERY TIME n The highest quality amplicons more sensitive, accurate, and specific n Full support for all
Deep Sequencing technologies
Deep Sequencing technologies Gabriela Salinas 30 October 2017 Transcriptome and Genome Analysis Laboratory http://www.uni-bc.gwdg.de/index.php?id=709 Microarray and Deep-Sequencing Core Facility University
10X Chromium. Single Cell and Long Read Sequencing Applications and Workflow. Marie Adams, MS Genomics Core Director Van Andel Institute
10X Chromium Single Cell and Long Read Sequencing Applications and Workflow Marie Adams, MS Genomics Core Director Van Andel Institute Introduction Overview of Chromium Instrument Workflow Chromium and
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS. Genomics Solutions Portfolio
GENOMICS WORKFLOW SOLUTIONS THAT GO WHERE THE SCIENCE LEADS Genomics Solutions Portfolio WORKFLOW SOLUTIONS FROM EXTRACTION TO ANALYSIS Application-based answers for every step of your workflow Scientists
Supplementary Figure 1
Supplementary Figure 1 CITE-seq library preparation. (a) Illustration of the DNA-barcoded antibodies used in CITE-seq. (b) Antibody-oligonucleotide complexes appear as a high-molecular-weight smear when
About Strand NGS. Strand Genomics, Inc All rights reserved.
About Strand NGS Strand NGS-formerly known as Avadis NGS, is an integrated platform that provides analysis, management and visualization tools for next-generation sequencing data. It supports extensive
Gene Expression Technology
Gene Expression Technology Bing Zhang Department of Biomedical Informatics Vanderbilt University bing.zhang@vanderbilt.edu Gene expression Gene expression is the process by which information from a gene
Polaris and Callisto: Advances in Cellular Biology. Jordan Moore Senior Field Applications Specialist
Polaris and Callisto: Advances in Cellular Biology Jordan Moore Senior Field Applications Specialist Single-Cell Biology Number of cells The population average is a lie average Transcripts per cell Gene
Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation
Automation of Lexogen s QuantSeq 3 mrna-seq Library Prep Kits on the Biomek FX p NGS Workstation The Lexogen QuantSeq 3 mrna-seq Library Prep Kits for Illumina (FWD and REV) produce ready-to-sequence libraries
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS
SO YOU WANT TO DO A: RNA-SEQ EXPERIMENT MATT SETTLES, PHD UNIVERSITY OF CALIFORNIA, DAVIS SETTLES@UCDAVIS.EDU Bioinformatics Core Genome Center UC Davis BIOINFORMATICS.UCDAVIS.EDU DISCLAIMER This talk/workshop
CITE-seq & Cell Hashing Protocol
CITE-seq & Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami
Reverse transcription-pcr (rt-pcr) Dr. Hani Alhadrami hanialhadrami@kau.edu.sa www.hanialhadrami.kau.edu.sa Overview Several techniques are available to detect and analyse RNA. Examples of these techniques
Methods of Biomaterials Testing Lesson 3-5. Biochemical Methods - Molecular Biology -
Methods of Biomaterials Testing Lesson 3-5 Biochemical Methods - Molecular Biology - Chromosomes in the Cell Nucleus DNA in the Chromosome Deoxyribonucleic Acid (DNA) DNA has double-helix structure The
Introduction to the NextSeq System
Introduction to the NextSeq System 2015 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cbot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq,
DNA Arrays Affymetrix GeneChip System
DNA Arrays Affymetrix GeneChip System chip scanner Affymetrix Inc. hybridization Affymetrix Inc. data analysis Affymetrix Inc. mrna 5' 3' TGTGATGGTGGGAATTGGGTCAGAAGGACTGTGGGCGCTGCC... GGAATTGGGTCAGAAGGACTGTGGC
G E N OM I C S S E RV I C ES
GENOMICS SERVICES ABOUT T H E N E W YOR K G E NOM E C E N T E R NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. Through
Cell Hashing Protocol
Cell Hashing Protocol For experiments involving Cell Hashing, use cost per cell calculator to plan experiments, determine number of hashes, number of cells to load, expected doublet rates (detected and
SureCell WTA 3 Checklist. Prepare Cell and Barcode Suspension Mixes
Prepare, Count, and Assess Viability of Single-Cell Suspension Dissociate cells for the cell or tissue type you are using. If using adherent cells, neutralize the trypsin by adding 4x the volume. Wash
User-Demonstrated Protocol: BD Single-Cell Multiplexing Kit Human
User-Demonstrated Protocol: BD Single-Cell Multiplexing Kit For use with the 10x Chromium Single Cell 3 Reagent Kit v2 01/2018 Doc ID: 179682 Rev. 1.0 Contents Disclaimer on page 3 Overview on page 3 Workflow
Requirements for Illumina Sequencing: Constructed Library Submission
Requirements for Illumina Sequencing: Constructed Library Submission Genome Sciences Centre, BC Cancer January 2018 Table of Contents Library Construction Method for DNA...1 Library Construction Method
Introduction to RNA-Seq in GeneSpring NGS Software
Introduction to RNA-Seq in GeneSpring NGS Software Dipa Roy Choudhury, Ph.D. Strand Scientific Intelligence and Agilent Technologies Learn more at www.genespring.com Introduction to RNA-Seq In a few years,
Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Introduction to Single Cell RNA Sequencing
Introduction to Single Cell RNA Sequencing Sarah Boswell Director of the Single Cell Core, Harvard Medical School Director of Sequencing Technologies, Laboratory of Systems Pharmacology Staff Scientist/Sequencing
LiquidBiopsy LIQUIDBIOPSY. Automated Rare Template Isolation Platform
LiquidBiopsy LIQUIDBIOPSY Automated Rare Template Isolation Platform Enabling cancer research with highly multiplexed molecular analysis of serially collected blood samples The LiquidBiopsy Platform simplifies
BIOO LIFE SCIENCE PRODUCTS. NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) BIOO Scientific Corp V13.01
BIOO LIFE SCIENCE PRODUCTS NEXTflex TM 16S V4 Amplicon-Seq Kit 4 (Illumina Compatible) Catalog #: 4201-01 (16 reactions) BIOO Scientific Corp. 2013 V13.01 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product
Illumina Sequencing Overview
Illumina Sequencing Overview Part # 15045845_Rev.C 2013 Illumina, Inc. All rights reserved. Illumina, IlluminaDx, BaseSpace, BeadArray, BeadXpress, cbot, CSPro, DASL, DesignStudio, Eco, GAIIx, Genetic
CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016
CS262 Lecture 12 Notes Single Cell Sequencing Jan. 11, 2016 Background A typical human cell consists of ~6 billion base pairs of DNA and ~600 million bases of mrna. It is time-consuming and expensive to
scgem Workflow Experimental Design Single cell DNA methylation primer design
scgem Workflow Experimental Design Single cell DNA methylation primer design The scgem DNA methylation assay uses qpcr to measure digestion of target loci by the methylation sensitive restriction endonuclease
INTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS. Guy Cavet
INTELLIGENT ANTIBODY DISCOVERY FROM HUMANS AND OTHER ANIMALS Guy Cavet g.cavet@atreca.com PRECISION THERAPIES FROM THE ACTIVE IMMUNE RESPONSE Patient/Animal with Immune Response Immune Repertoire Capture
Experimental Design. Dr. Matthew L. Settles. Genome Center University of California, Davis
Experimental Design Dr. Matthew L. Settles Genome Center University of California, Davis settles@ucdavis.edu What is Differential Expression Differential expression analysis means taking normalized sequencing
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased
Human Genome Sequencing Over the Decades The capacity to sequence all 3.2 billion bases of the human genome (at 30X coverage) has increased exponentially since the 1990s. In 2005, with the introduction
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire
Who pairs with whom? High-throughput sequencing of the human paired heavy and light chain repertoire Technical Journal Club September 15 th Christina Müller Background - antibody repertoire is the sum
RNA Sequencing. Next gen insight into transcriptomes , Elio Schijlen
RNA Sequencing Next gen insight into transcriptomes 05-06-2013, Elio Schijlen Transcriptome complete set of transcripts in a cell, and their quantity, for a specific developmental stage or physiological
Single-cell sequencing
Single-cell sequencing Jie He 2017-10-31 The Core of Biology Is All About One Cell Forward Approaching The Nobel Prize in Physiology or Medicine 2004 Dr. Richard Axel Dr. Linda Buck Hypothesis 1. The odorant
Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
1 Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Reads to Discovery. Visualize Annotate Discover. Small DNA-Seq ChIP-Seq Methyl-Seq. MeDIP-Seq. RNA-Seq. RNA-Seq.
Reads to Discovery RNA-Seq Small DNA-Seq ChIP-Seq Methyl-Seq RNA-Seq MeDIP-Seq www.strand-ngs.com Analyze Visualize Annotate Discover Data Import Alignment Vendor Platforms: Illumina Ion Torrent Roche
RNA-Seq data analysis course September 7-9, 2015
RNA-Seq data analysis course September 7-9, 2015 Peter-Bram t Hoen (LUMC) Jan Oosting (LUMC) Celia van Gelder, Jacintha Valk (BioSB) Anita Remmelzwaal (LUMC) Expression profiling DNA mrna protein Comprehensive
Single-cell RNA-sequencing
Single-cell RNA-sequencing Stefania Giacomello UC Davis, 22 June 2018 Applications - Heterogeneity analysis - Cell-type identification - Cellular states in differentiation and developmental processes -
Gene Regulation Solutions. Microarrays and Next-Generation Sequencing
Gene Regulation Solutions Microarrays and Next-Generation Sequencing Gene Regulation Solutions The Microarrays Advantage Microarrays Lead the Industry in: Comprehensive Content SurePrint G3 Human Gene
www.illumina.com/hiseq www.illumina.com FOR RESEARCH USE ONLY 2012 2014 Illumina, Inc. All rights reserved. Illumina, BaseSpace, cbot, CSPro, Genetic Energy, HiSeq, Nextera, TruSeq, the pumpkin orange
InDrop Single Cell Reverse Transcription
InDrop Single Cell Reverse Transcription Reagents SuperScript III Reverse Transcriptase (Thermo Fisher Cat. No. 18080044) RNaseOUT Recombinant Ribonuclease Inhibitor (Thermo Fisher Cat. No. 10777019) 1X
High Throughput Sequencing the Multi-Tool of Life Sciences. Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center
High Throughput Sequencing the Multi-Tool of Life Sciences Lutz Froenicke DNA Technologies and Expression Analysis Cores UCD Genome Center Complementary Approaches Illumina Still-imaging of clusters (~1000
NEBNext. Multiplex Oligos for Illumina (Dual Index Primers Set 2)
LIBRARY PREPARATION Multiplex Oligos for Illumina (Dual Index Primers Set 2) Instruction Manual NEB #E7780S 96 reactions Version 1.0 11/17 be INSPIRED drive DISCOVERY stay GENUINE This product is intended
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow
The Expanded Illumina Sequencing Portfolio New Sample Prep Solutions and Workflow Marcus Hausch, Ph.D. 2010 Illumina, Inc. All rights reserved. Illumina, illuminadx, Solexa, Making Sense Out of Life, Oligator,
dbcamplicons pipeline Amplicons
dbcamplicons pipeline Amplicons Matthew L. Settles Genome Center Bioinformatics Core University of California, Davis settles@ucdavis.edu; bioinformatics.core@ucdavis.edu Microbial community analysis Goal:
Next-Generation Sequencing. Technologies
Next-Generation Next-Generation Sequencing Technologies Sequencing Technologies Nicholas E. Navin, Ph.D. MD Anderson Cancer Center Dept. Genetics Dept. Bioinformatics Introduction to Bioinformatics GS011062
Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit
Application Note 13 RNA Sample Preparation Non-Organic-Based Isolation of Mammalian microrna using Norgen s microrna Purification Kit B. Lam, PhD 1, P. Roberts, MSc 1 Y. Haj-Ahmad, M.Sc., Ph.D 1,2 1 Norgen
Illumina Bio-Rad Single Cell Sequencing For Research Use Only. Not for use in diagnostic procedures.
Illumina Bio-Rad Single Cell Sequencing 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cbot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq,
Single Cell Genomics
Single Cell Genomics Application Cost Platform/Protocol Note 3 mrna-seq Cell capture/rt/library prep $1,990/Sample 10x Genomics Chromium 500-10,000 cells/sample 5 V(D)J + mrna Cell capture/rt/library prep
A Crash Course in NGS for GI Pathologists. Sandra O Toole
A Crash Course in NGS for GI Pathologists Sandra O Toole The Sanger Technique First generation sequencing Uses dideoxynucleotides (dideoxyadenine, dideoxyguanine, etc) These are molecules that resemble
Contact us for more information and a quotation
GenePool Information Sheet #1 Installed Sequencing Technologies in the GenePool The GenePool offers sequencing service on three platforms: Sanger (dideoxy) sequencing on ABI 3730 instruments Illumina SOLEXA
Globin Block Modules for QuantSeq Instruction Manual
Globin Block Modules for QuantSeq Instruction Manual Catalog Numbers: 070 (RS-Globin Block, Homo sapiens, 96 rxn) 071 (RS-Globin Block, Sus scrofa, 96 rxn) 015 (QuantSeq 3 mrna-seq Library Prep Kit for
Fully Automated Library Quantification for Illumina Sequencing on the NGS STAR
Fully Automated Library Quantification for Illumina Sequencing on the NGS STAR Introduction Hamilton Robotics, an industry leader in liquid handling and laboratory automation equipment, has partnered with
BD Single-Cell Multiplexing Kit Human Protocol
BD Single-Cell Multiplexing Kit Protocol For use with the BD Rhapsody system 11/2017 Doc ID: 54478 Rev. 1.0 Contents Overview on page 3 Sample Tag library preparation workflow on page 4 Reference for BD
High-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights:
TECH NOTE High-quality stranded RNA-seq libraries from single cells using the SMART-Seq Stranded Kit Product highlights: Simple workflow starts directly from 1 1,000 cells or 10 pg 10 ng total RNA to generate
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION
CM581A2: NEXT GENERATION SEQUENCING PLATFORMS AND LIBRARY GENERATION Fall 2015 Instructors: Coordinator: Carol Wilusz, Associate Professor MIP, CMB Instructor: Dan Sloan, Assistant Professor, Biology,
Technical note: Molecular Index counting adjustment methods
Technical note: Molecular Index counting adjustment methods By Jue Fan, Jennifer Tsai, Eleen Shum Introduction. Overview of BD Precise assays BD Precise assays are fast, high-throughput, next-generation
Introductory Next Gen Workshop
Introductory Next Gen Workshop http://www.illumina.ucr.edu/ http://www.genomics.ucr.edu/ Workshop Objectives Workshop aimed at those who are new to Illumina sequencing and will provide: - a basic overview
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends ( )
Single Cell Genomics (SCG): Market Size, Segmentation, Growth, Competition and Trends (2013-2021) May, 2017 3 rd Edition Information contained in this market report is believed to be reliable at the time
you can see that if if you look into the you know the capability kilobases per day, per machine kind of calculation if you do.
Functional Genomics Professor S Ganesh Department of Biological Sciences & Bioengineering Indian Institute of Technology Kanpur Lecture No 11 DNA Sequencing Methods Part 2 So welcome back to this course
NGEx. High quality sequential extraction of both DNA and RNA from the same tissue specimen. Fast.
NGEx Next Generation Extraction technology The only TRULY fully automated extraction solution. No manual reagent handling. No split samples: Sequential extraction of both DNA and RNA in a single workflow
TAKE YOUR NEXT STEP WITH CONFIDENCE
TAKE YOUR NEXT STEP WITH CONFIDENCE Biomek-Automated Genomic Solutions IT STARTS WITH DEFINING THE RIGHT WORKFLOW SOLUTION FOR YOU Human Health Agricultural Animal Health Environmental Food & Beverage
Complete protocol in 110 minutes Enzymatic fragmentation without sonication One-step fragmentation/tagging to save time
Molecular Cloning Laboratories Manual Version 1.2 Product name: MCNext UT DNA Sample Prep Kit Cat #: MCUDS-4, MCUDS-24, MCUDS-96 Description: This protocol explains how to prepare up to 96 pooled indexed
NextSeq 500 System WGS Solution
NextSeq 500 System WGS Solution An accessible, high-quality whole-genome sequencing solution for any species. Highlights High-Quality, High-Coverage Genome Illumina chemistry offers highest read quality
Welcome to the NGS webinar series
Welcome to the NGS webinar series Webinar 1 NGS: Introduction to technology, and applications NGS Technology Webinar 2 Targeted NGS for Cancer Research NGS in cancer Webinar 3 NGS: Data analysis for genetic
HyperCap, an automatable workflow on the Agilent Bravo B
Automation Note February 2018 HyperCap, an automatable workflow on the Agilent Bravo B 1. OVERVIEW As the demand for next-generation sequencing (NGS) grows, laboratories must adapt to manage increased
How much sequencing do I need? Emily Crisovan Genomics Core
How much sequencing do I need? Emily Crisovan Genomics Core How much sequencing? Three questions: 1. How much sequence is required for good experimental design? 2. What type of sequencing run is best?