scrna-seq and Single Cell Droplet Microfluidics Workshop CGS, Hong Kong 1 st November 2016

Transcription

1 scrna-seq and Single Cell Droplet Microfluidics Workshop CGS, Hong Kong 1 st November

2 Welcome! THANKS to CGS for hosting this workshop Thanks to UATIL for the organisation Overview of day Introduction to Blacktrace and Dolomite Bio Introduction to applications / RNA Seq Introduction to products used in the workshop

3 Who are we? Yann Lecouturier Regional Director Europe and China Nadia Shakir Applications Scientist

4 Today s timetable Start End Description Presenter 09:45 10:00 Registration 10:00 10:15 Introduction Yann 10:45 11:15 11:15 12:30 Introduction to Droplet Microfluidics: Basics for Biologists including overview of Single Cell Analysis, µencapsulator and scrna-seq system Demo and Hands-On Session 1: - Group A: µencapsulator, Microfluidic Basics, Dolomite Chips and Connectors - Group B: RNA-Seq Protocol on Dolomite s RNA-Seq System 12:30 13:30 Lunch 13:30 14:00 Introduction and Discussion on Single Cell RNA-Seq and Recent Advances in Biology Droplet Microfluidics Demo and Hands-On Session 2: 14:00 15:15 15:15 15:45 Q&A and Feedback - Group A: RNA-Seq Protocol on Dolomite s RNA-Seq System - Group B: µencapsulator, Microfluidic Basics, Dolomite Chips and Connectors Yann Yann, Nadia Nadia Yann, Nadia Yann, Nadia 15:45 16:00 End of Workshop Yann

5 The Blacktrace Group

6 Blacktrace Profile Ahead of the Curve Productizing Science A world leading global group of companies with HQ in UK Over 95% export - Approx 40% Americas, 30% EU, 30% Asia 2 offices in Royston- UK, 1 office in Sutton- UK, 1 office in Boston- US, 1 office in Yokohama- JP, 1 office in Mumbai- IN, 1 office in Sao Paolo- BR 40 distributors around the world Driven by Productising Science Focus on growth Doing as many new things as possible, development and launch of new advanced products and technologies Cutting edge markets and technology 120 people globally across group at present 45 in R&D absolute top class people

7 Syrris Products: Batch and Flow Chemistry Products Syrris develops and sells the coolest and most advanced technology products for R&D Chemists around the world Ahead of the Curve Productizing Science

8 Dolomite: Microfluidic Products Ahead of the Curve Productizing Science Dolomite develops and sells the coolest most advanced technology microfluidic products around the world Lab-on-Chip Diagnostics Analytical Instruments Environmental Monitoring Drug Discovery and Delivery Polymer particles Precision particle production Food Research Nanoparticles And many more!

9 Glass Solutions: Glass fabrication services Precision Glass Manufacturing for others Glass Blowing Typically starts from tubing Typically involves melting the glass with flames to form shapes 70% Scientific OEM End Users 30% Architecture and design Ahead of the Curve Productizing Science

10 About Dolomite Bio Dolomite Bio creates innovative products for high throughput single cell research. By encapsulating single cells in microfluidic droplets, our products enable rapid analysis of individual cells and their biological products. Our products include complete systems; convenient modules such as pumps, chips, microscopes and temperature control units; and system control software. This allows the analysis of tens to hundreds of thousands of single cells or molecules in parallel. The sample can be processed in a few minutes, and the entire process can be scaled from a few cells to millions or more.

11 Dolomite Bio Dolomite Bio was founded in March 2016 from its sister company Dolomite Microfluidics (part of the Blacktrace Group of companies). We went live with the launch of our website on 5 th July Dolomite Bio consists of a dedicated team of molecular biologists and engineers focussed on creating innovative products for high throughput single cell research. Dolomite Bio now serves all of Dolomite Microfluidics biology customers. We believe this will be a positive step forward for our customers and future customers.

12 Example of Dolomite Bio System Cell encapsulation system Productised: complete off-the-shelf system available High precision & quality Robust and reliable Easy to use

13 Encapsulation

14 Droplet biology Encapsulating millions of single cells (or nucleic acids) in precisely controlled, picolitre volume, droplet micro-reactors Cells Single cells + reaction mix in droplets oil Reaction mix 50 mm oil Enables exciting new applications that address longstanding, biologically important, problems

15 Droplets

16 Microfluidic Droplets Microfluidics enables: Production of highly monodisperse droplets, emulsions, double emulsions, bubbles or particles and is ideal for performing chemical and biochemical reactions in droplets Droplets from 1µm to 100's of µm's (femto- to nanoliter range) can be generated with exceptionally high control and reproducibility from research to production scale

17 Droplets Suitable for Cell Encapsulation Hydrophilic coating (pure glass) Hydrophobic OR Fluorophilic coating + + Hydrophilic surface Hydrophobic surface 17

18 Coating + Aqueous fluid + Organic fluid + Surfactant Fluid choice and surfactant choice can be confusing Dolomite can coat glass surfaces (hydrophobic and fluorophilic) and supplies a range of surfactants Chip surface coating Hydrophilic Hydrophobic Fluorophilic Droplet Fluid Hydrocarbon or fluorocarbon Oil Water Water Carrier Fluid Water Hydrocarbon oil Fluorocarbon oil Ideal for Biology Applications Surfactant in carrier Hydrophilic surfactant Hydrophobic surfactant Fluorinated surfactant Eg. Chip surface coating Hydrophilic Hydrophobic Fluorophilic Droplet Fluid Dichloromethane, mineral oil Water Carrier Fluid Water Mineral oil, decane, hexadecane Water FC-40 Surfactant in carrier PVA SPAN-80 Picosurf

19 Microfluidic Droplets

20 Droplet Generation Modes Dripping regime Monodisperse droplet formation. Jetting regime Flowing too fast Chaotic Adjust ratios Backflow Pressure imbalance.

21 Droplet Generation Water Droplet PicoSurf1 carrier P Q P Q mbar ul/min mbar ul/min Water Droplet PicoSurf1 carrier P Q P Q mbar ul/min mbar ul/min Water Droplet PicoSurf1 carrier P Q P Q mbar ul/min mbar ul/min

22 Product Overview P-Pump P-Pump (pressure pump) Ultra smooth flow 0-10 bar pressures Sensor display for real time display of flow rates Flow rate sensor fast and accurate measurements of ultra low liquid rates About Applications Capabilities Products Systems Components Summary

23 Droplet biology BACK TO CELL ENCAPSUALTION Cells Single cells + reaction mix in droplets oil Reaction mix 50 mm oil WHAT ARE THE BENEFITS AND APPLICATIONS

24 Droplet biology Why use droplets? Droplets can be used as micro-compartments or micro-reactors Single cells (or DNA or RNA molecules) are captured in individual droplets This allows millions of reproducible compartmentalised reactions to be carried out on single cells in parallel e.g., RT-PCR

25 Droplet biology General principles Usually for biology applications, water droplets in oil The oil used for this is typically a fluorocarbon oil, which are like hydrocarbon oils, but have fluorine atoms substituted for hydrogen atoms Stable, inert, biocompatible, allow gas exchange Like hydrocarbons, but fluorine atoms substituted for hydrogen atoms Humans can breathe fluorocarbons. Liquid ventilation research: e.g. deep sea diving; in patients with respiratory distress; neonatal intensive care Droplets are stabilised by a surfactant (e.g. Pico-Surf) Frequently desired to have not more than one cell/droplet Generally achieved by limiting dilution: e.g. 1 cell/10 droplets

26 Droplet biology Some common applications that are enabled: High throughput single cell RNA sequencing Neural tissues Developmental biology Tumour/CTC characterisation Profiling T cell clonotypes Isolating antibody coding sequences from blood samples FACS sorting, by encapsulating cells in double emulsion droplets Encapsulating cells in hydrogel beads Imaging cell-cell interactions in precisely controlled environments e.g., single cells in matrigel beads; interactions between one cancer call and one immune cell, etc.

27 Droplet biology Benefits Becomes possible, for the first time, to analyse millions of single cells e.g., more than 10 5 single cell libraries/hour Single cell reactions become efficient and robust Droplets are small, so e.g. effective mrna concentration is high Precisely-controlled micro-reactor volumes result in reproducible performance

28 Droplet biology Benefits Can capture quantitative data from rare cells Encapsulation of cells in precisely-sized hydrogel beads enables: the gel beads to protect transplanted cells from the host immune system the gel beads allow reagents to be diffused in and out of captured cells Enables imaging in precisely controlled 3D environments Cell Bead 50 mm

29 Practical sessions There will be two practical sessions in the laboratory µencapsulator (dry demo), basics of microfluidics, Chips and Connectors scrna-seq Wet demo Everyone will be split into two groups Group A: 10:45 12:30 µencapsulator, basics of microfluidics, Chips and Connectors 14:00 15:15 scrna-seq Group B: 10:45 12:30 scrna-seq 14:15 15:15 µencapsulator, basics of microfluidics, Chips and Connectors

30 What equipment will be used in the RNA-Seq practical session? scrna-seq System It uses the same reagents and beads described in the Drop-seq protocol, simplifying adoption and increasing reliability. Generates ~10,000 single cell libraries in a 15 minute run Second channel allows co-encapsulation of single cells with oligonucleotide-barcoded beads and lysis buffer Automation and integrated droplet analysis via PC software

31 How does Drop-seq work? Create a suspension of the cells of interest Create a suspension of beads with lysis buffer On microfluidic chip, flow suspensions 1 and 2 together with oil to make droplets in oil and collect off chip In the droplets, cells lyse and mrna is captured on a DNA barcoded bead Off chip, break open the droplets and wash the beads Perform RT and library prep Sequence library

32 What other equipment will be shown? µencapsulator System The μencapsulator System is a complete system for high throughput encapsulation of individual cells into picolitre droplets. Works with small samples of 100μl or less Encapsulation of single cells, DNA, etc. Encapsulates 300,000 cells in 15 minutes Second channel allows co-encapsulation with functionalized beads and/or reaction mix Ideal for profiling natively paired TCRs, isolating antibody coding sequences, encapsulating cells in hydrogels or encapsulating expression libraries for FACS sorting Automation and integrated droplet analysis via PC software

33 mencapsulator System Integrated microfluidic device Precise temperature control Minimal dead volume Droplet chip ports Sample reservoir chip cells Pico-Surf Droplet outlet beads cells beads Oil Pico-Surf Droplet outlet Oil Droplet junction Droplet chip Sample reservoir chip

34 PRACTICAL SESSION

35 Applications

36 Droplet Biology Applications High throughput single cell RNA-Seq Paired sequencing of antibodies or TCRs Droplets for FACS-sorting libraries Encapsulating cells in gel microbeads

37 Single cell RNA-Seq

38 Single cell RNA-Seq High throughput single cell RNA sequencing is enabled by microfluidic droplets Can generate at least 10 4 single-cell libraries/hour Simple, robust, reliable, fast Discover new cell types Track cell behaviour over experiments The only commercially available complete system is the Dolomite cell encapsulation system

39 Single cell RNA-Seq Cells are a fundamental unit of biology, traditional methods, e.g. microarrays, PCR, homogenise cell populations, can t see individual cells Therefore, cell types in populations are generally somewhat cryptic Many cell types remain to be discovered Methods for preparing single cell cdna libraries are laborious, require a lot of skill, are low throughput, and difficult to do reproducibly

40 Single cell RNA-Seq Individual cells are captured in droplets with mrna-capture beads Each bead has a unique DNA sequence barcode There are 16 million unique barcodes in the bead library The cells are lysed, and the released mrna is captured on the beads Uniquely barcoded RNAcapture beads Cells Oil Thousands of barcoded single cell transcriptomes Cells Oil 1. Cells are encapsulated with lysis buffer and a bead 2. The cell is broken open by the lysis buffer, releasing the mrna, which is captured by the bead 3. The beads are recovered from the emulsion for the next step Drop-seq: Macosko, Evan Z., et al. "Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets." Cell (2015): indrop: Klein, Allon M., et al. "Droplet Barcoding for Single-Cell Transcriptomics Applied to Embryonic Stem Cells." Cell (2015):

41 Bar-coded beads The bar-code is a random DNA sequence Each bead has >>10 6 copies of a single bar-code sequence A 12 nt barcode library has 4 12 = 16 million unique sequences Therefore, at least 1 million cells can be uniquely barcoded The poly(dt) sequence captures mrna, and primes cdna synthesis cdnas are tagged with the barcode Primer binding site barcode UMI 5 AAGCAGTGGTATCAACGCAGAGTAC JJJJJJJJJJJJ NNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 3 Primer binding site barcode UMI TTTTT Macosko, et al. Cell 161:1202

42 Single cell RNA-Seq Macosko PDMS chip Standard glass chip Workflow overview Cells Oil Uniquely barcoded RNA-capture beads Oil Thousands of barcoded single cell transcriptomes - The functional features are identical to the Macosko/McCarroll PDMS chip - Glass chips are stable, high precision, chemically inert, easy to setup, clean and use

43 Single cell RNA-Seq System setup Cells buffer Beads buffer Oil Droplets at 4,000 droplets/second Cell droplets Bead 125 mm 300 mm

44 Single cell RNA-Seq Summary Cell encapsulation enables an exciting new era of high throughput single cell RNA-Seq Enables complete observation of cell types, cell behaviours At least 10 4 single-cell libraries/hour Simple, efficient, robust, reliable, fast The only commercially available complete system is the Dolomite cell encapsulation system

45 Paired sequencing of antibodies or TCRs

46 Isolating antibody coding sequences Cell encapsulation enables the isolation of natively-paired antibody coding sequences from blood samples Isolate monoclonal antibodies, potential therapeutic antibodies From human blood samples Profile antibodies from multiple patients At various stages of infection and recovery Very fast, high throughput, reproducible Current methods: Hybridomas, dilution single cell cloning, ELISA screening Only applicable to mice/mouse antibodies

47 Isolating antibody coding sequences Antibodies: - Specifically tag pathogens for destruction - Secreted by B cells - ~10 5 B cells/ml of blood - Up to repertoire B Cell antibodies bacterium antigen - Specific antibodies are crucial and heavily-used research tools - Therapeutic antibodies also very valuable - However, because antibodies need to be correctly paired, and each B cell clone makes a different antibody, can t just RT-PCR antibodies from blood - Therefore, isolating an antibody requires at least weeks of work (immunising mice & making, amplifying & screening hybridomas) Isolation of thousands of individual B cells in microfluidic droplets Enables: Isolation of monoclonal antibodies, potential therapeutic antibodies From human blood samples Profile antibodies from multiple patients At various stages of infection and recovery Fast, high throughput, reproducible

48 Isolating antibody coding sequences Beads, + single cells, in droplets Lysis, mrna capture on beads Break emulsion, recover & wash beads, perform Reverse Transcription oil B cells RNA capture beads + lysis buffer oil Single beads, with PCR mix, in droplets oil Overlap Extension PCR: amplification and fragment fusion in droplets, high throughput sequencing cdna beads PCR mix oil Turchaninova, Maria A., et al. "Pairing of T cell receptor chains via emulsion PCR." European journal of immunology 43.9 (2013): DeKosky, Brandon J., et al. "In-depth determination and analysis of the human paired heavy-and light-chain antibody repertoire." Nature medicine 21.1 (2015):

49 Analysing natively-paired T Cell Receptors a Reliably encapsulating single lymphocytes with mrna capture beads Encapsulate single cells with beads Uses poly(dt) beads to capture mrnas from single cell b 100 mm d 10% 8% Stable cell encapsulation rate, few doubles 6% 4% c bead e 2% 0% 100% 0 mins 7 mins 14 mins 1 cell 2+ cells Bead encapsulation rate is stable 80% lymphocyte 60% 40% 100 mm 20% 0% 0 min 7 min 15 min 0 beads 1 bead

50 Isolating antibody coding sequences Advantages Rapidly isolate antibody coding sequences from blood samples Profile patient responses to infections or vaccines Thousands of natively-paired antibodies, in simple, rapid workflow Only commercially available complete system

51 Sorting libraries, using FACS-sortable microfluidic droplets

52 Encapsulating an expression library for FACS sorting Expression library, e.g., an enzyme Encapsulation of expression library with substrate oil Bacterial host Expression plasmid e.g., enzyme substrate oil Collection tube Development of reaction Re-encapsulation, with aqueous continuous phase water Droplets for FACS sorting Aqueous core Oil shell Substrate Product water Aqueous continuous phase Zinchenko et al. "One in a million: flow cytometric sorting of single cell-lysate assays in monodisperse picolitre double emulsion droplets for directed evolution." Analytical chemistry (2014) 86:2526

53 Droplets for FACS-sorting Sorting microfluidic droplets is a powerful capability Can be achieved by FACS sorting small double emulsion droplets Aqueous continuous phase Small droplets (e.g., 20 30) Applications In vitro evolution e.g., flu evolution Evolutionary dynamics Protein engineering by directed evolution Therapeutic proteins Industrial enzymes

54 Droplets for FACS-sorting In the first stage, cells are encapsulated in water-in-oil droplets 15 um hydrophilic chip, 2 pl droplets, at least 5 khz a Cells Aqueous Pico-Surf b 50 mm Second stage, w/o droplets encapsulated in water, to form water-in-oilin-water droplets 20 um fluorophilic chip, 20 um droplets, at least 3 khz c d 70 mm

55 Droplets for FACS-sorting Cells in double emulsion droplets 4.5 mm red blood cell Pico-Surf shell 20 mm 70 mm 50 mm 100 mm

56 Droplets for FACS-sorting Advantages The droplets can be fed into any standard FACS The method makes FACS-sorting droplets very accessible The two-chip method is very simple and robust Mono-disperse droplets can readily be made between mm Only commercially-available system for small double emulsions 4.5 mm red blood cell Pico-Surf shell 20 mm

57 Encapsulating cells in hydrogels

58 Encapsulating cells in hydrogel Encapsulating cells in gel micro-beads Cell therapy encapsulate cells for transplantation Protects cells from host immune system Nutrients diffuse in, secreted factors diffuse out Cell culture Highly defined & reproducible 3D culture conditions e.g., epithelial acini cultured in gel beads Controlled imaging/cell interaction conditions PCR and other reactions Cells can be encapsulated in gel beads, and reagents (e.g., lysis) washed in and out

59 Encapsulating cells in gel micro-beads Cells may be encapsulated in agarose, gelatin, alginate, etc. Cells can grow for days in beads oil Cell suspension Gel oil

60 Encapsulating cells in hydrogel Advantages Mono-disperse gel beads are a highly reproducible and controlled environment Allow natural 3D growth, with good diffusion and scalability Encapsulating cells in beads also allows reagents (e.g. lysis buffer, PCR buffer) to be readily washed in and out

61 Cell encapsulation Systems

62 Dolomite Bio cell encapsulation system Dolomite Bio cell encapsulation system Productised: complete off-the-shelf system available Easy to use High precision & quality Robust and reliable Modular, upgradeable

63 FCC Advanced control software The encapsulation system can be controlled from FCC Advanced software

64 P-Pumps Powerful, versatile, ultra-smooth pumping for microfluidics Controllable from FCC Advanced software 67

65 High Speed Digital Microscope Designed specifically for droplet microfluidics Visualises high speed droplet production 0.05 ms minimum exposure time Internal high intensity light source Long working distance

66 mencapsulator Simple microfluidic device, specifically for biology Compatible with cells, beads, biochemical reactions Efficient and complete processing of small samples Precise temperature control, by mounting on the TCU

67 mencapsulator system Integrated microfluidic device Precise temperature control Minimal dead volume Droplet chip ports Sample reservoir chip cells Pico-Surf Droplet outlet beads cells beads Oil Pico-Surf Droplet outlet Oil Droplet junction Droplet chip Sample reservoir chip

68 e.g., encapsulation of beads & cells Reliably encapsulating single cells with mrna capture beads Enables very high throughput single cell RT-PCR e.g., antibody isolation, TCR profiling 100 mm bead lymphocyte 50 mm bead lymphocyte 10% 8% 6% 4% 2% Stable cell encapsulation rate, few doubles 100 mm 0% 0 mins 7 mins 14 mins 1 cell 2+ cells

69 2-chip double emulsion on mencapsulator 1 st stage, water-in-oil (WO) droplets 2 nd stage, re-encapsulate to water-in-oil-in-water droplets Oil Buffer Aqueous droplet core FACS Cells Buffer Oil Oil shell First stage, 15 mm fluorophilic chip ( ) Second stage, 15 mm hydrophilic chip ( ) Reagent 1 WO droplets in WO droplets out WOW droplets out Pico-Surf in Buffer in Reagent 2 Spacer oil in

70 Agarose beads for mencapsulation Agarose is attractive for encapsulation Enabled by precise temperature control in mencapsulator 50 mm agarose beads formed with low gelling temperature agarose Oil mencapsulator Oil 100 mm Temperature controller 100 mm Robust temperature control allows encapsulation at mild temperatures

71 Summary

72 Summary Flexible systems for cell encapsulation Dolomite Bio s systems: Include all hardware and software Include installation and training High quality Scalable Modular High precision with reproducible results User-friendly: easy to set-up, use and operate Broad range of applications

73 Thank you for your attention