Source of D. littoralis fosmid clones

Size: px
Start display at page:

Download "Source of D. littoralis fosmid clones"

Transcription

1 Source of D. littoralis fosmid clones Libby Slawson Bio 4342 January 28, 2004 Overview What is a fosmid? Library construction Selection of target genes Probing the Library Confirming clones What is a fosmid? A cloning system based on the E. coli F factor. These clones have an average insert size of 40 Kb, with a very small standard deviation. -NCBI glossary 1

2 Library Construction Fosmid library we are using was created by the BACPAC Resource Center Genomic DNA was partially digested by MboI (four-cutter), size selected, and cloned into the BamHI site of pfos1 NNGATCNNNNNNNNNNGATCNN NNGATCNNNNNNNNNNCTAGNN MboI NGGATCCN NCCTAGGN MboI BamHI NGGATCNNNNNNNNNNGATCCN NCCTAGNNNNNNNNNNCTAGGN? Packaging into Phage Why fosmids? This library was available on a gridded membrane Filters were spotted with 36,864 colonies, representing 18,432 individual clones, spotted in duplicate Order by number! 2

3 Our research goal To compare sequence from the dot chromosome of D. melanogaster with D. littoralis Selection of target genes by Rachel Shevchek Small (dot) chromosome of many Drosophila species is known to have similar genes (Podemski, 2001*) Sequencing has recently been completed for D. pseudoobscura, a species my diverged from D. melanogaster Last spring, Rachel did a BLAST comparison using cdna sequences from all the genes from the dot chromosome of D. melanogaster to the genomic sequence of D. pseudoobscura from the Baylor website She looked for >200bp chunks of genes that were very highly conserved (>80%) and designed PCR primers using Primer3 ( *Podemski, Ferrer, Locke (2001) Whole arm inversions of chromosome 4 in Drosophila species, Chromosoma 110, PCR primers designed for 30 genes total Fourth Chromosome Map: Conserved Genes Between D. melanogaster and D. psuedoobscura 25kb PlexB pan Ank CG31998 Ci CG kb Syt7 BEST CG2052 Hcf 425kb CaMKI CG11533 zfh2 Thd1 CG1970 onecut 625kb Eph CG1732 CG11360 ey bt1 bt2 CG31992 myoglianin 825kb CG11152 CG11148 Glu-Ra CG11093 toy unc kb PlexA ATPsyn CG32018 Arf102F 3

4 PCR generation of probe template Rachel did PCR using D. melanogaster genomic DNA for template The PCR products were used as template for the probe reaction Probing the libraries by Elmer Kellmann PCR products were used as template in a Klenow reaction with 32 P labeled dctp Three probes were pooled to use in one hybridization Filters were probed and washed at low stringency because of large amount of distance between species After exposing the filters to film, Elmer picked positive clones and ordered from the BACPAC center Results 52 positive clones 4

5 Confirming clones Why confirm? Methods used: Since we pooled several probes in one hybridization, we didn t know which clone corresponded to which probe/gene We could have ordered the wrong clone BACPAC center could have sent us the wrong clone Colony hybridization Slot blot Southern blot Overlapping restriction fragments In situ hybridizations Something could have gotten labeled wrong Colony hybridization Slot blots 5

6 Southern blots We needed to do preliminary restriction mapping to send on to the GSC Transfer gel to filter after taking a picture and blot Ended up not working so well Overlapping restriction maps In situ hybridizations Ten fosmids in process of being probed against polytene chromosomes of D. littoralis Being done in the lab of Dr. Mary-Lou Pardue at MIT Will not tell us what gene the fosmid contains, but will tell us where some of the DNA from the fosmid is localized *example in situ, not our results 6

7 Confirmed clones 18 of the original 52 fosmid clones were sent on to the GSC Successful libraries were made from 10 clones by Library Core You are working on the subclones picked from these libraries The other 8 clones will be finished by the instructors and new techniques will be used to find clones for next year Map of clones to date 25 kb pan 2 GSC Ank CG32000 CG kb BEST Hcf 2 GSC CG GSC 425 kb CaMKI CG11533 Thd1 1-2 GSC CG1970 onecut 1 GSC 625 kb 450 kb CG1732 CG31992 bt2 1 GSC 2 GSC 825 kb Glu-Ra CG11093 toy 1025 kb 925 kb ATPsyn Arf 2 GSC 950 kb 975 kb 1000 kb 1025 kb 1050 kb Questions? 7

8 Your fosmid clones XAAA103 Arf102F, CG11093 XAAA106 Overlapping RE maps XAAA11 ATPsynB XAAA112 Hcf, CG2052 XAAA113 Hcf, CG2052 XAAA121 BEST XAAA122 BEST XAAA72 Onecut XAAA73 CG1970, CG31998 XAAA83 Overlapping RE maps Reminder: Hybridization means sequence similarity, not genetic homology! 8

The fourth chromosome: targeting heterochromatin formation in Drosophila. Drosophila melanogaster chromosomes

The fourth chromosome: targeting heterochromatin formation in Drosophila. Drosophila melanogaster chromosomes The fourth chromosome: targeting heterochromatin formation in Drosophila Drosophila melanogaster chromosomes modified from TS Painter, 1934, J. Hered 25: 465-476. 1 DNA packaging domains HATs Euchromatin

More information

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.

GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two

More information

Finished (Almost) Sequence of Drosophila littoralis Chromosome 4 Fosmid Clone XAAA73. Seth Bloom Biology 4342 March 7, 2004

Finished (Almost) Sequence of Drosophila littoralis Chromosome 4 Fosmid Clone XAAA73. Seth Bloom Biology 4342 March 7, 2004 Finished (Almost) Sequence of Drosophila littoralis Chromosome 4 Fosmid Clone XAAA73 Seth Bloom Biology 4342 March 7, 2004 Summary: I successfully sequenced Drosophila littoralis fosmid clone XAAA73. The

More information

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library

Biology 105: Introduction to Genetics PRACTICE FINAL EXAM Part I: Definitions. Homology: Reverse transcriptase. Allostery: cdna library Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Reverse transcriptase Allostery: cdna library Transformation Part II Short Answer 1. Describe the reasons for

More information

Molecular Cell Biology - Problem Drill 11: Recombinant DNA

Molecular Cell Biology - Problem Drill 11: Recombinant DNA Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? Problem Set 5 answers 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive

More information

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross?

1a. What is the ratio of feathered to unfeathered shanks in the offspring of the above cross? 1. Whether or not the shanks of chickens contains feathers is due to two independently assorting genes. Individuals have unfeathered shanks when they are homozygous for recessive genes at two loci; the

More information

Selected Techniques Part I

Selected Techniques Part I 1 Selected Techniques Part I Gel Electrophoresis Can be both qualitative and quantitative Qualitative About what size is the fragment? How many fragments are present? Is there in insert or not? Quantitative

More information

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction

Reading Lecture 8: Lecture 9: Lecture 8. DNA Libraries. Definition Types Construction Lecture 8 Reading Lecture 8: 96-110 Lecture 9: 111-120 DNA Libraries Definition Types Construction 142 DNA Libraries A DNA library is a collection of clones of genomic fragments or cdnas from a certain

More information

Genome Projects. Part III. Assembly and sequencing of human genomes

Genome Projects. Part III. Assembly and sequencing of human genomes Genome Projects Part III Assembly and sequencing of human genomes All current genome sequencing strategies are clone-based. 1. ordered clone sequencing e.g., C. elegans well suited for repetitive sequences

More information

B. Incorrect! Ligation is also a necessary step for cloning.

B. Incorrect! Ligation is also a necessary step for cloning. Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease

More information

Enzyme that uses RNA as a template to synthesize a complementary DNA

Enzyme that uses RNA as a template to synthesize a complementary DNA Biology 105: Introduction to Genetics PRACTICE FINAL EXAM 2006 Part I: Definitions Homology: Comparison of two or more protein or DNA sequence to ascertain similarities in sequences. If two genes have

More information

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc.

Chapter 20 Recombinant DNA Technology. Copyright 2009 Pearson Education, Inc. Chapter 20 Recombinant DNA Technology Copyright 2009 Pearson Education, Inc. 20.1 Recombinant DNA Technology Began with Two Key Tools: Restriction Enzymes and DNA Cloning Vectors Recombinant DNA refers

More information

Chapter 6 - Molecular Genetic Techniques

Chapter 6 - Molecular Genetic Techniques Chapter 6 - Molecular Genetic Techniques Two objects of molecular & genetic technologies For analysis For generation Molecular genetic technologies! For analysis DNA gel electrophoresis Southern blotting

More information

Finishing Drosophila ananassae Fosmid 2410F24

Finishing Drosophila ananassae Fosmid 2410F24 Nick Spies Research Explorations in Genomics Finishing Report Elgin, Shaffer and Leung 23 February 2013 Abstract: Finishing Drosophila ananassae Fosmid 2410F24 Finishing Drosophila ananassae fosmid clone

More information

Molecular Biology: DNA sequencing

Molecular Biology: DNA sequencing Molecular Biology: DNA sequencing Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. SEQUENCING OF LARGE TEMPLATES As we have seen, we can obtain up to 800 nucleotides

More information

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction

BIOTECHNOLOGY. Sticky & blunt ends. Restriction endonucleases. Gene cloning an overview. DNA isolation & restriction BIOTECHNOLOGY RECOMBINANT DNA TECHNOLOGY Recombinant DNA technology involves sticking together bits of DNA from different sources. Made possible because DNA & the genetic code are universal. 2004 Biology

More information

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour

M Keramatipour 2. M Keramatipour 1. M Keramatipour 4. M Keramatipour 3. M Keramatipour 5. M Keramatipour Molecular Cloning Methods Mohammad Keramatipour MD, PhD keramatipour@tums.ac.ir Outline DNA recombinant technology DNA cloning co Cell based PCR PCR-based Some application of DNA cloning Genomic libraries

More information

Genome Sequence Assembly

Genome Sequence Assembly Genome Sequence Assembly Learning Goals: Introduce the field of bioinformatics Familiarize the student with performing sequence alignments Understand the assembly process in genome sequencing Introduction:

More information

Organization of the libraries. For PCR screening

Organization of the libraries. For PCR screening Organization of the libraries For PCR screening Recall : Construction of a library (YAC and BAC) Genomic DNA Vector BAC YAC restriction enzyme digestion + PFGE BAC YAC ligation transformation Host-cells

More information

Chapter 20 Biotechnology

Chapter 20 Biotechnology Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction

More information

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence

Annotating 7G24-63 Justin Richner May 4, Figure 1: Map of my sequence Annotating 7G24-63 Justin Richner May 4, 2005 Zfh2 exons Thd1 exons Pur-alpha exons 0 40 kb 8 = 1 kb = LINE, Penelope = DNA/Transib, Transib1 = DINE = Novel Repeat = LTR/PAO, Diver2 I = LTR/Gypsy, Invader

More information

BS 50 Genetics and Genomics Week of Nov 29

BS 50 Genetics and Genomics Week of Nov 29 BS 50 Genetics and Genomics Week of Nov 29 Additional Practice Problems for Section Problem 1. A linear piece of DNA is digested with restriction enzymes EcoRI and HinDIII, and the products are separated

More information

Genome Sequencing-- Strategies

Genome Sequencing-- Strategies Genome Sequencing-- Strategies Bio 4342 Spring 04 What is a genome? A genome can be defined as the entire DNA content of each nucleated cell in an organism Each organism has one or more chromosomes that

More information

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1

CAP BIOINFORMATICS Su-Shing Chen CISE. 10/5/2005 Su-Shing Chen, CISE 1 CAP 5510-9 BIOINFORMATICS Su-Shing Chen CISE 10/5/2005 Su-Shing Chen, CISE 1 Basic BioTech Processes Hybridization PCR Southern blotting (spot or stain) 10/5/2005 Su-Shing Chen, CISE 2 10/5/2005 Su-Shing

More information

Lecture Four. Molecular Approaches I: Nucleic Acids

Lecture Four. Molecular Approaches I: Nucleic Acids Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single

More information

Finishing Drosophila Grimshawi Fosmid Clone DGA19A15. Matthew Kwong Bio4342 Professor Elgin February 23, 2010

Finishing Drosophila Grimshawi Fosmid Clone DGA19A15. Matthew Kwong Bio4342 Professor Elgin February 23, 2010 Finishing Drosophila Grimshawi Fosmid Clone DGA19A15 Matthew Kwong Bio4342 Professor Elgin February 23, 2010 1 Abstract The primary aim of the Bio4342 course, Research Explorations and Genomics, is to

More information

1. A brief overview of sequencing biochemistry

1. A brief overview of sequencing biochemistry Supplementary reading materials on Genome sequencing (optional) The materials are from Mark Blaxter s lecture notes on Sequencing strategies and Primary Analysis 1. A brief overview of sequencing biochemistry

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

BIO 202 Midterm Exam Winter 2007

BIO 202 Midterm Exam Winter 2007 BIO 202 Midterm Exam Winter 2007 Mario Chevrette Lectures 10-14 : Question 1 (1 point) Which of the following statements is incorrect. a) In contrast to prokaryotic DNA, eukaryotic DNA contains many repetitive

More information

Bootcamp: Molecular Biology Techniques and Interpretation

Bootcamp: Molecular Biology Techniques and Interpretation Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing

More information

Chapter 5. Structural Genomics

Chapter 5. Structural Genomics Chapter 5. Structural Genomics Contents 5. Structural Genomics 5.1. DNA Sequencing Strategies 5.1.1. Map-based Strategies 5.1.2. Whole Genome Shotgun Sequencing 5.2. Genome Annotation 5.2.1. Using Bioinformatic

More information

Design. Construction. Characterization

Design. Construction. Characterization Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication

More information

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06

BSCI410-Liu/Spring 06 Exam #1 Feb. 23, 06 Your Name: Your UID# 1. (20 points) Match following mutations with corresponding mutagens (X-RAY, Ds transposon excision, UV, EMS, Proflavin) a) Thymidine dimmers b) Breakage of DNA backbone c) Frameshift

More information

Molecular Genetics Techniques. BIT 220 Chapter 20

Molecular Genetics Techniques. BIT 220 Chapter 20 Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant

More information

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou

Abcam.com. hutton.ac.uk. Ipmdss.dk. Bo Gong and Eva Chou Abcam.com Bo Gong and Eva Chou Ipmdss.dk hutton.ac.uk What is a homeotic gene? A gene which regulates the developmental fate of anatomical structures in an organism Why study them? Understand the underlying

More information

PLNT2530 (2018) Unit 6b Sequence Libraries

PLNT2530 (2018) Unit 6b Sequence Libraries PLNT2530 (2018) Unit 6b Sequence Libraries Molecular Biotechnology (Ch 4) Analysis of Genes and Genomes (Ch 5) Unless otherwise cited or referenced, all content of this presenataion is licensed under the

More information

d. reading a DNA strand and making a complementary messenger RNA

d. reading a DNA strand and making a complementary messenger RNA Biol/ MBios 301 (General Genetics) Spring 2003 Second Midterm Examination A (100 points possible) Key April 1, 2003 10 Multiple Choice Questions-4 pts. each (Choose the best answer) 1. Transcription involves:

More information

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping

BENG 183 Trey Ideker. Genome Assembly and Physical Mapping BENG 183 Trey Ideker Genome Assembly and Physical Mapping Reasons for sequencing Complete genome sequencing!!! Resequencing (Confirmatory) E.g., short regions containing single nucleotide polymorphisms

More information

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G

Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Annotation Practice Activity [Based on materials from the GEP Summer 2010 Workshop] Special thanks to Chris Shaffer for document review Parts A-G Introduction: A genome is the total genetic content of

More information

BIO 304 Fall 2000 Exam II Name: ID #: 1. Fill in the blank with the best answer from the provided word bank. (2 pts each)

BIO 304 Fall 2000 Exam II Name: ID #: 1. Fill in the blank with the best answer from the provided word bank. (2 pts each) 1. Fill in the blank with the best answer from the provided word bank. (2 pts each) incomplete dominance conditional mutation penetrance expressivity pleiotropy Southern blotting hybridization epistasis

More information

Supplemental Information. Autoregulatory Feedback Controls. Sequential Action of cis-regulatory Modules. at the brinker Locus

Supplemental Information. Autoregulatory Feedback Controls. Sequential Action of cis-regulatory Modules. at the brinker Locus Developmental Cell, Volume 26 Supplemental Information Autoregulatory Feedback Controls Sequential Action of cis-regulatory Modules at the brinker Locus Leslie Dunipace, Abbie Saunders, Hilary L. Ashe,

More information

Chapter 10 (Part II) Gene Isolation and Manipulation

Chapter 10 (Part II) Gene Isolation and Manipulation Biology 234 J. G. Doheny Chapter 10 (Part II) Gene Isolation and Manipulation Practice Questions: Answer the following questions with one or two sentences. 1. What does PCR stand for? 2. What does the

More information

Computational Biology I LSM5191

Computational Biology I LSM5191 Computational Biology I LSM5191 Lecture 5 Notes: Genetic manipulation & Molecular Biology techniques Broad Overview of: Enzymatic tools in Molecular Biology Gel electrophoresis Restriction mapping DNA

More information

Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009

Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 1 Draft 3 Annotation of DGA06H06, Contig 1 Jeannette Wong Bio4342W 27 April 2009 Page 2 Introduction: Annotation is the process of analyzing the genomic sequence of an organism. Besides identifying

More information

Fatchiyah

Fatchiyah Fatchiyah Email: fatchiya@yahoo.co.id RNAs: mrna trna rrna RNAi DNAs: Protein: genome DNA cdna mikro-makro mono-poly single-multi Analysis: Identification human and animal disease Finger printing Sexing

More information

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.

BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY. !! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which

More information

Genome Analysis. Bacterial genome projects

Genome Analysis. Bacterial genome projects Genome Analysis Bacterial Genome sequencing does this help us in the investigation of adaptive responses/regulatory systems? Genome Sequencing Projects strategy & methods annotation Comparative genomics

More information

Recombinant DNA Libraries and Forensics

Recombinant DNA Libraries and Forensics MIT Department of Biology 7.014 Introductory Biology, Spring 2005 A. Library construction Recombinant DNA Libraries and Forensics Recitation Section 18 Answer Key April 13-14, 2005 Recall that earlier

More information

Motivation From Protein to Gene

Motivation From Protein to Gene MOLECULAR BIOLOGY 2003-4 Topic B Recombinant DNA -principles and tools Construct a library - what for, how Major techniques +principles Bioinformatics - in brief Chapter 7 (MCB) 1 Motivation From Protein

More information

2054, Chap. 14, page 1

2054, Chap. 14, page 1 2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification

More information

Learning Objectives. 2. Restriction Endonucleases 3. Cloning 4. Genetic Engineering 5. DNA libraries 6. PCR 7. DNA Fingerprinting

Learning Objectives. 2. Restriction Endonucleases 3. Cloning 4. Genetic Engineering 5. DNA libraries 6. PCR 7. DNA Fingerprinting Fig. 13-CO, p.330 Learning Objectives 1. Purification & detection of nucleic acids. 2. Restriction Endonucleases 3. Cloning 4. Genetic Engineering 5. DNA libraries 6. PCR 7. DNA Fingerprinting Gel Electrophoresis

More information

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering

Chapter 8: Recombinant DNA. Ways this technology touches us. Overview. Genetic Engineering Chapter 8 Recombinant DNA and Genetic Engineering Genetic manipulation Ways this technology touches us Criminal justice The Justice Project, started by law students to advocate for DNA testing of Death

More information

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants

AP Biology. Chapter 20. Biotechnology: DNA Technology & Genomics. Biotechnology. The BIG Questions. Evolution & breeding of food plants What do you notice about these phrases? radar racecar Madam I m Adam Able was I ere I saw Elba a man, a plan, a canal, Panama Was it a bar or a bat I saw? Chapter 20. Biotechnology: DNA Technology & enomics

More information

Genetic Transformation of Drosophila with Transposable Element Vectors SCIENCE, VOL. 218, 22 OCTOBER 1982

Genetic Transformation of Drosophila with Transposable Element Vectors SCIENCE, VOL. 218, 22 OCTOBER 1982 Genetic Transformation of Drosophila with Transposable Element Vectors SCIENCE, VOL. 218, 22 OCTOBER 1982 Transposition of Cloned P Elements into Drosophila Germ Line Chromosomes SCIENCE, VOL. 218, 22

More information

Results WCP (Whole chromosome paint) FISH

Results WCP (Whole chromosome paint) FISH Results 61 3 Results The proband as well as her mother and grand mother with an inversion chromosome 3 and short stature were studied in this project to characterize the breakpoints. Cytogenetic analysis

More information

Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome

Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Finishing Fosmid DMAC-27a of the Drosophila mojavensis third chromosome Ruth Howe Bio 434W 27 February 2010 Abstract The fourth or dot chromosome of Drosophila species is composed primarily of highly condensed,

More information

7 Gene Isolation and Analysis of Multiple

7 Gene Isolation and Analysis of Multiple Genetic Techniques for Biological Research Corinne A. Michels Copyright q 2002 John Wiley & Sons, Ltd ISBNs: 0-471-89921-6 (Hardback); 0-470-84662-3 (Electronic) 7 Gene Isolation and Analysis of Multiple

More information

Learning Objectives :

Learning Objectives : Learning Objectives : Understand the basic differences between genomic and cdna libraries Understand how genomic libraries are constructed Understand the purpose for having overlapping DNA fragments in

More information

A Guide to Consed Michelle Itano, Carolyn Cain, Tien Chusak, Justin Richner, and SCR Elgin.

A Guide to Consed Michelle Itano, Carolyn Cain, Tien Chusak, Justin Richner, and SCR Elgin. 1 A Guide to Consed Michelle Itano, Carolyn Cain, Tien Chusak, Justin Richner, and SCR Elgin. Main Window Figure 1. The Main Window is the starting point when Consed is opened. From here, you can access

More information

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for

Biotechnology. Chapter 20. Biology Eighth Edition Neil Campbell and Jane Reece. PowerPoint Lecture Presentations for Chapter 20 Biotechnology PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions from Joan Sharp Copyright

More information

7.02/ RECOMBINANT DNA METHODS EXAM KEY

7.02/ RECOMBINANT DNA METHODS EXAM KEY MIT Department of Biology 7.02 Experimental Biology & Communication, Spring 2005 7.02/10.702 RECOMBINANT DNA METHODS EXAM KEY Regrade requests are due to the instructor in the 7.02 teaching lab by the

More information

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host).

STANDARD CLONING PROCEDURES. Shotgun cloning (using a plasmid vector and E coli as a host). STANDARD CLONING PROCEDURES Shotgun cloning (using a plasmid vector and E coli as a host). 1) Digest donor DNA and plasmid DNA with the same restriction endonuclease 2) Mix the fragments together and treat

More information

AP Biology

AP Biology Advanced Techniques Electrophoresis & RFLPs Gel Electrophoresis Separation of DNA fragments by size DNA is negatively charged moves toward + charge in electrical field agarose gel swimming through Jello

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 3 Molecular Techniques Separation and Detection, Part

More information

Chapter 20 DNA Technology & Genomics. If we can, should we?

Chapter 20 DNA Technology & Genomics. If we can, should we? Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant

More information

Introduction to some aspects of molecular genetics

Introduction to some aspects of molecular genetics Introduction to some aspects of molecular genetics Julius van der Werf (partly based on notes from Margaret Katz) University of New England, Armidale, Australia Genetic and Physical maps of the genome...

More information

Case It: integrating molecular biology computer simulations and bioinformatics into case-based learning and student research

Case It: integrating molecular biology computer simulations and bioinformatics into case-based learning and student research Case It: integrating molecular biology computer simulations and bioinformatics into case-based learning and student research Mark Bergland and Karen Klyczek University of Wisconsin-River Falls Introductory

More information

BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name:

BSCI410-Liu/Spring 09/Feb 26 Exam #1 Your name: 1. (20 points) Give the name of a mutagen that could cause the following damages to DNA: a) Thymidine dimers UV b) Breakage of DNA backbone X-Ray c) 2 bp insertion (frameshift mutation) proflavin, acridine

More information

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix

Cat # Box1 Box2. DH5a Competent E. coli cells CCK-20 (20 rxns) 40 µl 40 µl 50 µl x 20 tubes. Choo-Choo Cloning TM Enzyme Mix Molecular Cloning Laboratories User Manual Version 3.3 Product name: Choo-Choo Cloning Kits Cat #: CCK-10, CCK-20, CCK-096, CCK-384 Description: Choo-Choo Cloning is a highly efficient directional PCR

More information

Chimp Sequence Annotation: Region 2_3

Chimp Sequence Annotation: Region 2_3 Chimp Sequence Annotation: Region 2_3 Jeff Howenstein March 30, 2007 BIO434W Genomics 1 Introduction We received region 2_3 of the ChimpChunk sequence, and the first step we performed was to run RepeatMasker

More information

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects.

Course summary. Today. PCR Polymerase chain reaction. Obtaining molecular data. Sequencing. DNA sequencing. Genome Projects. Goals Organization Labs Project Reading Course summary DNA sequencing. Genome Projects. Today New DNA sequencing technologies. Obtaining molecular data PCR Typically used in empirical molecular evolution

More information

GENOME 371, Problem Set 6

GENOME 371, Problem Set 6 GENOME 371, Problem Set 6 1. S. pombe is a distant relative of baker s yeast (which you used in quiz section). Wild type S. pombe can grow on plates lacking tryptophan (-trp plates). A mutant has been

More information

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs

Schematic representation of the endogenous PALB2 locus and gene-disruption constructs Supplementary Figures Supplementary Figure 1. Generation of PALB2 -/- and BRCA2 -/- /PALB2 -/- DT40 cells. (A) Schematic representation of the endogenous PALB2 locus and gene-disruption constructs carrying

More information

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques)

Recent technology allow production of microarrays composed of 70-mers (essentially a hybrid of the two techniques) Microarrays and Transcript Profiling Gene expression patterns are traditionally studied using Northern blots (DNA-RNA hybridization assays). This approach involves separation of total or polya + RNA on

More information

Biology 4100 Minor Assignment 1 January 19, 2007

Biology 4100 Minor Assignment 1 January 19, 2007 Biology 4100 Minor Assignment 1 January 19, 2007 This assignment is due in class on February 6, 2007. It is worth 7.5% of your final mark for this course. Your assignment must be typed double-spaced on

More information

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr.

MIT Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. MIT Department of Biology 7.01: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor Tyler Jacks, Dr. Claudette Gardel iv) Would Xba I be useful for cloning? Why or why not?

More information

A PCR-based Technology for Quickly Screening of gdna Library 1

A PCR-based Technology for Quickly Screening of gdna Library 1 A PCR-based Technology for Quickly Screening of gdna Library 1 Yongxiang Zhao a,b *, Jiahui Zhang a,c, Qi Tang b, Zhonggui Shan d, Qinming Fan d a Hainan Medical College, Haikou, Hainan 571101, P.R. China

More information

Prime-It II Random Primer Labeling Kit

Prime-It II Random Primer Labeling Kit Prime-It II Random Primer Labeling Kit Instruction Manual Catalog #300385 Revision C0 For Research Use Only. Not for use in diagnostic procedures. 300385-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

INNOVAPI WP3 Activity 3 Health Parameters

INNOVAPI WP3 Activity 3 Health Parameters Harmonization of methods for measuring viral load and bio-markers of aging Stage1 : Quality check of extracted RNA in Torino A qpcr on 18S gene showed that the extracted samples also contain genomic DNA.

More information

Biotechnolog y and DNA Technology

Biotechnolog y and DNA Technology PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,

More information

Finishing Drosophila Ananassae Fosmid 2728G16

Finishing Drosophila Ananassae Fosmid 2728G16 Finishing Drosophila Ananassae Fosmid 2728G16 Kyle Jung March 8, 2013 Bio434W Professor Elgin Page 1 Abstract For my finishing project, I chose to finish fosmid 2728G16. This fosmid carries a segment of

More information

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside

NAME TA SEC Problem Set 4 FRIDAY October 15, Answers to this problem set must be inserted into the box outside MIT Biology Department 7.012: Introductory Biology - Fall 2004 Instructors: Professor Eric Lander, Professor Robert A. Weinberg, Dr. Claudette Gardel NAME TA SEC 7.012 Problem Set 4 FRIDAY October 15,

More information

Basic lab techniques

Basic lab techniques Basic lab techniques Sandrine Dudoit Bioconductor short course Summer 2002 Copyright 2002, all rights reserved Lab techniques Basic lab techniques for nucleic acids Hybridization. Cut: restriction enzymes.

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

7.012 Problem Set 5. Question 1

7.012 Problem Set 5. Question 1 Name Section 7.012 Problem Set 5 Question 1 While studying the problem of infertility, you attempt to isolate a hypothetical rabbit gene that accounts for the prolific reproduction of rabbits. After much

More information

Problem Set 8. Answer Key

Problem Set 8. Answer Key MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no

More information

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves

3. Translation. 2. Transcription. 1. Replication. and functioning through their expression in. Genes are units perpetuating themselves Central Dogma Genes are units perpetuating themselves and functioning through their expression in the form of proteins 1 DNA RNA Protein 2 3 1. Replication 2. Transcription 3. Translation Spring 2002 21

More information

Bacillus thuringiensis

Bacillus thuringiensis Microbial Bioinsecticide Bacillus thuringiensis Aris Tri Wahyudi, PhD Department of Biology Bogor Agricultural University 2010 Microbial Insecticide A microbial bioinsecticide is an organism that either

More information

10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA

10X ligation buffer ligase 1 vector DNA insert DNA H 2 O. 10 µl Total Volume. 10X ligation buffer ligase 1 vector DNA insert DNA Biol/Chem 475 S07 Study problems for quiz 1 See also questions posed in lab handouts including ligase handout Answers to questions 1&2 included at the end of this document. 1. You plan to clone a 1.0 kb

More information

Finishing of Fosmid 1042D14. Project 1042D14 is a roughly 40 kb segment of Drosophila ananassae

Finishing of Fosmid 1042D14. Project 1042D14 is a roughly 40 kb segment of Drosophila ananassae Schefkind 1 Adam Schefkind Bio 434W 03/08/2014 Finishing of Fosmid 1042D14 Abstract Project 1042D14 is a roughly 40 kb segment of Drosophila ananassae genomic DNA. Through a comprehensive analysis of forward-

More information

XXII DNA cloning and sequencing. Outline

XXII DNA cloning and sequencing. Outline XXII DNA cloning and sequencing 1) Deriving DNA for cloning Outline 2) Vectors; forming recombinant DNA; cloning DNA; and screening for clones containing recombinant DNA [replica plating and autoradiography;

More information

SCREENING AND PRESERVATION OF DNA LIBRARIES

SCREENING AND PRESERVATION OF DNA LIBRARIES MODULE 4 LECTURE 5 SCREENING AND PRESERVATION OF DNA LIBRARIES 4-5.1. Introduction Library screening is the process of identification of the clones carrying the gene of interest. Screening relies on a

More information

1. As discussed in class there are three functional elements required for eukaryotic chromosomes.

1. As discussed in class there are three functional elements required for eukaryotic chromosomes. 1. As discussed in class there are three functional elements required for eukaryotic chromosomes. a. What are these three elements? (3 pts) origins of replication, centromeres, telomeres b. These three

More information

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab

BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab BIO/CHEM 475 Molecular Biology Laboratory Spring 2007 Biol/Chem 475 Part 2 of Cloning Lab Week 5 Analysis of pgem recombinant clones using PCR Clonecheck to determine size of insert; select clones for

More information

Answer sheet. Student number:

Answer sheet. Student number: Page 1 of 9 MIDTERM EXAM OF BIO/BPS3151 2016 Answer sheet Name: Student number: Part II: Calculations 1 128g 2 58.5g 3 NaCl: 1L Water: 0.2L 4 2.5 g/l 5 0.4 6 1:4:2 7 900 ml 8 Plasmid A: 3.75 µl Plasmid

More information

SEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont

SEQUENCING DNA. Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Jos. J. Schall Biology Department University of Vermont SEQUENCING DNA Start with PCR product (your end result of a PCR). Remember, your template DNA in the PCR was extracted DNA that included

More information

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018

Outline. Annotation of Drosophila Primer. Gene structure nomenclature. Muller element nomenclature. GEP Drosophila annotation projects 01/04/2018 Outline Overview of the GEP annotation projects Annotation of Drosophila Primer January 2018 GEP annotation workflow Practice applying the GEP annotation strategy Wilson Leung and Chris Shaffer AAACAACAATCATAAATAGAGGAAGTTTTCGGAATATACGATAAGTGAAATATCGTTCT

More information

DESIGNER GENES - BIOTECHNOLOGY

DESIGNER GENES - BIOTECHNOLOGY DESIGNER GENES - BIOTECHNOLOGY Technology to manipulate DNA techniques often called genetic engineering or Recombinant DNA Technology-Technology used to manipulate DNA Procedures often called genetic engineering

More information