Cloning and Expression of Recombinant Proteins
|
|
|
- Philomena Sheryl Little
- 5 years ago
- Views:
Transcription
1 Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D Garching Germany 1 Created May 31, 2013, modified June 2014
2 Bacterial plasmids! 90,000 bp 99 coding 3 Natural plasmid are huge and contain a multitude of genes. E.g., the plasmid associated with the entero-hemolytic E. coli strain O157 is more than 90 kb (kilo-basepairs) long and contains genes for its on replication, transduction into an acceptor strain, pili, pathogeneity factors, and other.
3 Bacterial plasmids 2686 bp < 5 coding natural plasmid stripped to minimal elements 4 For biotechnological purposes, natural plasmids have been stripped down to their essentials.
4 Bacterial plasmids 2686 bp < 5 coding origin of replication 6 Polisky B (1988) ColE1 replication control circuitry: sense from antisense. Cell 55: Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication (in most cases oriv, derived from plasmid ColEI, which works by priming of DNA synthesis through RNA II (,primer ) and its counter-acting anti-sense RNA I, regulated by the 4-helix protein rop), Polisky B (1988) ColE1 replication control circuitry: sense from antisense. Cell 55: oriv/cole1:
5 Bacterial plasmids RNAP rop Protein (Repressor of Primer) unknown mechanism Initial Interaction of RNA I with Primer Nascent Primer = RNA II 2686 bp < 5 coding Origin origin of replication anti-sense RNA I Conformation RNA-DNA Hybridization RNase H Cleavage at Origin Nascent Primer RNA I end of RNA I Nucleates DNA-RNA Duplex Formation Formation of!-" Domain Readthrough Transcription without Hybrid Formation Initiation of Leading Strand Release of Transcript 9 Polisky B (1988) ColE1 replication control circuitry: sense from antisense. Cell 55: Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication (in most cases oriv, derived from plasmid ColEI, which works by priming of DNA synthesis through RNA II (,primer ) and its counter-acting anti-sense RNA I, regulated by the 4-helix protein rop), Polisky B (1988) ColE1 replication control circuitry: sense from antisense. Cell 55: oriv/cole1:
6 Bacterial plasmids β-lactamase (confering ampr) 2686 bp < 5 coding 11 "-Lactam- Antibiotika E. coli Staphylococcus aureus Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), See also:
7 Bacterial plasmids 2686 bp < 5 coding multiple cloning site Restriction endonucleases: Part of a defense system against foreign (viral) DNA, works in combination with methyltransferase enzymes 13 E. coli Dam system E. coli Dcm system E. coli EcoRII or EcoK1990 restriction endonuclease...gatc... + S-Adenosylmethionine -N6methyl...GATC... -C5methyl...CCAGG... + S-Adenosylmethionine...CCWGG... W = A or T...CCAGG GGTCC...-5 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes briefly polycloning ) site, relying on the action of restriction endonucleases. Restriction endonucleases are part of a defense mechanism of bacteria against viral invaders, called restirction-modification system. dsdna is cleaved at specific sequence patterns, unless they are marked as own by sequence-specific methyl-transferases. Data from NEB (
8 Bacterial plasmids multiple cloning site 14...GATC... Staphylococcus aureus Methyltransferase S. aureus Sau3AI restriction endonuclease + S-Adenosylmethionine Restriction endonucleases: Part of a defense system against foreign (viral) DNA, works in combination with methyltransferase enzymes -5methyl...GATC......GATC CTAG...-5 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes briefly polycloning ) site, relying on the action of restriction endonucleases. Restriction endonucleases are part of a defense mechanism of bacteria against viral invaders, called restirction-modification system. dsdna is cleaved at specific sequence patterns, unless they are marked as own by sequence-specific methyl-transferases. Data from NEB ( Roberts RJ, Belfort M, Bestor T, Bhagwat AS, Bickle TA, et al. (2003) A nomenclature for restriction enzymes, DNA methyltransferases, homing endonucleases and their genes. Nucleic Acids Res 31:
9 SacI BamHI Bacterial plasmids My Coding Sequence of Interest GAGCTC GGATCC GGATCC GAGCTC (polycistronic) RNA 15 The foreign DNA (encoding the gene of my interest) can be integrated into the vector plasmid using restriction endonucleolytic cuts in both vector and foreing () DNA.
10 SacI BamHI Bacterial plasmids My Coding Sequence of Interest C G GATCC GAGCT polycistronic RNA 16 The foreign DNA (encoding the gene of my interest) can be integrated into the vector plasmid using restriction endonucleolytic cuts in both vector and foreing () DNA. The use of restriction enzymes that produce overhangs allows,directional cloning.
11 SacI BamHI Bacterial plasmids My Coding Sequence of Interest C G GATCC GAGCT polycistronic RNA Phosphate Base Ribose G AGCT C G AGCT C 17 The foreign DNA (encoding the gene of my interest) can be integrated into the vector plasmid using restriction endonucleolytic cuts in both vector and foreing () DNA. The use of restriction enzymes that produce overhangs allows,directional cloning.
12 SacI BamHI Bacterial plasmids My Coding Sequence of Interest C G GATCC GAGCT polycistronic RNA Base Ribose G AGCT C G AGCT C 18 The foreign DNA (encoding the gene of my interest) can be integrated into the vector plasmid using restriction endonucleolytic cuts in both vector and foreing () DNA. The use of restriction enzymes that produce overhangs allows,directional cloning.
13 Bacterial plasmids 2686 bp < 5 coding marker (optional) promoter multiple cloning site Expression Vectors -35:...TTGACA... promoter 19 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
14 Bacterial plasmids 2686 bp < 5 coding marker (optional) promoter multiple cloning site Expression Vectors 5ʻ-...AGGAGG...-3ʻ Shine-Dalgarno Sequenz 5ʻ-...UUCACAC AGGAAACAGCU AUG...-3ʻ 3ʻ-...AU UCCUCCACUAG...-5ʻ mrna 16S rrna promoter 20 (Achtung, Notation 3 ->5!) Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
15 terminator Bacterial plasmids 2686 bp < 5 coding marker (optional) promoter multiple cloning site Expression Vectors terminator promoter 21 Terminator sequence on DNA (example: trp operon) Terminator sequence: mrna hairpin...cccagcccgcctaatgagcgggctttttttt GGGTCGGGCGGATTACTCGCCCGAAAAAAAA CCCAGCCCGCC U A 3 -UUUUCGGGCGAG U A Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
16 marker (optional) Bacterial plasmids promoter 2686 bp < 5 coding lacz α- Peptide DNA laci P O lacz lacy laca β-galactosidase 22 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
17 marker (optional) Bacterial plasmids promoter 2686 bp < 5 coding lacz α- Peptide DNA laci P O lacz lacy laca β-galactosidase blue 23 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
18 marker (optional) Bacterial plasmids promoter 2686 bp < 5 coding lacz α- Peptide blue/white screening DNA laci P O lacz lacy laca β-galactosidase (without N-terminal α-peptide) + α-peptide blue 25 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
19 marker (optional) Bacterial plasmids promoter 2686 bp < 5 coding lacz α- Peptide blue/white screening DNA laci P O lacz lacy laca β-galactosidase (without N-terminal α-peptide) + α-peptide colorless 25 Plasmids used in biotech have been stripped down to their essentials. The minimal requirement comprises: the origin of replication, an antibiotics resistance gene (here: the ampicillin resistance, based on a protein called beta-lactamase), a multiple cloning (sometimes also called polycloning ) site, and (optional) selection markers that help identifying correct clones.
20 Bacterial plasmids Plasmids (symbolic, see right) bp size multiple, 1-200/cell) Chromosome ~ bp size (symbolic;1/cell) 26
21 Bacterial plasmids Plasmids (symbolic, see right) bp size multiple, 1-200/cell) Chromosome ~ bp size (symbolic;1/cell) Membrane Lipids Proteins Carbohydrates 27
22 Bacterial plasmids Plasmids (symbolic, see right) bp size multiple, 1-200/cell) Membrane Lipids SDS sodium docecyl sulfate Chromosome ~ bp size (symbolic;1/cell) Proteins SDS NaOH, ph!10 Carbohydrates 27
23 Plasmids Bacterial plasmids SD S NaOH, ph!10 plasmid isolation or preparation Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7: insoluble aggregate
24 Plasmids Bacterial plasmids transformation Ca 2+, Mn 2+,... heat shock 42 C,electroporation Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7:
Reading Lecture 3: 24-25, 45, Lecture 4: 66-71, Lecture 3. Vectors. Definition Properties Types. Transformation
Lecture 3 Reading Lecture 3: 24-25, 45, 55-66 Lecture 4: 66-71, 75-79 Vectors Definition Properties Types Transformation 56 VECTORS- Definition Vectors are carriers of a DNA fragment of interest Insert
Chapter 4. Recombinant DNA Technology
Chapter 4 Recombinant DNA Technology 5. Plasmid Cloning Vectors Plasmid Plasmids Self replicating Double-stranded Mostly circular DNA ( 500 kb) Linear : Streptomyces, Borrelia burgdorferi Replicon
DNA Cloning with Cloning Vectors
Cloning Vectors A M I R A A. T. A L - H O S A R Y L E C T U R E R O F I N F E C T I O U S D I S E A S E S F A C U L T Y O F V E T. M E D I C I N E A S S I U T U N I V E R S I T Y - E G Y P T DNA Cloning
Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner.
Enzymes Restriction Enzymes (Site-Specific Endonuclease) Enzymes that recognize and cleave dsdna in a highly sequence specific manner. Generally recognize an inverted repeat sequence 4, 6, or 8 base pairs
Chapter 13: Biotechnology
Chapter Review 1. Explain why the brewing of beer is considered to be biotechnology. The United Nations defines biotechnology as any technological application that uses biological system, living organism,
BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY
Biology Multiple Choice 016074 BIOLOGY LTF DIAGNOSTIC TEST DNA to PROTEIN & BIOTECHNOLOGY Test Code: 016074 Directions: Each of the questions or incomplete statements below is followed by five suggested
BIOLOGY - CLUTCH CH.20 - BIOTECHNOLOGY.
!! www.clutchprep.com CONCEPT: DNA CLONING DNA cloning is a technique that inserts a foreign gene into a living host to replicate the gene and produce gene products. Transformation the process by which
Design. Construction. Characterization
Design Construction Characterization DNA mrna (messenger) A C C transcription translation C A C protein His A T G C T A C G Plasmids replicon copy number incompatibility selection marker origin of replication
Lac Operon contains three structural genes and is controlled by the lac repressor: (1) LacY protein transports lactose into the cell.
Regulation of gene expression a. Expression of most genes can be turned off and on, usually by controlling the initiation of transcription. b. Lactose degradation in E. coli (Negative Control) Lac Operon
Chapter 20 DNA Technology & Genomics. If we can, should we?
Chapter 20 DNA Technology & Genomics If we can, should we? Biotechnology Genetic manipulation of organisms or their components to make useful products Humans have been doing this for 1,000s of years plant
CHAPTER 20 DNA TECHNOLOGY AND GENOMICS. Section A: DNA Cloning
Section A: DNA Cloning 1. DNA technology makes it possible to clone genes for basic research and commercial applications: an overview 2. Restriction enzymes are used to make recombinant DNA 3. Genes can
Recitation CHAPTER 9 DNA Technologies
Recitation CHAPTER 9 DNA Technologies DNA Cloning: General Scheme A cloning vector and eukaryotic chromosomes are separately cleaved with the same restriction endonuclease. (A single chromosome is shown
Chapter 9. Biotechnology and DNA Technology
Chapter 9 Biotechnology and DNA Technology SLOs Compare and contrast biotechnology, recombinant DNA technology, and genetic engineering. Identify the roles of a clone and a vector in making recombined
Molecular Genetics Techniques. BIT 220 Chapter 20
Molecular Genetics Techniques BIT 220 Chapter 20 What is Cloning? Recombinant DNA technologies 1. Producing Recombinant DNA molecule Incorporate gene of interest into plasmid (cloning vector) 2. Recombinant
Molecular Cell Biology - Problem Drill 11: Recombinant DNA
Molecular Cell Biology - Problem Drill 11: Recombinant DNA Question No. 1 of 10 1. Which of the following statements about the sources of DNA used for molecular cloning is correct? Question #1 (A) cdna
7.1 Techniques for Producing and Analyzing DNA. SBI4U Ms. Ho-Lau
7.1 Techniques for Producing and Analyzing DNA SBI4U Ms. Ho-Lau What is Biotechnology? From Merriam-Webster: the manipulation of living organisms or their components to produce useful usually commercial
Genetics Lecture 21 Recombinant DNA
Genetics Lecture 21 Recombinant DNA Recombinant DNA In 1971, a paper published by Kathleen Danna and Daniel Nathans marked the beginning of the recombinant DNA era. The paper described the isolation of
Module Code: BIO00007C
Examination Candidate Number: Desk Number: BSc and MSc Degree Examinations 2018-9 Department : BIOLOGY Title of Exam: Genetics Time Allowed: 1 Hour 30 Minutes Marking Scheme: Total marks available for
Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for :
Transformation Insertion of DNA of interest Amplification Amplified segment of DNA can be purified from bacteria in sufficient quantity and quality for : DNA Sequence. Understand relatedness of genes and
BIO440 Genetics Laboratory Transformation
BIO440 Genetics Laboratory Transformation The transfer of genetic information between bacteria has been occurring for billions of years. Humans first noticed this process in the laboratory in the 1920
Problem Set 8. Answer Key
MCB 102 University of California, Berkeley August 11, 2009 Isabelle Philipp Online Document Problem Set 8 Answer Key 1. The Genetic Code (a) Are all amino acids encoded by the same number of codons? no
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut
Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University-Egypt Restriction Endonucleases, (cutting dna) (ligation)
Big Idea 3C Basic Review
Big Idea 3C Basic Review 1. A gene is a. A sequence of DNA that codes for a protein. b. A sequence of amino acids that codes for a protein. c. A sequence of codons that code for nucleic acids. d. The end
BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt
BS1940 Course Topics Fall 2001 Drs. Hatfull and Arndt Introduction to molecular biology Combining genetics, biochemistry, structural chemistry Information flow in biological systems: The Central Dogma
Biotechnology and DNA Technology
11/27/2017 PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College CHAPTER 9 Biotechnology and DNA Technology Introduction to Biotechnology Learning Objectives Compare
Multiple choice questions (numbers in brackets indicate the number of correct answers)
1 Multiple choice questions (numbers in brackets indicate the number of correct answers) February 1, 2013 1. Ribose is found in Nucleic acids Proteins Lipids RNA DNA (2) 2. Most RNA in cells is transfer
Molecular Cloning. Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library:
Molecular Cloning Genomic DNA Library: Contains DNA fragments that represent an entire genome. cdna Library: Made from mrna, and represents only protein-coding genes expressed by a cell at a given time.
Genetic Engineering & Recombinant DNA
Genetic Engineering & Recombinant DNA Chapter 10 Copyright The McGraw-Hill Companies, Inc) Permission required for reproduction or display. Applications of Genetic Engineering Basic science vs. Applied
Figure A summary of spontaneous alterations likely to require DNA repair.
DNA Damage Figure 5-46. A summary of spontaneous alterations likely to require DNA repair. The sites on each nucleotide that are known to be modified by spontaneous oxidative damage (red arrows), hydrolytic
AP Biology Gene Expression/Biotechnology REVIEW
AP Biology Gene Expression/Biotechnology REVIEW Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Gene expression can be a. regulated before transcription.
F (fertility) plasmid Fig Gene movement, part III and restriction-modification. Plasmid transfer via F conjugation
Microm 410 2009: Gene Movement-Conjugation F (fertility) plasmid Fig 11.19 Gene movement, part III and restriction-modification Plasmid transfer via F conjugation Conjugative ability due to transfer (tra
4. Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily:
CHEM 4420 Exam I Spring 2012 Page 1 of 5 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
Nucleic Acid Structure:
Nucleic Acid Structure: Purine and Pyrimidine nucleotides can be combined to form nucleic acids: 1. Deoxyribonucliec acid (DNA) is composed of deoxyribonucleosides of! Adenine! Guanine! Cytosine! Thymine
Ch 8. Microbial Genetics
Ch 8 Microbial Genetics SLOs Define the terms genome and gene, and differentiate between genotype and phenotype. Draw a detailed segment of DNA. Summarize the steps of bacterial DNA replication, and identify
The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity
Promega Notes Magazine Number 62, 1997, p. 02 The GeneEditor TM in vitro Mutagenesis System: Site- Directed Mutagenesis Using Altered Beta-Lactamase Specificity By Christine Andrews and Scott Lesley Promega
B. Incorrect! Ligation is also a necessary step for cloning.
Genetics - Problem Drill 15: The Techniques in Molecular Genetics No. 1 of 10 1. Which of the following is not part of the normal process of cloning recombinant DNA in bacteria? (A) Restriction endonuclease
Lecture 22: Molecular techniques DNA cloning and DNA libraries
Lecture 22: Molecular techniques DNA cloning and DNA libraries DNA cloning: general strategy -> to prepare large quantities of identical DNA Vector + DNA fragment Recombinant DNA (any piece of DNA derived
GENE REGULATION IN PROKARYOTES
GENE REGULATION IN PROKARYOTES Prepared by Brenda Leady, University of Toledo Copyright (c) The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 1 Gene regulation refers to
Page 70 Monday December 8, 2014
replication and Monday December 8, 0 Notebook check 8: Page 69, DNA Technology Introduction Worksheet. The process by which a foreign gene is replicated by insertion into a bacterium is called genetic
Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4)
TSSM 2017 Page 1 of 7 Biology Teach Yourself Series Topic 12: Molecular Biology (Unit 4) A: Level 14, 474 Flinders Street Melbourne VIC 3000 T: 1300 134 518 W: tssm.com.au E: info@tssm.com.au TSSM 2017
Chapter 9 Genetic Engineering
Chapter 9 Genetic Engineering Biotechnology: use of microbes to make a protein product Recombinant DNA Technology: Insertion or modification of genes to produce desired proteins Genetic engineering: manipulation
The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally.
Name Microbial Genetics, BIO 410/510 2008 Exam II The plasmid shown to the right has an oriv and orit at the positions indicated, and is known to replicate bidirectionally. 1.) Indicate where replication
Figure 1. Map of cloning vector pgem T-Easy (bacterial plasmid DNA)
Texas A&M University-Corpus Christi CHEM4402 Biochemistry II Laboratory Laboratory 6: Ligation & Bacterial Transformation (Bring your text and laptop to class if you wish to work on your assignment during
Lecture 25 (11/15/17)
Lecture 25 (11/15/17) Reading: Ch9; 328-332 Ch25; 990-995, 1005-1012 Problems: Ch9 (study-guide: applying); 1,2 Ch9 (study-guide: facts); 7,8 Ch25 (text); 1-3,5-7,9,10,13-15 Ch25 (study-guide: applying);
The Lactose Intolerance of Bacteria
Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene 5 Blue-White Screening 6 References The Lactose Intolerance of Bacteria The standard growth
CHEM 4420 Exam I Spring 2013 Page 1 of 6
CHEM 4420 Exam I Spring 2013 Page 1 of 6 Name Use complete sentences when requested. There are 100 possible points on this exam. The multiple choice questions are worth 2 points each. All other questions
Recombinant DNA Technology
Recombinant DNA Technology Common General Cloning Strategy Target DNA from donor organism extracted, cut with restriction endonuclease and ligated into a cloning vector cut with compatible restriction
Module 3. Lecture 5. Regulation of Gene Expression in Prokaryotes
Module 3 Lecture 5 Regulation of Gene Expression in Prokaryotes Recap So far, we have looked at prokaryotic gene regulation using 3 operon models. lac: a catabolic operon which displays induction via negative
Technical tips Session 4
Technical tips Session 4 Biotinylation assay: Streptavidin is a small bacterial protein that binds with high affinity to the vitamin biotin. This streptavidin-biotin combination can be used to link molecules
Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression
Vol. 1:7-15 Antisense RNA Insert Design for Plasmid Construction to Knockdown Target Gene Expression Ji, Tom, Lu, Aneka, Wu, Kaylee Department of Microbiology and Immunology, University of British Columbia
Lecture Four. Molecular Approaches I: Nucleic Acids
Lecture Four. Molecular Approaches I: Nucleic Acids I. Recombinant DNA and Gene Cloning Recombinant DNA is DNA that has been created artificially. DNA from two or more sources is incorporated into a single
Name Per AP: CHAPTER 27: PROKARYOTES (Bacteria) p559,
AP: CHAPTER 27: PROKARYOTES (Bacteria) p559, 561-564 1. How does the bacterial chromosome compare to a eukaryotic chromosome? 2. What is a plasmid? 3. How fast can bacteria reproduce? 4. What is a bacterial
The study of the structure, function, and interaction of cellular proteins is called. A) bioinformatics B) haplotypics C) genomics D) proteomics
Human Biology, 12e (Mader / Windelspecht) Chapter 21 DNA Which of the following is not a component of a DNA molecule? A) a nitrogen-containing base B) deoxyribose sugar C) phosphate D) phospholipid Messenger
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7)
Independent Study Guide The Blueprint of Life, from DNA to Protein (Chapter 7) I. General Principles (Chapter 7 introduction) a. Morse code distinct series of dots and dashes encode the 26 letters of the
Lesson 1 Introduction to Genetic Engineering
Lesson 1 Introduction to Genetic Engineering Genetic engineering is the manipulation of an organism s genetic material (DNA) by introducing or eliminating specific genes A gene is a piece of DNA which
MCB 102 University of California, Berkeley August 11 13, Problem Set 8
MCB 102 University of California, Berkeley August 11 13, 2009 Isabelle Philipp Handout Problem Set 8 The answer key will be posted by Tuesday August 11. Try to solve the problem sets always first without
Biotechnolog y and DNA Technology
PowerPoint Lecture Presentations prepared by Bradley W. Christian, McLennan Community College C H A P T E R 9 Biotechnolog y and DNA Technology Introduction to Biotechnology Biotechnology: the use of microorganisms,
BIOLOGY 101. CHAPTER 18: Gene Expression: Turning genes on and off
BIOLOGY 101 CHAPTER 18: Gene Expression: Turning genes on and off BACTERIAL TRANSFORMATION: Bacteria have the ability to pick up DNA from their surroundings and transcribe it as if it was their own. When
Bacteria Reproduce Asexually via BINARY FISSION
An Introduction to Microbial Genetics Today: Intro to Microbial Genetics Lunch pglo! Bacteria Reproduce Asexually via BINARY FISSION But, Bacteria still undergo GENETIC RECOMBINATION (combining DNA from
Chapter 5. Objectives: Exploration of gene Recombinant DNA technology Genome sequencing Manipulation of Eukaryotic genes
Chapter 5 Objectives: Exploration of gene Recombinant DNA technology Genome sequencing Manipulation of Eukaryotic genes Restriction enzymes - cleave DNA et specific sequence - found in prokaryotes, cleave
Exam 2 Key - Spring 2008 A#: Please see us if you have any questions!
Page 1 of 5 Exam 2 Key - Spring 2008 A#: Please see us if you have any questions! 1. A mutation in which parts of two nonhomologous chromosomes change places is called a(n) A. translocation. B. transition.
Prokaryotic Transcription
Prokaryotic Transcription Contents 1 The Lactose Intolerance of Bacteria 2 The Lac Operon 3 Lac Operon Simulation 4 LacZ as a reporter gene The Lactose Intolerance of Bacteria The standard growth kinetics
Transcription in Prokaryotes. Jörg Bungert, PhD Phone:
Transcription in Prokaryotes Jörg Bungert, PhD Phone: 352-273-8098 Email: jbungert@ufl.edu Objectives Understand the basic mechanism of transcription. Know the function of promoter elements and associating
CHAPTER 9 DNA Technologies
CHAPTER 9 DNA Technologies Recombinant DNA Artificially created DNA that combines sequences that do not occur together in the nature Basis of much of the modern molecular biology Molecular cloning of genes
Rawan Almujaibel Anas Abu-Humaidan
8 Rawan Almujaibel...... Anas Abu-Humaidan In the previous lecture the Dr. talked about DNA structure and their 4 types of nitrogen bases. Then he talked about bacterial DNA (chromosomes) and their replication
Basics of Recombinant DNA Technology Biochemistry 302. March 5, 2004 Bob Kelm
Basics of Recombinant DNA Technology Biochemistry 302 March 5, 2004 Bob Kelm Applications of recombinant DNA technology Mapping and identifying genes (DNA cloning) Propagating genes (DNA subcloning) Modifying
chapter eight: microbial genetics
chapter eight: microbial genetics Revised 9/15/2016 the hereditary material Griffith 1927 & Avery, et al. 1944 the transforming principle coined by Griffith, identified by Avery the hereditary material
DNA. Griffith s Transforming Principle Experiment 11/30/2006 DNA 2
DNA Griffith s Transforming Principle Experiment 11/30/2006 DNA 2 1 Avery, McCarty, & MacLeod 1944 Extended Griffith s work 16 years later Search for the transforming factor Live rough cells + Protein
Bootcamp: Molecular Biology Techniques and Interpretation
Bootcamp: Molecular Biology Techniques and Interpretation Bi8 Winter 2016 Today s outline Detecting and quantifying nucleic acids and proteins: Basic nucleic acid properties Hybridization PCR and Designing
Chapter Fundamental Molecular Genetic Mechanisms
Chapter 5-1 - Fundamental Molecular Genetic Mechanisms 5.1 Structure of Nucleic Acids 5.2 Transcription of Protein-Coding Genes and Formation of Functional mrna 5.3 The Decoding of mrna by trnas 5.4 Stepwise
2054, Chap. 14, page 1
2054, Chap. 14, page 1 I. Recombinant DNA technology (Chapter 14) A. recombinant DNA technology = collection of methods used to perform genetic engineering 1. genetic engineering = deliberate modification
Experimental genetics - I
Experimental genetics - I Examples of diseases with genetic-links Hemophilia (complete loss or altered form of factor VIII): bleeding disorder Duchenne muscular dystrophy (altered form of dystrophin) muscle
Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST
Bring a Molecular Cell Biology Laboratory into the Classroom of HKUST Prof. Kathy Q. Luo and Prof. Donald C. Chang Dept. of Chemical Engineering, Bioengineering Graduate Program and Dept. of Biology HK
Chapter 11. Transcription. The biochemistry and molecular biology department of CMU
Chapter 11 Transcription The biochemistry and molecular biology department of CMU Transcription The synthesis of RNA molecules using DNA strands as the templates so that the genetic information can be
GENETICS EXAM 3 FALL a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size.
Student Name: All questions are worth 5 pts. each. GENETICS EXAM 3 FALL 2004 1. a) is a technique that allows you to separate nucleic acids (DNA or RNA) by size. b) Name one of the materials (of the two
DESIGNER GENES SAMPLE TOURNAMENT
DESIGNER GENES SAMPLE TOURNAMENT PART ONE- GENETICS PROBLEMS In dogs, the inheritance of hair color involves a gene (B) for black hair and a gene (b) for brown hair. A dominant (C) is also involved. It
March 15, Genetics_of_Viruses_and_Bacteria_p5.notebook. smallest viruses are smaller than ribosomes. A virulent phage (Lytic)
Genetics_of_Viruses_and_Bacteria_p5.notebook smallest viruses are smaller than ribosomes Adenovirus Tobacco mosaic virus Bacteriophage Influenza virus envelope is derived from the host cell The capsids
Chapter 20 Biotechnology
Chapter 20 Biotechnology Manipulation of DNA In 2007, the first entire human genome had been sequenced. The ability to sequence an organisms genomes were made possible by advances in biotechnology, (the
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 1 The BIG Questions! How can we use our knowledge of DNA to: " diagnose disease or defect? " cure disease or defect? " change/improve organisms?!
Chapter 4. The Genomic Biologist s Toolkit
Chapter 4. The Genomic Biologist s Toolkit Contents 4. Genomic Biologists tool kit 4.1. Restriction Endonucleases making sticky ends 4.2. Cloning Vectors 4.2.1. Simple Cloning Vectors 4.2.2. Expression
Restriction Endonucleases, (Cutting DNA) (Ligation) Ligase & Phosphatase
Restriction Endonucleases, (Cutting DNA) (Ligation) Ligase & Phosphatase Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine
Molecular Biology (2)
Molecular Biology (2) Restriction endonucleases, RFLP, and gene cloning Mamoun Ahram, PhD Second semester, 2017-2018 Resources This lecture Cooper, pp 120-124 Endonucleases Enzymes that degrade DNA within
(A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D) Is part of the eukaryote chromosome
Microbiology - Problem Drill 07: Microbial Genetics and Biotechnology No. 1 of 10 1. A plasmid is? (A) Extrachromosomal DNA (B) RNA found in bacterial cells (C) Is part of the bacterial chromosome (D)
CONSTRUCTION OF GENOMIC LIBRARY
MODULE 4-LECTURE 4 CONSTRUCTION OF GENOMIC LIBRARY 4-4.1. Introduction A genomic library is an organism specific collection of DNA covering the entire genome of an organism. It contains all DNA sequences
Red Type Indicates Unique Site
3600 G0605 pscaavmcmvmcsbghpa Plasmid Features: Coordinates Feature 980-1084 AAV2 5 ITR 1144-1666 modified CMV 1667-1761 MCS 1762-1975 BgHpA 1987-2114 AAV2 3 ITR 3031-3891 B-lactamase (Ampicillin) Antibiotic
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA
RNA Expression of the information in a gene generally involves production of an RNA molecule transcribed from a DNA template. RNA differs from DNA that it has a hydroxyl group at the 2 position of the
Biol 3301 Genetics Exam #2A October 26, 2004
Biol 3301 Genetics Exam #2A October 26, 2004 This exam consists of 40 multiple choice questions worth 2.5 points each, for a total of 100 points. Good luck. Name SS# 1. Which of the following statements
Genes to Proteins. Nucleic Acid Structure
Genes to Proteins Pratt & Cornely Chapter 3 Nucleobase Nucleoside Nucleotide Nucleic acid Chromatin Chromosome Nucleic Acid Structure 1 Base Structure Purines and pyrimidines Aromatic Tautomers Nucleosides
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs
Chapter 8 DNA Recognition in Prokaryotes by Helix-Turn-Helix Motifs 1. Helix-turn-helix proteins 2. Zinc finger proteins 3. Leucine zipper proteins 4. Beta-scaffold factors 5. Others λ-repressor AND CRO
4/26/2015. Cut DNA either: Cut DNA either:
Ch.20 Enzymes that cut DNA at specific sequences (restriction sites) resulting in segments of DNA (restriction fragments) Typically 4-8 bp in length & often palindromic Isolated from bacteria (Hundreds
Microbial Genetics. Chapter 8
Microbial Genetics Chapter 8 Structure and Function of Genetic Material Genome A cell s genetic information Chromosome Structures containing DNA that physically carry hereditary information Gene Segments
7.1 The lac Operon 7-1
7.1 The lac Operon The lac operon was the first operon discovered It contains 3 genes coding for E. coli proteins that permit the bacteria to use the sugar lactose Galactoside permease (lacy) which transports
Molecular Biology: Gene cloning
Molecular Biology: Gene cloning Author: Prof Marinda Oosthuizen Licensed under a Creative Commons Attribution license. CLONING VECTORS The central component of a gene cloning experiment is the vector or
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? CHAPTER 2A STUDENT GUIDE 2013 Amgen Foundation. All rights reserved.
CHAPTER 2A HOW DO YOU BEGIN TO CLONE A GENE? 35 INTRODUCTION In the Program Introduction, you learned that the increase in diabetes in the United States has resulted in a great demand for its treatment,
Recombinant DNA, Biotechnology, and Microbes. Microbiology 221
Recombinant DNA, Biotechnology, and Microbes Microbiology 221 Overview Putting microbes to Work Molecular Cloning Recombinant DNA technology utilizes the power of microbiological selection and screening
Enter Legible BANNER ID: B 0 0
INTRODUCTORY BIOCHEMISTRY BIOL0280 Third Midterm Examination May 1, 2012 Enter Legible BANNER ID: B 0 0 Make sure that your Banner ID is on every page. This is the only way we have of matching you with
EcoR1 is a type IIP restriction endonuclease which cleaves the palindromic
Transfer of the Fungal cdna CIH-1 from the Plasmid Vector pbk CMV to the Plasmid Vector puc19 and sub- Cloning Mediated Recombinant puc19 Amplification INTRODUCTION Molecular cloning is a method used for
Regulation of gene expression. (Lehninger pg )
Regulation of gene expression (Lehninger pg. 1072-1085) Today s lecture Gene expression Constitutive, inducible, repressible genes Specificity factors, activators, repressors Negative and positive gene
Yesterday s Picture UNIT 3B
Warm-Up Plasmids are circular pieces of DNA which bacterial cells are able to take up from the environment, then replicate and transcribe. Eukaryotic cells, by contrast, contain large, linear (non-circular)
5. Which of the following enzymes catalyze the attachment of an amino acid to trna in the formation of aminoacyl trna?
Sample Examination Questions for Exam 3 Material Biology 3300 / Dr. Jerald Hendrix Warning! These questions are posted solely to provide examples of past test questions. There is no guarantee that any