Evaluation of Optical Surrogates for the Characterization of DOM Removal by Coagulation

Size: px
Start display at page:

Download "Evaluation of Optical Surrogates for the Characterization of DOM Removal by Coagulation"

Transcription

1 Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is The Royal Society of Chemistry 215 Evaluation of Optical Surrogates for the Characterization of DOM Removal by Coagulation Julie A. Korak 1, *, Fernando L. Rosario-Ortiz 1 and R. Scott Summers 1 1 Department of Civil, Environmental and Architectural Engineering, 428 UCB, University of Colorado Boulder, Boulder, CO 839 *Corresponding author, Julie.Korak@colorado.edu Supplemental Information 1. PARAFAC Model Development and Validation 1.1. Data Preparation The initial model contained 113 EEMs. 1 st order Rayleigh scattering was masked with the insertion of zeros. Second order Rayleigh scattering was masked with a margin of 22 nm and interpolated using the smoothing procedure in the dreem toolbox 1. First order Raman scattering was minimized by blank subtraction, but second order Raman scattering was interpolated using a margin of 1 nm. The data set was normalized prior to modeling to minimize the correlation between the PARAFAC components. All models were constrained to only include non-negative components Outlier Identification A preliminary outlier test investigated models containing 2 to 9 components. The initial investigation identified one sample as an outlier that exerted a significant leverage. This sample (Ft. Collins raw water) was removed from the data set (112 EEMs remaining in the final model) Component Number Screening The number of components was investigated by examining the sum squared error (SSE) and residuals of different component models. Systematic decreases in SSE occurred with each added component up to 6 components. Addition of a 6 th component eliminated a systematic residual centered around excitation 34 nm and emission 45 nm (Figure S-1). Little decease in SSE was observed with the addition of a 7 th component (Figure S-2). All components in the 6 - omponent model were physically realistic, only exhibiting one emission maxima. Based on these observations, a 6-component model was retained for validation. 1

2 Figure S-1. Sum squared error (SSE) as a function of excitation and emission wavelength for 2 through 6 component models. Figure S-2. Sum squared error (SSE) as a function of excitation and emission wavelength for 5 through 9 component models. 2

3 1.4. Model Validation A random initialization procedure was conducted to build 1 different models with different starting parameters to identify the stability of the solution and the overall model with a minimized error. The least squares solution had a core consistency value of 8.6%, and five other models in converged with similar core consistency values. The least squares model was further validated using split half analysis. The samples were randomly assigned to 4 different splits and combined into 4 different halves with 56 EEMs each (S 4 C 4 T 2 testing approach). Two of the splits required a smaller tolerance (1-8 ) and more analysis runs (5 instead of the default 3) to validate, but both split half analysis tests were validated for all comparisons. The models developed from each split were in good agreement with the overall, least squares model (Figure S-3). Figure ## presents contour plots of the final validated model. Figure S-3. Component loading for the overall model overlaid with the loadings for each of the 4 splits. Excitation spectra are dashed lines, and emission spectra are solid lines. 3

4 1.5. Model post-processing The normalization process was reversed to calculate the component loadings for each original sample. The model was also projected to calculate the loadings for the outlier originally removed from the dataset. A residual analysis of this projected model on the outlier found that it had a poor fit. Therefore, no PARAFAC component results are reported. Contour plots for each model component is presented in Figure S-4. Figure S-4. Contour plots of the 6 components in the final validated model. 2. Comparison of Raw Water Optical Properties and Coagulation Behaviors Multiple optical compositional indicators for the raw water samples were compared to establish the variability in the dataset. Table S-1 summarizes the optical properties of the raw water samples and range between source waters. PARAFAC component abundance is calculated as the component loading (F max ) divided by the sum of all component loadings (ΣF max ). Source 18 (Fort Collins) was an outlier in the PARAFAC model. Peak C is defined as the maximum intensity within the range: Excitation = 3-34 nm and Emission = 4-48 nm. Peak C emission wavelength is the emission wavelength at which the maximum intensity is located. Peak C/UV is the Peak C intensity divided by the absorbance at the corresponding excitation wavelength. Table S-2 demonstrates that most of the optical indicators are strongly correlated with one another. Figure S-5 compares the measured DOC removals to those predicted by the Edwards coagulation model 2. 4

5 Table S-1. Summary of raw water characteristics based on optical properties. No. Source DOC (mg/l) SUVA (L mg c -1 m -1 ) PARAFAC Component Abundance (%) C1 C2 C3 C4 C5 C6 FI Peak C Em Wavelength (nm) Specific Peak C (RU L mg c -1 ) Peak C/UV (RU-cm) 1 Betasso WTP % 23% 25% 8% 6% 4% Betasso WTP % 22% 25% 9% 6% 4% Betasso WTP % 21% 22% 9% 7% 6% Betasso WTP % 19% 2% 1% 1% 9% Boulder Reservoir % 11% 14% 19% 17% 13% Boulder Reservoir % 1% 14% 19% 17% 12% Boulder Reservoir % 11% 15% 18% 16% 11% Barr Lake % 19% 8% 16% 23% 13% Jackson Reservoir % 13% 11% 12% 21% 15% Lake Mead, NV % 1% 14% 2% 16% 1% Danville, KY % 19% 17% 11% 12% 4% Red River, ND % 16% 18% 16% 11% 3% Red Lake, MN % 17% 19% 17% 9% 3% Lake Erie, OH % 1% 11% 17% 2% 15% Arvada % 12% 12% 17% 17% 12% Boulder % 12% 14% 18% 15% 1% Evergreen % 18% 21% 12% 11% 5% Fort Collins Grand Junction % 11% 15% 18% 17% 9% Greely-Loveland % 12% 13% 19% 17% 8% Greely-Seaman % 15% 16% 17% 12% 5% Pueblo % 12% 14% 17% 16% 9% Minimum % 1% 8% 8% 6% 3% Maximum % 23% 25% 2% 23% 15%

6 Table S-2. Spearman rank correlation coefficients between compositional optical indicators in raw waters. Only statistically significant (p<.5) relationships are shown. SUVA C1% C2% C3% C4% C5% C6% FI Peak C Em Wavelength Specific Peak C Peak C/UV SUVA NaN C1% NaN C2% NaN C3% NaN C4% NaN C5% NaN C6% NaN FI NaN Peak C Em NaN Specific Peak C NaN -- Peak C/ UV NaN 6

7 7 6 Predicted DOC Removal (%) SUVA > 3 2 < SUVA < 3 SUVA < Measured DOC Removal (%) Figure S-5. Measured DOC removal compared to predicted DOC removal based on Edwards Model. The solid line represents the 1:1 line and the dashed lines are ±15% intervals. 7

8 3. Linear Regression Model Development# Excitation Wavelength (nm) Emission Wavelength (nm) Figure S-6. Wavelength combinations for exported and visually inspected residual plots Figure S-7. Contour plot exhibiting the p-value for the Kolmogorov-Smirnov test for models fit to different wavelength combinations for fully corrected fluorescence data. Value greater than.5 indicates non-normally distributed residuals. 8

9 DOC Removal (%) y=.93x R 2 pred =.85 PIavg=15% Comp Comp 2 y=.76x+.54 R 2 pred =.76 PIavg=18% DOC Removal (%) Comp 3 y=.79x+-.82 R 2 pred =.83 PIavg=15% Comp 4 y=.78x+-.82 R 2 pred =.84 PIavg=15% DOC Removal (%) y=.35x+.29 R 2 pred =.92 Comp 5 PIavg=35% y=.25x+.27 R 2 pred =.36 Comp 6 PIavg=35% Component Removal (%) Component Removal (%) Figure S-8. Regression analyses modeling DOC removal as a function of PARAFAC component removal. The model equation, R 2 pred and PI ag values are reported for each best-fit model. 9

10 Figure S-9. Parameter screening for linear regression (Eqn 5) fit to each wavelength combination for fluorescence data without inner filter corrections as a) Slope parameter estimate, b) Slope parameter p value (significance), c) Intercept parameter estimate, and d) Intercept parameter p value (significance). Figure S-1. Contour plot exhibiting the p-value for the Kolmogorov-Smirnov test for models fit to different wavelength combinations for fluorescence data without inner filter corrections. Value greater than.5 indicates non-normally distributed residuals. 1

11 Figure S-11. Parameter screening for regressions relating the relative decrease in UV absorbance to relative DOC removal at different absorbance wavelengths. Figure S-12. Regression model and diagnostic criteria predicting the relative decrease in DOC from the relative increase in FI. Solid line indicates model prediction, and dashed line indicates the 95% prediction interval. 11

12 Figure S-13. Multiple linear regression model and diagnostic criteria predicting the relative decrease in DOC from the relative decrease in UV 254 and relative increase in FI. Solid line indicates model prediction. Figure S-14. Multiple linear regression model and diagnostic criteria predicting the relative decrease in DOC from the relative decrease in UV 254 and final ph Solid line indicates model prediction. 12

13 4. DOC Removal Prediction based on Raw Water 1 a) C1:C2 1 b) C1:C3 1 c) C1:C DOC Removal (%) at 4 mg/l Alum d) C1:C g) C2:C e) C1:C h) C2:C f) C2:C i) C2:C DOC Removal (%) at 4 mg/l Alum j) C3:C m) C4:C k) C3:C n) C4:C l) C3:C o) C5:C Raw Water Ratio of Component F max values Figure S-15. PARAFAC Component intensity ratios in the raw water related to DOC removal at an alum dose of ~4 mg/l. Two samples were outliers and not included in the relationships (square, hollow markers). 13

14 DOC Removal (%) at 4 mg/l Alum y=3x+-.56 R 2 pred =.34 PIavg=39% Comp Comp 2 y=2.3x PIavg=29% R 2 pred = DOC Removal (%) at 4 mg/l Alum y=3.2x+-.15 R 2 pred =.85 PIavg=16% Comp Comp 4 y=-3x+.76 R 2 pred =.45 PIavg=34% DOC Removal (%) at 4 mg/l Alum Comp y=-3x+.8 R 2 pred =.85 PIavg=16% Component Abundance in Raw Water (%) Comp 6 y=-3.4x+.68 R 2 pred =.4 PIavg=38% Component Abundance in Raw Water (%) Figure S-16. PARAFAC Component abundance in the raw water related to DOC removal at an alum dose of ~4 mg/l. Two samples were outliers and not included in the relationships (square, hollow markers). 14

15 5. References 1. K. R. Murphy, C. A. Stedmon, D. Graeber, and R. Bro, Analytical Methods, 213, 5, M. Edwards, Journal AWWA, 1997, 89,

Assessment of Geosmin Occurrence and Potential Treatment by Advanced Oxidation

Assessment of Geosmin Occurrence and Potential Treatment by Advanced Oxidation Assessment of Geosmin Occurrence and Potential Treatment by Advanced Oxidation Sean MacIsaac, Elliott Wright & Dr. Graham Gagnon Civil and Resource Engineering Dalhousie University Overview Background

More information

Determination of UV Phototransformation of DOM in Treated Drinking Water by 3D Fluorescence

Determination of UV Phototransformation of DOM in Treated Drinking Water by 3D Fluorescence Determination of UV Phototransformation of DOM in Treated Drinking Water by 3D Fluorescence Aaron D. Dotson 1*, Katherine Beggs 2 and Drew VonLindern 1 1 University of Alaska Anchorage, Civil Engineering

More information

Characterization of dissolved organic matter in Colorado watersheds: The role of nutrients and algae on DBP formation

Characterization of dissolved organic matter in Colorado watersheds: The role of nutrients and algae on DBP formation Characterization of dissolved organic matter in Colorado watersheds: The role of nutrients and algae on DBP formation Amanda Hohner, Alia Khan, Diane McKnight, R. Scott Summers, and Fernando Rosario-Ortiz

More information

Use of Physicochemical Changes in NOM to Evaluate THM. Formation During Snowmelt, After Wildfires, and in Pre- Ozonation Water Treatment

Use of Physicochemical Changes in NOM to Evaluate THM. Formation During Snowmelt, After Wildfires, and in Pre- Ozonation Water Treatment Use of Physicochemical Changes in NOM to Evaluate THM The Relationship of Size, Polarity and THMFP of DOC in Northern Colorado Watersheds Formation During Snowmelt, After Wildfires, and in Pre- Ozonation

More information

Journal of Environmental Sciences 19(2007)

Journal of Environmental Sciences 19(2007) Journal of Environmental Sciences 19(2007) 787 791 Composition analysis of colored dissolved organic matter in Taihu Lake based on three dimension excitation-emission fluorescence matrix and PARAFAC model,

More information

Supporting Information. The effects of iron on optical properties of dissolved organic matter

Supporting Information. The effects of iron on optical properties of dissolved organic matter 1 1 Supporting Information 2 3 4 The effects of iron on optical properties of dissolved organic matter 5 6 7 8 9 Brett A. Poulin 1, Joseph N. Ryan 1, and George R. Aiken 2 * 1 Department of Civil, Environmental

More information

Fluorescence-Enhanced Treatment Process Optimization

Fluorescence-Enhanced Treatment Process Optimization Fluorescence-Enhanced Treatment Process Optimization Christopher Miller, PE Associate Professor Civil Engineering AWWA Conference October 29, 2015 Acknowledgements 2014 Headlines 2015 Headlines 2015 Headlines

More information

Supplementary Figure 1 - Excitation-emission-matrix (3D-EEM) for a 3/2 mixture

Supplementary Figure 1 - Excitation-emission-matrix (3D-EEM) for a 3/2 mixture Supplementary Figure 1 - Excitation-emission-matrix (3D-EEM) for a 3/2 mixture of DOC isolated from a laboratory algal culture and river water. This mixture was created so that the algal (Ex 280 nm, Em

More information

Assessing Trichloromethane Formation and Control in Algal-Stimulated Waters Amended With Nitrogen and Phosphorus

Assessing Trichloromethane Formation and Control in Algal-Stimulated Waters Amended With Nitrogen and Phosphorus University of Arkansas, Fayetteville ScholarWorks@UARK Theses and Dissertations 12-2013 Assessing Trichloromethane Formation and Control in Algal-Stimulated Waters Amended With Nitrogen and Phosphorus

More information

STAT 2300: Unit 1 Learning Objectives Spring 2019

STAT 2300: Unit 1 Learning Objectives Spring 2019 STAT 2300: Unit 1 Learning Objectives Spring 2019 Unit tests are written to evaluate student comprehension, acquisition, and synthesis of these skills. The problems listed as Assigned MyStatLab Problems

More information

SYSTEMATIC APPROACH TO WATER TREATMENT PLANT PROCESS OPTIMIZATION

SYSTEMATIC APPROACH TO WATER TREATMENT PLANT PROCESS OPTIMIZATION SYSTEMATIC APPROACH TO WATER TREATMENT PLANT PROCESS OPTIMIZATION Alex Yavich, Ph.D., P.E. Optimization Solutions Environmental, LLC WATERCON 2012 Optimization Solutions Environmental, LLC Water Treatment

More information

Highly efficient detection of hydrogen peroxide in solution and in the vapor phase via fluorescence quenching

Highly efficient detection of hydrogen peroxide in solution and in the vapor phase via fluorescence quenching Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information for Highly efficient detection of hydrogen peroxide in solution

More information

4.3 Nonparametric Tests cont...

4.3 Nonparametric Tests cont... Class #14 Wednesday 2 March 2011 What did we cover last time? Hypothesis Testing Types Student s t-test - practical equations Effective degrees of freedom Parametric Tests Chi squared test Kolmogorov-Smirnov

More information

Water quality sensing with a simultaneous UV-VIS absorbance & fluorescence excitation-emission mapping sensor

Water quality sensing with a simultaneous UV-VIS absorbance & fluorescence excitation-emission mapping sensor Water quality sensing with a simultaneous UV-VIS absorbance & fluorescence excitation-emission mapping sensor Adam M. Gilmore, Ph.D. HORIBA Instruments Inc. 3880 Park Avenue Edison, NJ 08820 Email: adam.gilmore@horiba.com

More information

Optical Properties of CdSe Nanocrystals

Optical Properties of CdSe Nanocrystals UC Berkeley College of Chemistry Chemistry 125 Physical Chemistry Laboratory Optical Properties of CdSe Nanocrystals Author: Jonathan Melville Lab Partner: David Gygi Graduate Student Instructor: Marieke

More information

Improved Jar Testing Optimization with TOC Analysis. Dondra Biller, PhD GE Analytical Instruments Boulder, CO

Improved Jar Testing Optimization with TOC Analysis. Dondra Biller, PhD GE Analytical Instruments Boulder, CO Improved Jar Testing Optimization with TOC Analysis Dondra Biller, PhD GE Analytical Instruments Boulder, CO Outline of Presentation 1. What is total organic carbon (TOC)? 2. Importance of jar testing

More information

OPTIMISING PAC DOSING TO REMOVE MIB AND GEOSMIN IN FOUR ADELAIDE METROPOLITAN WATER TREATMENT PLANTS. David Cook

OPTIMISING PAC DOSING TO REMOVE MIB AND GEOSMIN IN FOUR ADELAIDE METROPOLITAN WATER TREATMENT PLANTS. David Cook OPTIMISING PAC DOSING TO REMOVE MIB AND GEOSMIN IN FOUR ADELAIDE METROPOLITAN WATER TREATMENT PLANTS Paper Presented by: David Cook Authors: David Cook, Australian Water Quality Centre - SA Gayle Newcombe,

More information

Angélique Goffin, Sabrina Guérin, Vincent Rocher, Gilles Varrault

Angélique Goffin, Sabrina Guérin, Vincent Rocher, Gilles Varrault Excitation-emission matrix Fluorescence spectroscopy to assess quality and quantity of dissolved organic matter in the Seine River from the upstream to the downstream of the Paris agglomeration during

More information

A simple model for low flow forecasting in Mediterranean streams

A simple model for low flow forecasting in Mediterranean streams European Water 57: 337-343, 2017. 2017 E.W. Publications A simple model for low flow forecasting in Mediterranean streams K. Risva 1, D. Nikolopoulos 2, A. Efstratiadis 2 and I. Nalbantis 1* 1 School of

More information

Chapter 10 Regression Analysis

Chapter 10 Regression Analysis Chapter 10 Regression Analysis Goal: To become familiar with how to use Excel 2007/2010 for Correlation and Regression. Instructions: You will be using CORREL, FORECAST and Regression. CORREL and FORECAST

More information

Biodegradation Of Catchment Source Organic Matter In

Biodegradation Of Catchment Source Organic Matter In Biodegradation Of Catchment Source Organic Matter In Riverine Environments Merissa Marius 1, Adrian Collins 2, Anne Stringfellow 1, David Sear 3, David Smallman 1 1 Civil Engineering and the Environment,

More information

Lake transparency: a window into decadal variations in dissolved organic carbon concentrations in Lakes of Acadia National Park, Maine

Lake transparency: a window into decadal variations in dissolved organic carbon concentrations in Lakes of Acadia National Park, Maine Lake transparency: a window into decadal variations in dissolved organic carbon concentrations in Lakes of Acadia National Park, Maine Collin Roesler Department of Earth and Oceanographic Science, Bowdoin

More information

In situ semi-quantitative assessment of single cell viability by resonance

In situ semi-quantitative assessment of single cell viability by resonance Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) In situ semi-quantitative assessment

More information

Special Publication SJ2004-SP22 St. Johns River Water Supply Project Surface Water Treatment and Demineralization Study

Special Publication SJ2004-SP22 St. Johns River Water Supply Project Surface Water Treatment and Demineralization Study Special Publication SJ2004-SP22 St. Johns River Water Supply Project Surface Water Treatment and Demineralization Study Preliminary Raw Water Characterization TECHNICAL MEMORANDUM PRELIMINARY RAW WATER

More information

Characterizing the Interaction between Trace Metal and Dissolved Organic Matter from the Florida Coastal Everglades

Characterizing the Interaction between Trace Metal and Dissolved Organic Matter from the Florida Coastal Everglades Characterizing the Interaction between Trace Metal and Dissolved Organic Matter from the Florida Coastal Everglades Rudolf Jaffé and Youhei Yamashita Southeast Environmental Research Center & Department

More information

Spatial and temporal variations and factors controlling the concentrations of hydrogen peroxide and organic peroxides in rivers

Spatial and temporal variations and factors controlling the concentrations of hydrogen peroxide and organic peroxides in rivers Accessory publication Spatial and temporal variations and factors controlling the concentrations of hydrogen peroxide and organic peroxides in rivers Khan M. G. Mostofa A,B and Hiroshi Sakugawa B,C A State

More information

Paula Bontempi. University of Southern Mississippi, Department of Marine Science, 1020 Balch Blvd, Stennis Space Center, MS

Paula Bontempi. University of Southern Mississippi, Department of Marine Science, 1020 Balch Blvd, Stennis Space Center, MS TRANSFORMATION OF ALLOCHTHONOUS DISSOLVED ORGANIC CARBON IN A TROPICAL BLACKWATER RIVER AS :MEASURED BY FLUORESCENCE ANALYSIS: APPLICATION TO FOODWEB ECOLOGY Paula Bontempi. University of Southern Mississippi,

More information

IMPACT OF NOM AND NITRATE ON THE FEASIBILITY OF UV/H O 2 2 TREATMENT FOR ORGANIC MICROPOLLUTANT CONTROL

IMPACT OF NOM AND NITRATE ON THE FEASIBILITY OF UV/H O 2 2 TREATMENT FOR ORGANIC MICROPOLLUTANT CONTROL IMPACT OF NOM AND NITRATE ON THE FEASIBILITY OF UV/H O 2 2 TREATMENT FOR ORGANIC MICROPOLLUTANT CONTROL Bram J. Martijn PWN Water Supply Company North Holland James P. Malley University of New Hampshire

More information

Natural organic matter in drinking water Ontario Water Works Association Water Treatment Seminar March 20, 2018

Natural organic matter in drinking water Ontario Water Works Association Water Treatment Seminar March 20, 2018 Natural organic matter in drinking water Ontario Water Works Association Water Treatment Seminar March 20, 2018 Judy MacDonald, P. Eng. Water Quality Engineer Materials and Treatment Section Water and

More information

Relationships Between Disinfection Byproducts and Dissolved Organic Matter in Drinking Water

Relationships Between Disinfection Byproducts and Dissolved Organic Matter in Drinking Water Relationships Between Disinfection Byproducts and Dissolved Organic Matter in Drinking Water Meng-Horng (Chris) Hsu, I. H. (Mel) Suffet Environmental Science and Engineering Program UCLA Los Angeles, CA

More information

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) Berberine as a novel light-up i-motif fluorescence ligand

More information

Using Empower SystemsQT Qualification Tool

Using Empower SystemsQT Qualification Tool Using Empower SystemsQT Qualification Tool for Waters Modular HPLC Systems A summary of Empower SystemsQT Qualification Tool features and benefits, with emphasis on the technical attributes of the qualification

More information

MOLECULAR COMPOSITION AND OPTICAL PROPERTIES OF NATURAL ORGANIC MATTER: CORRELATING BULK SPECTROSCOPY AND ULTRAHIGH RESOLUTION MASS SPECTROMETRY

MOLECULAR COMPOSITION AND OPTICAL PROPERTIES OF NATURAL ORGANIC MATTER: CORRELATING BULK SPECTROSCOPY AND ULTRAHIGH RESOLUTION MASS SPECTROMETRY MOLECULAR COMPOSITION AND OPTICAL PROPERTIES OF NATURAL ORGANIC MATTER: CORRELATING BULK SPECTROSCOPY AND ULTRAHIGH RESOLUTION MASS SPECTROMETRY CLIMATE CHANGE AND DOM IN PEATLANDS William T. Cooper*,

More information

Disinfectant dosing of blended drinking waters

Disinfectant dosing of blended drinking waters 18 th World IMACS / MODSIM Congress, Cairns, Australia 13-17 July 2009 http://mssanz.org.au/modsim09 Disinfectant dosing of blended drinking waters van Leeuwen, J. 1,3, D. Cook 2, C. Chow 1,2,3 and M.

More information

UV254 Go! Measurement and Calibration of BOD against the BOD five day test

UV254 Go! Measurement and Calibration of BOD against the BOD five day test 1 st October 18 UV254 Go! Measurement and Calibration of BOD against the BOD five day test Tools Needed Photonic Measurements UV254 Go! Quartz Cuvettes Distilled water BOD 5day testing system such as BODTrak

More information

and Forecasting CONCEPTS

and Forecasting CONCEPTS 6 Demand Estimation and Forecasting CONCEPTS Regression Method Scatter Diagram Linear Regression Regression Line Independent Variable Explanatory Variable Dependent Variable Intercept Coefficient Slope

More information

SECTION 11 ACUTE TOXICITY DATA ANALYSIS

SECTION 11 ACUTE TOXICITY DATA ANALYSIS SECTION 11 ACUTE TOXICITY DATA ANALYSIS 11.1 INTRODUCTION 11.1.1 The objective of acute toxicity tests with effluents and receiving waters is to identify discharges of toxic effluents in acutely toxic

More information

Supplementary Materials for

Supplementary Materials for Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 Supplementary Materials for Bimolecular Proximity of Ruthenium Complex and Methylene Blue

More information

Characterizing dissolved organic matter fluorescence with parallel factor analysis: a tutorial

Characterizing dissolved organic matter fluorescence with parallel factor analysis: a tutorial LIMNOLOGY and OCEANOGRAPHY: METHODS Limnol. Oceanogr.: Methods 6, 2008, 572 579 2008, by the American Society of Limnology and Oceanography, Inc. Characterizing dissolved organic matter fluorescence with

More information

alamarblue Technical Datasheet

alamarblue Technical Datasheet alamarblue Technical Datasheet Bio-Rad Laboratories Endeavour House, Langford Lane, Kidlington, Oxford, OXON OX5 1GE, UK antibody_sales_uk@bio-radcom Tel: +44 () 1865 8527 Copyright Bio-Rad Laboratories,

More information

Seasonal Source Water Quality and Treatment Challenges Town of Newburgh s Chadwick Lake Filtration Plant

Seasonal Source Water Quality and Treatment Challenges Town of Newburgh s Chadwick Lake Filtration Plant Seasonal Source Water Quality and Treatment Challenges Town of Newburgh s Chadwick Lake Filtration Plant Clayton Johnson GHD Kevin Castro GHD James Osborne Town of Newburgh Image placeholder Outline Introduction

More information

Ohio EPA HAB Update. OTCO Workshop March 7, Heather Raymond Ohio EPA HAB Coordinator

Ohio EPA HAB Update. OTCO Workshop March 7, Heather Raymond Ohio EPA HAB Coordinator Ohio EPA HAB Update OTCO Workshop March 7, 2018 Heather Raymond Ohio EPA HAB Coordinator Ohio EPA HAB Update 2017 HAB Monitoring Overview Cyanotoxin Treatment: Treatment technique rule requirements, CPE

More information

Using fluorescence for rapid wastewater presence detection in sources of drinking water

Using fluorescence for rapid wastewater presence detection in sources of drinking water Using fluorescence for rapid wastewater presence detection in sources of drinking water Nicolas Peleato, Robert C. Andrews, Ray L. Legge* Department of Civil Engineering, University of Toronto and *Department

More information

Trophic roles determine coral reef fish community size structure

Trophic roles determine coral reef fish community size structure Supplementary Material Trophic roles determine coral reef fish community size structure James P.W. Robinson 1, Julia K. Baum 2 1 Department of Biology, University of Victoria, PO BOX 1700 Station CSC,

More information

Facile Preparation of Low Cytotoxicity Fluorescent Carbon Nanocrystals by. Electrooxidation of Graphite

Facile Preparation of Low Cytotoxicity Fluorescent Carbon Nanocrystals by. Electrooxidation of Graphite Supporting Information for Facile Preparation of Low Cytotoxicity Fluorescent Carbon Nanocrystals by Electrooxidation of Graphite Qiao-Ling Zhao, Zhi-Ling Zhang, Bi-Hai Huang, Jun Peng, Min Zhang, Dai-Wen

More information

Use of Organic Characterization Techniques to Monitor Advanced Oxidation Processes in Water Reuse And Wastewater Treatment

Use of Organic Characterization Techniques to Monitor Advanced Oxidation Processes in Water Reuse And Wastewater Treatment Use of Organic Characterization Techniques to Monitor Advanced Oxidation Processes in Water Reuse And Wastewater Treatment G-0005-stock-2010 Template Final.ppt Ben Stanford Aleks Pisarenko Dan Gerrity

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Mechanochromism and aggregation induced emission in benzothiazole substituted

More information

TECHNICAL NOTE THE NEXT GENERATION OF MICROPLATES

TECHNICAL NOTE THE NEXT GENERATION OF MICROPLATES TECHNICAL NOTE TN0002: Optimiser Microplate System (ELISA) Setup Guide on the BioTek FLx800 Fluorescence Microplate Reader THE NEXT GENERATION OF MICROPLATES Better Immunoassays through Innovative Microfluidics

More information

Raman Spectroscopy for Pharmaceutical Applications

Raman Spectroscopy for Pharmaceutical Applications Spectroscopy Solutions 2014 E conference Raman Spectroscopy for Pharmaceutical Applications Frederick H. Long, Ph.D. President, Spectroscopic Solutions, LLC History of Raman Spectroscopy Discovery of Raman

More information

Supporting Information for. Conjugated polymer composite artificial muscle with solvent-induced anisotropic mechanical actuation

Supporting Information for. Conjugated polymer composite artificial muscle with solvent-induced anisotropic mechanical actuation Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2014 Supporting Information for Conjugated polymer composite artificial muscle

More information

Super-marketing. A Data Investigation. A note to teachers:

Super-marketing. A Data Investigation. A note to teachers: Super-marketing A Data Investigation A note to teachers: This is a simple data investigation requiring interpretation of data, completion of stem and leaf plots, generation of box plots and analysis of

More information

Calculation of BLM Fixed Monitoring Benchmarks for Copper at Selected Monitoring Sites in Colorado

Calculation of BLM Fixed Monitoring Benchmarks for Copper at Selected Monitoring Sites in Colorado Prepared by HydroQual, Inc. for the US Environmental Protection Agency Calculation of BLM Fixed Monitoring Benchmarks for Copper at Selected Monitoring Sites in Colorado Final Report October 10, 2008 GLEC.030.004.01.001

More information

Preliminary Investigation of Near Infrared Spectroscopy for Green Sand Component Identification

Preliminary Investigation of Near Infrared Spectroscopy for Green Sand Component Identification Preliminary Investigation of Near Infrared Spectroscopy for Green Sand Component Identification Dr. Scott R. Giese University of Northern Iowa Research Objective Green sand molding characterization for

More information

A Method to Determine Biodegradable Dissolved Organic Nitrogen in Water ND 58108, USA

A Method to Determine Biodegradable Dissolved Organic Nitrogen in Water ND 58108, USA A Method to Determine Biodegradable Dissolved Organic Nitrogen in Water Tanush Wadhawan a, Halis Simsek a, Murthy Kasi a, Kristofer Knutson b, John McEvoy c, Birgit Pruess c and Eakalak Khan a* a Department

More information

Assessment of nanoparticles safety: corrected absorbance-based toxicity test

Assessment of nanoparticles safety: corrected absorbance-based toxicity test Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 7 Supplementary information Assessment of nanoparticles safety: corrected absorbance-based toxicity test

More information

Robert T. Shoaf, P.E., BCEE Presented by John Krinks, PE

Robert T. Shoaf, P.E., BCEE Presented by John Krinks, PE Nitrate and/or TOC Removal by RO Membranes, Anion Exchange and GAC Case Studies Robert T. Shoaf, P.E., BCEE Presented by John Krinks, PE 52 nd Annual OTCO Water Workshop Columbus, OH March 4 th -5 th,

More information

Investigator: July 2002

Investigator: July 2002 KINETIC-BASED MODELS FOR BROMATE FORMATION IN NATURAL WATERS USEPA GRANT # R 826835-01-0 FINAL REPORT EXECUTIVE SUMMARY Investigator: Paul Westerhoff, Ph.D., PE Associate Professor Department of Civil

More information

Investigation of dendrimers functionalized with eosin as macrophotoinitiators for polymerization-based signal amplification reactions

Investigation of dendrimers functionalized with eosin as macrophotoinitiators for polymerization-based signal amplification reactions Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Investigation of dendrimers functionalized with eosin as macrophotoinitiators

More information

Marine Chemistry. Piotr Kowalczuk a,, William J. Cooper b, Michael J. Durako c, Amanda E. Kahn c, Michael Gonsior b, Heather Young c

Marine Chemistry. Piotr Kowalczuk a,, William J. Cooper b, Michael J. Durako c, Amanda E. Kahn c, Michael Gonsior b, Heather Young c Marine Chemistry 118 (2010) 22 36 Contents lists available at ScienceDirect Marine Chemistry journal homepage: www.elsevier.com/locate/marchem Characterization of dissolved organic matter fluorescence

More information

Fusion Analytical Method Validation

Fusion Analytical Method Validation Fusion QbD Software Platform Fusion Analytical Method Validation The Only Software That Has It All! 100% aligned with FDA/ICH Quality by Design (QbD) guidances! Can be used for LC and Non-LC methods (e.g.

More information

Lab 6 Measurement of Ozone

Lab 6 Measurement of Ozone Georgia Institute of Technology School of Earth and Atmospheric Sciences EAS 4641 Spring 2008 Lab 6 Measurement of Ozone Purpose of Lab 6: In this lab you will measure the ambient concentration of ozone

More information

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011.

Electronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011. Experimental: MTT assay: To determine cell viability the colorimetric MTT metabolic activity assay was used. Hela cells (1 10 4 cells/well) were cultured in a 96-well plate at 37 C, and exposed to varying

More information

Enhanced biodegradation of carbamazepine after UV/H 2 O 2 advanced. oxidation

Enhanced biodegradation of carbamazepine after UV/H 2 O 2 advanced. oxidation Supporting Information for the Environmental Science and Technology article: Enhanced biodegradation of carbamazepine after UV/H 2 O 2 advanced oxidation Prepared for submission to Environmental Science

More information

Measurement of Enzyme Kinetics by UV-Visible Spectroscopy

Measurement of Enzyme Kinetics by UV-Visible Spectroscopy UV-0002 UV-Visible Spectroscopy Introduction Enzyme activity is frequently investigated in the medicinal, biochemistry, and food science research fields to elucidate the rate of which reaction occurs and

More information

Indicators of Hydrologic Alteration (IHA) software, Version 7.1

Indicators of Hydrologic Alteration (IHA) software, Version 7.1 Indicators of Hydrologic Alteration (IHA) software, Version 7.1 IHA Software Analyzes hydrologic characteristics and their changes over time. Computes 67 ecologicallyrelevant flow statistics using daily

More information

AGGGCTCACTCCAGCCTCCAG AGGGGAGGGATGAAGTGATGGG TGCTGGAGCCCGAGTGGGAA TGCCGCACGAAGCTAGCCAT ATCCAGGGAGCAGCGAGCCAA CCGCCTTGTCATGGGTGTGCT

AGGGCTCACTCCAGCCTCCAG AGGGGAGGGATGAAGTGATGGG TGCTGGAGCCCGAGTGGGAA TGCCGCACGAAGCTAGCCAT ATCCAGGGAGCAGCGAGCCAA CCGCCTTGTCATGGGTGTGCT Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Sarvesh Varma, Joel Voldman* Supplemental Information PCR Primers The following table lists

More information

Watershed Characteristics and Sediment PAH Contribution from Coal-Tar Sealant EVAN DART CE 394K UNIVERSITY OF TEXAS AT AUSTIN

Watershed Characteristics and Sediment PAH Contribution from Coal-Tar Sealant EVAN DART CE 394K UNIVERSITY OF TEXAS AT AUSTIN 2014 Watershed Characteristics and Sediment PAH Contribution from Coal-Tar Sealant EVAN DART CE 394K UNIVERSITY OF TEXAS AT AUSTIN I. Introduction The increase in urbanization in the United States has

More information

Side by Side Piloting of Process Alternatives Yields Direct Performance Comparison

Side by Side Piloting of Process Alternatives Yields Direct Performance Comparison OBG PRESENTS: OBG PRESENTS: Side by Side Piloting of Process Alternatives Yields Direct Performance Comparison LORI W. REID, P.E. New York State AWWA Spring Meeting, April 26, 2017 Outline Background Project

More information

Fuel Fluorescence Logging using the Optical Image Profiler (OIP)

Fuel Fluorescence Logging using the Optical Image Profiler (OIP) Fuel Fluorescence Logging using the Optical Image Profiler (OIP) Note: A Patent is Pending for this System. Daniel Pipp Chemist, Geoprobe Systems Presented May 2017 at the Battelle Bioremediation Symposium

More information

Dynamics of Energy Transfer in Large. Plasmonic Aluminum Nanoparticles

Dynamics of Energy Transfer in Large. Plasmonic Aluminum Nanoparticles Supporting Information Dynamics of Energy Transfer in Large Plasmonic Aluminum Nanoparticles Kenneth J. Smith,#, Yan Cheng,#, Ebuka S. Arinze,#, Nicole E. Kim, Arthur E. Bragg, Susanna M. Thon Department

More information

Anthropogenic Influences of Paved Runoff and Sanitary Sewage on the Dissolved

Anthropogenic Influences of Paved Runoff and Sanitary Sewage on the Dissolved Support Information (SI) File Title Anthropogenic Influences of Paved Runoff and Sanitary Sewage on the Dissolved Organic Matter Quality of Wet Weather Overflows: An Excitation-Emission Matrix Parallel

More information

Tarrant Regional Water District Water Quality Trend Analysis Final Report Executive Summary. July 2011

Tarrant Regional Water District Water Quality Trend Analysis Final Report Executive Summary. July 2011 Tarrant Regional Water District Water Quality Trend Analysis 1989-2009 Final Report Executive Summary July 2011 Prepared for Tarrant Regional Water District 201 North Shore Drive Fort Worth, TX 76135 Phone:

More information

Experiment 18 Determination of Iron by Visible Spectrophotometry

Experiment 18 Determination of Iron by Visible Spectrophotometry Experiment 18 Determination of Iron by Visible Spectrophotometry PRELAB DISCUSSION Visible spectrophotometry (spectral analysis) is a method of measuring the concentration of colored solutions by the amount

More information

Performance of the Sievers 500 RL On-Line TOC Analyzer

Performance of the Sievers 500 RL On-Line TOC Analyzer GE Water & Process Technologies Analytical Instruments Performance of the Sievers 500 RL On-Line TOC Analyzer imagination at work Page 2 of 10 Introduction To determine the performance characteristics

More information

Declaration. All substantive contributions by others to the worked presented, including jointly authored publications, is clearly acknowledged.

Declaration. All substantive contributions by others to the worked presented, including jointly authored publications, is clearly acknowledged. High performance size exclusion chromatography with a multiple wavelength absorbance detector for improved dissolved organic matter characterisation and water quality monitoring Huiping Huang School of

More information

OVERVIEW OF ELECTRIC COST OF SERVICE STUDIES

OVERVIEW OF ELECTRIC COST OF SERVICE STUDIES The Prime Group Priority Cost of Service, Rate & Regulatory Support OVERVIEW OF ELECTRIC COST OF SERVICE STUDIES By: Larry Feltner There are a number of considerations in determining the level and structure

More information

Research Article Estimation of Biochemical Oxygen Demand Based on Dissolved Organic Carbon, UV Absorption, and Fluorescence Measurements

Research Article Estimation of Biochemical Oxygen Demand Based on Dissolved Organic Carbon, UV Absorption, and Fluorescence Measurements Chemistry Volume 1, Article ID 79, 9 pages http://dx.doi.org/1.11/1/79 Research Article Estimation of Biochemical Oxygen Demand Based on Dissolved Organic Carbon, UV Absorption, and Measurements Jihyun

More information

Minuscule weight percent of graphene oxide and reduced graphene oxide modified Ag 3 PO 4 : New insight into improved photocatalytic activity

Minuscule weight percent of graphene oxide and reduced graphene oxide modified Ag 3 PO 4 : New insight into improved photocatalytic activity Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2016 Supporting Information Minuscule

More information

Your Analyte ELISA Kit Instruction

Your Analyte ELISA Kit Instruction NovaTeinBio FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC PURPOSES Your Analyte ELISA Kit Instruction Intended use The kit is used to detect the level of Your analyte in cell culture, serum blood plasma and

More information

A facile and fast method for quantitating lignin in lignocellulosic biomass using acidic

A facile and fast method for quantitating lignin in lignocellulosic biomass using acidic Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2016 Electronic Supporting Information (ESI) A facile and fast method for quantitating lignin

More information

Austin Peters, PE, MWH

Austin Peters, PE, MWH Presented at PNWS-AWWA Annual Conference Spokane, Washington May 9, 2013 Austin Peters, PE, MWH Co-Authors: Jennifer Gelmini, PE, MWH Michael McWhirter, MWH Michael Price, PE, MWH Peter Kreft, PE, MWH

More information

Categorical Predictors, Building Regression Models

Categorical Predictors, Building Regression Models Fall Semester, 2001 Statistics 621 Lecture 9 Robert Stine 1 Categorical Predictors, Building Regression Models Preliminaries Supplemental notes on main Stat 621 web page Steps in building a regression

More information

FROM: Dan Rubado, Evaluation Project Manager, Energy Trust of Oregon; Phil Degens, Evaluation Manager, Energy Trust of Oregon

FROM: Dan Rubado, Evaluation Project Manager, Energy Trust of Oregon; Phil Degens, Evaluation Manager, Energy Trust of Oregon September 2, 2015 MEMO FROM: Dan Rubado, Evaluation Project Manager, Energy Trust of Oregon; Phil Degens, Evaluation Manager, Energy Trust of Oregon TO: Marshall Johnson, Sr. Program Manager, Energy Trust

More information

CHARACTERIZATION OF WATER CHEMISTRY AND DIDYMOSPHENIA GEMINATA GROWTH IN BOULDER CREEK RACHEL A. MCLOUGHLIN

CHARACTERIZATION OF WATER CHEMISTRY AND DIDYMOSPHENIA GEMINATA GROWTH IN BOULDER CREEK RACHEL A. MCLOUGHLIN CHARACTERIZATION OF WATER CHEMISTRY AND DIDYMOSPHENIA GEMINATA GROWTH IN BOULDER CREEK By RACHEL A. MCLOUGHLIN B.S. Environmental Studies, Randolph-Macon College, 2006 A thesis submitted to the Faculty

More information

APPENDIX III SAMPLE LAB REPORT. Experiment 1. High Performance Liquid Chromatography. Alfred E. Neuman

APPENDIX III SAMPLE LAB REPORT. Experiment 1. High Performance Liquid Chromatography. Alfred E. Neuman APPENDIX III SAMPLE LAB REPORT Experiment 1 High Performance Liquid Chromatography Alfred E. Neuman Chemistry 436 September 15, 1999 INTRODUCTION In this experiment, high performance liquid chromatography

More information

Zu-Tao Ou-Yang Center for Global Change and Earth Observation Michigan State University

Zu-Tao Ou-Yang Center for Global Change and Earth Observation Michigan State University Zu-Tao Ou-Yang Center for Global Change and Earth Observation Michigan State University Ocean Color: Spectral Visible Radiometry Color of the ocean contains latent information on the water qualitycdom,

More information

A Versatile Method for Quantification of DNA and PCR Products Based on Timeresolved

A Versatile Method for Quantification of DNA and PCR Products Based on Timeresolved A Versatile Method for Quantification of DNA and PCR Products Based on Timeresolved Eu III Luminescence Bo Song, a Caroline D. B. Vandevyver, a,1 Emmanuel Deiters, a Anne-Sophie Chauvin, a Ilkka Hemmilä,

More information

Statistics 201 Summary of Tools and Techniques

Statistics 201 Summary of Tools and Techniques Statistics 201 Summary of Tools and Techniques This document summarizes the many tools and techniques that you will be exposed to in STAT 201. The details of how to do these procedures is intentionally

More information

Formation of Disinfection By-products during Ballast. Water Treatment with Ozone, Chlorine, and Peracetic. Acid: Influence of Water Quality Parameters

Formation of Disinfection By-products during Ballast. Water Treatment with Ozone, Chlorine, and Peracetic. Acid: Influence of Water Quality Parameters Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is The Royal Society of Chemistry 215 Supporting Information for: Formation of Disinfection

More information

U.S. Geological Survey, Fort Collins, Colorado 80523, USA; 2 Texas

U.S. Geological Survey, Fort Collins, Colorado 80523, USA; 2 Texas 1 2 Linking the Agricultural Landscape of the Midwest to Stream Health with Structural Equation Modeling. 3 4 AUTHORS Travis S. Schmidt 1*, Peter C. Van Metre 2, Daren M. Carlisle 3 5 6 7 1 tschmidt@usgs.gov,

More information

Response of Seismically Isolated Bridges Considering Variation in the Mechanical Properties of Individual Isolators

Response of Seismically Isolated Bridges Considering Variation in the Mechanical Properties of Individual Isolators ..1.... Response of Seismically Isolated Bridges Considering Variation in the Mechanical Properties of Individual Isolators Gordon Warn Graduate Research Assistant, Department of Civil Structural and Environmental

More information

EXPERIMENT 5. Molecular Absorption Spectroscopy: Determination of Iron with 1,10-Phenanthroline

EXPERIMENT 5. Molecular Absorption Spectroscopy: Determination of Iron with 1,10-Phenanthroline EXPERIMENT 5 Molecular Absorption Spectroscopy: Determination of Iron with 1,10-Phenanthroline UNKNOWN Submit a clean, labeled 100-mL volumetric flask to the instructor so that your unknown iron solution

More information

Quartz Glass for Optics Data and Properties

Quartz Glass for Optics Data and Properties Quartz Glass for Optics Data and Properties Technical Properties Internal transmission (%) Values of pure transmissions of a 10 mm thick sample for selected UV-Wavelengths. Wavelength nm Suprasil ArF/

More information

Attachment E2. Drought Indices Calculation Methods and Applicability to Colfax County

Attachment E2. Drought Indices Calculation Methods and Applicability to Colfax County Attachment E2 Drought Indices Calculation Methods and Applicability to Colfax County Attachment E2. Drought Indices Methodology and Applicability to Colfax County E2.1 Palmer Drought Severity Index E2.1.1

More information

GOOD LABORATORY PRACTICE Agilent Cary 8454 UV-Visible Spectroscopy System

GOOD LABORATORY PRACTICE Agilent Cary 8454 UV-Visible Spectroscopy System GOOD LABORATORY PRACTICE Agilent Cary 8454 UV-Visible Spectroscopy System Introduction The objective of good laboratory practice (GLP) is to obtain accurate and precise results, using a measurement system

More information

Seasonal variation of colored dissolved organic matter in the Nelson Estuary, Hudson Bay

Seasonal variation of colored dissolved organic matter in the Nelson Estuary, Hudson Bay Seasonal variation of colored dissolved organic matter in the Nelson Estuary, Hudson Bay C. Guéguen 1, A. Perroud 1, G. McCullough 2, D. G. Barber 2 1 Department of Chemistry, Trent University 2 Centre

More information

Our Solutions for Protein Analysis

Our Solutions for Protein Analysis Our Solutions for Protein Analysis www.horibalifesciences.com info.sci@horiba.com Solutions for Protein Characterization Kinetics Proteins are involved in many critical roles in the body: Enzymes - allow

More information

The Influence of Watershed Land Use on the Composition of Dissolved Organic Matter Entering Conesus Lake, NY

The Influence of Watershed Land Use on the Composition of Dissolved Organic Matter Entering Conesus Lake, NY The Influence of Watershed Land Use on the Composition of Dissolved Organic Matter Entering Conesus Lake, NY Morgan R. Bida, Todd Pagano, A. Christina Tyler Program in Environmental Sciences School of

More information

SEES 503 SUSTAINABLE WATER RESOURCES. Floods. Instructor. Assist. Prof. Dr. Bertuğ Akıntuğ

SEES 503 SUSTAINABLE WATER RESOURCES. Floods. Instructor. Assist. Prof. Dr. Bertuğ Akıntuğ SEES 503 SUSTAINABLE WATER RESOURCES Floods Instructor Assist. Prof. Dr. Bertuğ Akıntuğ Civil Engineering Program Middle East Technical University Northern Cyprus Campus SEES 503 Sustainable Water Resources

More information