Evaluation of Optical Surrogates for the Characterization of DOM Removal by Coagulation
|
|
- Wilfred Shepherd
- 5 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is The Royal Society of Chemistry 215 Evaluation of Optical Surrogates for the Characterization of DOM Removal by Coagulation Julie A. Korak 1, *, Fernando L. Rosario-Ortiz 1 and R. Scott Summers 1 1 Department of Civil, Environmental and Architectural Engineering, 428 UCB, University of Colorado Boulder, Boulder, CO 839 *Corresponding author, Julie.Korak@colorado.edu Supplemental Information 1. PARAFAC Model Development and Validation 1.1. Data Preparation The initial model contained 113 EEMs. 1 st order Rayleigh scattering was masked with the insertion of zeros. Second order Rayleigh scattering was masked with a margin of 22 nm and interpolated using the smoothing procedure in the dreem toolbox 1. First order Raman scattering was minimized by blank subtraction, but second order Raman scattering was interpolated using a margin of 1 nm. The data set was normalized prior to modeling to minimize the correlation between the PARAFAC components. All models were constrained to only include non-negative components Outlier Identification A preliminary outlier test investigated models containing 2 to 9 components. The initial investigation identified one sample as an outlier that exerted a significant leverage. This sample (Ft. Collins raw water) was removed from the data set (112 EEMs remaining in the final model) Component Number Screening The number of components was investigated by examining the sum squared error (SSE) and residuals of different component models. Systematic decreases in SSE occurred with each added component up to 6 components. Addition of a 6 th component eliminated a systematic residual centered around excitation 34 nm and emission 45 nm (Figure S-1). Little decease in SSE was observed with the addition of a 7 th component (Figure S-2). All components in the 6 - omponent model were physically realistic, only exhibiting one emission maxima. Based on these observations, a 6-component model was retained for validation. 1
2 Figure S-1. Sum squared error (SSE) as a function of excitation and emission wavelength for 2 through 6 component models. Figure S-2. Sum squared error (SSE) as a function of excitation and emission wavelength for 5 through 9 component models. 2
3 1.4. Model Validation A random initialization procedure was conducted to build 1 different models with different starting parameters to identify the stability of the solution and the overall model with a minimized error. The least squares solution had a core consistency value of 8.6%, and five other models in converged with similar core consistency values. The least squares model was further validated using split half analysis. The samples were randomly assigned to 4 different splits and combined into 4 different halves with 56 EEMs each (S 4 C 4 T 2 testing approach). Two of the splits required a smaller tolerance (1-8 ) and more analysis runs (5 instead of the default 3) to validate, but both split half analysis tests were validated for all comparisons. The models developed from each split were in good agreement with the overall, least squares model (Figure S-3). Figure ## presents contour plots of the final validated model. Figure S-3. Component loading for the overall model overlaid with the loadings for each of the 4 splits. Excitation spectra are dashed lines, and emission spectra are solid lines. 3
4 1.5. Model post-processing The normalization process was reversed to calculate the component loadings for each original sample. The model was also projected to calculate the loadings for the outlier originally removed from the dataset. A residual analysis of this projected model on the outlier found that it had a poor fit. Therefore, no PARAFAC component results are reported. Contour plots for each model component is presented in Figure S-4. Figure S-4. Contour plots of the 6 components in the final validated model. 2. Comparison of Raw Water Optical Properties and Coagulation Behaviors Multiple optical compositional indicators for the raw water samples were compared to establish the variability in the dataset. Table S-1 summarizes the optical properties of the raw water samples and range between source waters. PARAFAC component abundance is calculated as the component loading (F max ) divided by the sum of all component loadings (ΣF max ). Source 18 (Fort Collins) was an outlier in the PARAFAC model. Peak C is defined as the maximum intensity within the range: Excitation = 3-34 nm and Emission = 4-48 nm. Peak C emission wavelength is the emission wavelength at which the maximum intensity is located. Peak C/UV is the Peak C intensity divided by the absorbance at the corresponding excitation wavelength. Table S-2 demonstrates that most of the optical indicators are strongly correlated with one another. Figure S-5 compares the measured DOC removals to those predicted by the Edwards coagulation model 2. 4
5 Table S-1. Summary of raw water characteristics based on optical properties. No. Source DOC (mg/l) SUVA (L mg c -1 m -1 ) PARAFAC Component Abundance (%) C1 C2 C3 C4 C5 C6 FI Peak C Em Wavelength (nm) Specific Peak C (RU L mg c -1 ) Peak C/UV (RU-cm) 1 Betasso WTP % 23% 25% 8% 6% 4% Betasso WTP % 22% 25% 9% 6% 4% Betasso WTP % 21% 22% 9% 7% 6% Betasso WTP % 19% 2% 1% 1% 9% Boulder Reservoir % 11% 14% 19% 17% 13% Boulder Reservoir % 1% 14% 19% 17% 12% Boulder Reservoir % 11% 15% 18% 16% 11% Barr Lake % 19% 8% 16% 23% 13% Jackson Reservoir % 13% 11% 12% 21% 15% Lake Mead, NV % 1% 14% 2% 16% 1% Danville, KY % 19% 17% 11% 12% 4% Red River, ND % 16% 18% 16% 11% 3% Red Lake, MN % 17% 19% 17% 9% 3% Lake Erie, OH % 1% 11% 17% 2% 15% Arvada % 12% 12% 17% 17% 12% Boulder % 12% 14% 18% 15% 1% Evergreen % 18% 21% 12% 11% 5% Fort Collins Grand Junction % 11% 15% 18% 17% 9% Greely-Loveland % 12% 13% 19% 17% 8% Greely-Seaman % 15% 16% 17% 12% 5% Pueblo % 12% 14% 17% 16% 9% Minimum % 1% 8% 8% 6% 3% Maximum % 23% 25% 2% 23% 15%
6 Table S-2. Spearman rank correlation coefficients between compositional optical indicators in raw waters. Only statistically significant (p<.5) relationships are shown. SUVA C1% C2% C3% C4% C5% C6% FI Peak C Em Wavelength Specific Peak C Peak C/UV SUVA NaN C1% NaN C2% NaN C3% NaN C4% NaN C5% NaN C6% NaN FI NaN Peak C Em NaN Specific Peak C NaN -- Peak C/ UV NaN 6
7 7 6 Predicted DOC Removal (%) SUVA > 3 2 < SUVA < 3 SUVA < Measured DOC Removal (%) Figure S-5. Measured DOC removal compared to predicted DOC removal based on Edwards Model. The solid line represents the 1:1 line and the dashed lines are ±15% intervals. 7
8 3. Linear Regression Model Development# Excitation Wavelength (nm) Emission Wavelength (nm) Figure S-6. Wavelength combinations for exported and visually inspected residual plots Figure S-7. Contour plot exhibiting the p-value for the Kolmogorov-Smirnov test for models fit to different wavelength combinations for fully corrected fluorescence data. Value greater than.5 indicates non-normally distributed residuals. 8
9 DOC Removal (%) y=.93x R 2 pred =.85 PIavg=15% Comp Comp 2 y=.76x+.54 R 2 pred =.76 PIavg=18% DOC Removal (%) Comp 3 y=.79x+-.82 R 2 pred =.83 PIavg=15% Comp 4 y=.78x+-.82 R 2 pred =.84 PIavg=15% DOC Removal (%) y=.35x+.29 R 2 pred =.92 Comp 5 PIavg=35% y=.25x+.27 R 2 pred =.36 Comp 6 PIavg=35% Component Removal (%) Component Removal (%) Figure S-8. Regression analyses modeling DOC removal as a function of PARAFAC component removal. The model equation, R 2 pred and PI ag values are reported for each best-fit model. 9
10 Figure S-9. Parameter screening for linear regression (Eqn 5) fit to each wavelength combination for fluorescence data without inner filter corrections as a) Slope parameter estimate, b) Slope parameter p value (significance), c) Intercept parameter estimate, and d) Intercept parameter p value (significance). Figure S-1. Contour plot exhibiting the p-value for the Kolmogorov-Smirnov test for models fit to different wavelength combinations for fluorescence data without inner filter corrections. Value greater than.5 indicates non-normally distributed residuals. 1
11 Figure S-11. Parameter screening for regressions relating the relative decrease in UV absorbance to relative DOC removal at different absorbance wavelengths. Figure S-12. Regression model and diagnostic criteria predicting the relative decrease in DOC from the relative increase in FI. Solid line indicates model prediction, and dashed line indicates the 95% prediction interval. 11
12 Figure S-13. Multiple linear regression model and diagnostic criteria predicting the relative decrease in DOC from the relative decrease in UV 254 and relative increase in FI. Solid line indicates model prediction. Figure S-14. Multiple linear regression model and diagnostic criteria predicting the relative decrease in DOC from the relative decrease in UV 254 and final ph Solid line indicates model prediction. 12
13 4. DOC Removal Prediction based on Raw Water 1 a) C1:C2 1 b) C1:C3 1 c) C1:C DOC Removal (%) at 4 mg/l Alum d) C1:C g) C2:C e) C1:C h) C2:C f) C2:C i) C2:C DOC Removal (%) at 4 mg/l Alum j) C3:C m) C4:C k) C3:C n) C4:C l) C3:C o) C5:C Raw Water Ratio of Component F max values Figure S-15. PARAFAC Component intensity ratios in the raw water related to DOC removal at an alum dose of ~4 mg/l. Two samples were outliers and not included in the relationships (square, hollow markers). 13
14 DOC Removal (%) at 4 mg/l Alum y=3x+-.56 R 2 pred =.34 PIavg=39% Comp Comp 2 y=2.3x PIavg=29% R 2 pred = DOC Removal (%) at 4 mg/l Alum y=3.2x+-.15 R 2 pred =.85 PIavg=16% Comp Comp 4 y=-3x+.76 R 2 pred =.45 PIavg=34% DOC Removal (%) at 4 mg/l Alum Comp y=-3x+.8 R 2 pred =.85 PIavg=16% Component Abundance in Raw Water (%) Comp 6 y=-3.4x+.68 R 2 pred =.4 PIavg=38% Component Abundance in Raw Water (%) Figure S-16. PARAFAC Component abundance in the raw water related to DOC removal at an alum dose of ~4 mg/l. Two samples were outliers and not included in the relationships (square, hollow markers). 14
15 5. References 1. K. R. Murphy, C. A. Stedmon, D. Graeber, and R. Bro, Analytical Methods, 213, 5, M. Edwards, Journal AWWA, 1997, 89,
Assessment of Geosmin Occurrence and Potential Treatment by Advanced Oxidation
Assessment of Geosmin Occurrence and Potential Treatment by Advanced Oxidation Sean MacIsaac, Elliott Wright & Dr. Graham Gagnon Civil and Resource Engineering Dalhousie University Overview Background
More informationDetermination of UV Phototransformation of DOM in Treated Drinking Water by 3D Fluorescence
Determination of UV Phototransformation of DOM in Treated Drinking Water by 3D Fluorescence Aaron D. Dotson 1*, Katherine Beggs 2 and Drew VonLindern 1 1 University of Alaska Anchorage, Civil Engineering
More informationCharacterization of dissolved organic matter in Colorado watersheds: The role of nutrients and algae on DBP formation
Characterization of dissolved organic matter in Colorado watersheds: The role of nutrients and algae on DBP formation Amanda Hohner, Alia Khan, Diane McKnight, R. Scott Summers, and Fernando Rosario-Ortiz
More informationUse of Physicochemical Changes in NOM to Evaluate THM. Formation During Snowmelt, After Wildfires, and in Pre- Ozonation Water Treatment
Use of Physicochemical Changes in NOM to Evaluate THM The Relationship of Size, Polarity and THMFP of DOC in Northern Colorado Watersheds Formation During Snowmelt, After Wildfires, and in Pre- Ozonation
More informationJournal of Environmental Sciences 19(2007)
Journal of Environmental Sciences 19(2007) 787 791 Composition analysis of colored dissolved organic matter in Taihu Lake based on three dimension excitation-emission fluorescence matrix and PARAFAC model,
More informationSupporting Information. The effects of iron on optical properties of dissolved organic matter
1 1 Supporting Information 2 3 4 The effects of iron on optical properties of dissolved organic matter 5 6 7 8 9 Brett A. Poulin 1, Joseph N. Ryan 1, and George R. Aiken 2 * 1 Department of Civil, Environmental
More informationFluorescence-Enhanced Treatment Process Optimization
Fluorescence-Enhanced Treatment Process Optimization Christopher Miller, PE Associate Professor Civil Engineering AWWA Conference October 29, 2015 Acknowledgements 2014 Headlines 2015 Headlines 2015 Headlines
More informationSupplementary Figure 1 - Excitation-emission-matrix (3D-EEM) for a 3/2 mixture
Supplementary Figure 1 - Excitation-emission-matrix (3D-EEM) for a 3/2 mixture of DOC isolated from a laboratory algal culture and river water. This mixture was created so that the algal (Ex 280 nm, Em
More informationAssessing Trichloromethane Formation and Control in Algal-Stimulated Waters Amended With Nitrogen and Phosphorus
University of Arkansas, Fayetteville ScholarWorks@UARK Theses and Dissertations 12-2013 Assessing Trichloromethane Formation and Control in Algal-Stimulated Waters Amended With Nitrogen and Phosphorus
More informationSTAT 2300: Unit 1 Learning Objectives Spring 2019
STAT 2300: Unit 1 Learning Objectives Spring 2019 Unit tests are written to evaluate student comprehension, acquisition, and synthesis of these skills. The problems listed as Assigned MyStatLab Problems
More informationSYSTEMATIC APPROACH TO WATER TREATMENT PLANT PROCESS OPTIMIZATION
SYSTEMATIC APPROACH TO WATER TREATMENT PLANT PROCESS OPTIMIZATION Alex Yavich, Ph.D., P.E. Optimization Solutions Environmental, LLC WATERCON 2012 Optimization Solutions Environmental, LLC Water Treatment
More informationHighly efficient detection of hydrogen peroxide in solution and in the vapor phase via fluorescence quenching
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information for Highly efficient detection of hydrogen peroxide in solution
More information4.3 Nonparametric Tests cont...
Class #14 Wednesday 2 March 2011 What did we cover last time? Hypothesis Testing Types Student s t-test - practical equations Effective degrees of freedom Parametric Tests Chi squared test Kolmogorov-Smirnov
More informationWater quality sensing with a simultaneous UV-VIS absorbance & fluorescence excitation-emission mapping sensor
Water quality sensing with a simultaneous UV-VIS absorbance & fluorescence excitation-emission mapping sensor Adam M. Gilmore, Ph.D. HORIBA Instruments Inc. 3880 Park Avenue Edison, NJ 08820 Email: adam.gilmore@horiba.com
More informationOptical Properties of CdSe Nanocrystals
UC Berkeley College of Chemistry Chemistry 125 Physical Chemistry Laboratory Optical Properties of CdSe Nanocrystals Author: Jonathan Melville Lab Partner: David Gygi Graduate Student Instructor: Marieke
More informationImproved Jar Testing Optimization with TOC Analysis. Dondra Biller, PhD GE Analytical Instruments Boulder, CO
Improved Jar Testing Optimization with TOC Analysis Dondra Biller, PhD GE Analytical Instruments Boulder, CO Outline of Presentation 1. What is total organic carbon (TOC)? 2. Importance of jar testing
More informationOPTIMISING PAC DOSING TO REMOVE MIB AND GEOSMIN IN FOUR ADELAIDE METROPOLITAN WATER TREATMENT PLANTS. David Cook
OPTIMISING PAC DOSING TO REMOVE MIB AND GEOSMIN IN FOUR ADELAIDE METROPOLITAN WATER TREATMENT PLANTS Paper Presented by: David Cook Authors: David Cook, Australian Water Quality Centre - SA Gayle Newcombe,
More informationAngélique Goffin, Sabrina Guérin, Vincent Rocher, Gilles Varrault
Excitation-emission matrix Fluorescence spectroscopy to assess quality and quantity of dissolved organic matter in the Seine River from the upstream to the downstream of the Paris agglomeration during
More informationA simple model for low flow forecasting in Mediterranean streams
European Water 57: 337-343, 2017. 2017 E.W. Publications A simple model for low flow forecasting in Mediterranean streams K. Risva 1, D. Nikolopoulos 2, A. Efstratiadis 2 and I. Nalbantis 1* 1 School of
More informationChapter 10 Regression Analysis
Chapter 10 Regression Analysis Goal: To become familiar with how to use Excel 2007/2010 for Correlation and Regression. Instructions: You will be using CORREL, FORECAST and Regression. CORREL and FORECAST
More informationBiodegradation Of Catchment Source Organic Matter In
Biodegradation Of Catchment Source Organic Matter In Riverine Environments Merissa Marius 1, Adrian Collins 2, Anne Stringfellow 1, David Sear 3, David Smallman 1 1 Civil Engineering and the Environment,
More informationLake transparency: a window into decadal variations in dissolved organic carbon concentrations in Lakes of Acadia National Park, Maine
Lake transparency: a window into decadal variations in dissolved organic carbon concentrations in Lakes of Acadia National Park, Maine Collin Roesler Department of Earth and Oceanographic Science, Bowdoin
More informationIn situ semi-quantitative assessment of single cell viability by resonance
Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information (ESI) In situ semi-quantitative assessment
More informationSpecial Publication SJ2004-SP22 St. Johns River Water Supply Project Surface Water Treatment and Demineralization Study
Special Publication SJ2004-SP22 St. Johns River Water Supply Project Surface Water Treatment and Demineralization Study Preliminary Raw Water Characterization TECHNICAL MEMORANDUM PRELIMINARY RAW WATER
More informationCharacterizing the Interaction between Trace Metal and Dissolved Organic Matter from the Florida Coastal Everglades
Characterizing the Interaction between Trace Metal and Dissolved Organic Matter from the Florida Coastal Everglades Rudolf Jaffé and Youhei Yamashita Southeast Environmental Research Center & Department
More informationSpatial and temporal variations and factors controlling the concentrations of hydrogen peroxide and organic peroxides in rivers
Accessory publication Spatial and temporal variations and factors controlling the concentrations of hydrogen peroxide and organic peroxides in rivers Khan M. G. Mostofa A,B and Hiroshi Sakugawa B,C A State
More informationPaula Bontempi. University of Southern Mississippi, Department of Marine Science, 1020 Balch Blvd, Stennis Space Center, MS
TRANSFORMATION OF ALLOCHTHONOUS DISSOLVED ORGANIC CARBON IN A TROPICAL BLACKWATER RIVER AS :MEASURED BY FLUORESCENCE ANALYSIS: APPLICATION TO FOODWEB ECOLOGY Paula Bontempi. University of Southern Mississippi,
More informationIMPACT OF NOM AND NITRATE ON THE FEASIBILITY OF UV/H O 2 2 TREATMENT FOR ORGANIC MICROPOLLUTANT CONTROL
IMPACT OF NOM AND NITRATE ON THE FEASIBILITY OF UV/H O 2 2 TREATMENT FOR ORGANIC MICROPOLLUTANT CONTROL Bram J. Martijn PWN Water Supply Company North Holland James P. Malley University of New Hampshire
More informationNatural organic matter in drinking water Ontario Water Works Association Water Treatment Seminar March 20, 2018
Natural organic matter in drinking water Ontario Water Works Association Water Treatment Seminar March 20, 2018 Judy MacDonald, P. Eng. Water Quality Engineer Materials and Treatment Section Water and
More informationRelationships Between Disinfection Byproducts and Dissolved Organic Matter in Drinking Water
Relationships Between Disinfection Byproducts and Dissolved Organic Matter in Drinking Water Meng-Horng (Chris) Hsu, I. H. (Mel) Suffet Environmental Science and Engineering Program UCLA Los Angeles, CA
More informationBerberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) Berberine as a novel light-up i-motif fluorescence ligand
More informationUsing Empower SystemsQT Qualification Tool
Using Empower SystemsQT Qualification Tool for Waters Modular HPLC Systems A summary of Empower SystemsQT Qualification Tool features and benefits, with emphasis on the technical attributes of the qualification
More informationMOLECULAR COMPOSITION AND OPTICAL PROPERTIES OF NATURAL ORGANIC MATTER: CORRELATING BULK SPECTROSCOPY AND ULTRAHIGH RESOLUTION MASS SPECTROMETRY
MOLECULAR COMPOSITION AND OPTICAL PROPERTIES OF NATURAL ORGANIC MATTER: CORRELATING BULK SPECTROSCOPY AND ULTRAHIGH RESOLUTION MASS SPECTROMETRY CLIMATE CHANGE AND DOM IN PEATLANDS William T. Cooper*,
More informationDisinfectant dosing of blended drinking waters
18 th World IMACS / MODSIM Congress, Cairns, Australia 13-17 July 2009 http://mssanz.org.au/modsim09 Disinfectant dosing of blended drinking waters van Leeuwen, J. 1,3, D. Cook 2, C. Chow 1,2,3 and M.
More informationUV254 Go! Measurement and Calibration of BOD against the BOD five day test
1 st October 18 UV254 Go! Measurement and Calibration of BOD against the BOD five day test Tools Needed Photonic Measurements UV254 Go! Quartz Cuvettes Distilled water BOD 5day testing system such as BODTrak
More informationand Forecasting CONCEPTS
6 Demand Estimation and Forecasting CONCEPTS Regression Method Scatter Diagram Linear Regression Regression Line Independent Variable Explanatory Variable Dependent Variable Intercept Coefficient Slope
More informationSECTION 11 ACUTE TOXICITY DATA ANALYSIS
SECTION 11 ACUTE TOXICITY DATA ANALYSIS 11.1 INTRODUCTION 11.1.1 The objective of acute toxicity tests with effluents and receiving waters is to identify discharges of toxic effluents in acutely toxic
More informationSupplementary Materials for
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2019 Supplementary Materials for Bimolecular Proximity of Ruthenium Complex and Methylene Blue
More informationCharacterizing dissolved organic matter fluorescence with parallel factor analysis: a tutorial
LIMNOLOGY and OCEANOGRAPHY: METHODS Limnol. Oceanogr.: Methods 6, 2008, 572 579 2008, by the American Society of Limnology and Oceanography, Inc. Characterizing dissolved organic matter fluorescence with
More informationalamarblue Technical Datasheet
alamarblue Technical Datasheet Bio-Rad Laboratories Endeavour House, Langford Lane, Kidlington, Oxford, OXON OX5 1GE, UK antibody_sales_uk@bio-radcom Tel: +44 () 1865 8527 Copyright Bio-Rad Laboratories,
More informationSeasonal Source Water Quality and Treatment Challenges Town of Newburgh s Chadwick Lake Filtration Plant
Seasonal Source Water Quality and Treatment Challenges Town of Newburgh s Chadwick Lake Filtration Plant Clayton Johnson GHD Kevin Castro GHD James Osborne Town of Newburgh Image placeholder Outline Introduction
More informationOhio EPA HAB Update. OTCO Workshop March 7, Heather Raymond Ohio EPA HAB Coordinator
Ohio EPA HAB Update OTCO Workshop March 7, 2018 Heather Raymond Ohio EPA HAB Coordinator Ohio EPA HAB Update 2017 HAB Monitoring Overview Cyanotoxin Treatment: Treatment technique rule requirements, CPE
More informationUsing fluorescence for rapid wastewater presence detection in sources of drinking water
Using fluorescence for rapid wastewater presence detection in sources of drinking water Nicolas Peleato, Robert C. Andrews, Ray L. Legge* Department of Civil Engineering, University of Toronto and *Department
More informationTrophic roles determine coral reef fish community size structure
Supplementary Material Trophic roles determine coral reef fish community size structure James P.W. Robinson 1, Julia K. Baum 2 1 Department of Biology, University of Victoria, PO BOX 1700 Station CSC,
More informationFacile Preparation of Low Cytotoxicity Fluorescent Carbon Nanocrystals by. Electrooxidation of Graphite
Supporting Information for Facile Preparation of Low Cytotoxicity Fluorescent Carbon Nanocrystals by Electrooxidation of Graphite Qiao-Ling Zhao, Zhi-Ling Zhang, Bi-Hai Huang, Jun Peng, Min Zhang, Dai-Wen
More informationUse of Organic Characterization Techniques to Monitor Advanced Oxidation Processes in Water Reuse And Wastewater Treatment
Use of Organic Characterization Techniques to Monitor Advanced Oxidation Processes in Water Reuse And Wastewater Treatment G-0005-stock-2010 Template Final.ppt Ben Stanford Aleks Pisarenko Dan Gerrity
More informationSupporting Information
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Mechanochromism and aggregation induced emission in benzothiazole substituted
More informationTECHNICAL NOTE THE NEXT GENERATION OF MICROPLATES
TECHNICAL NOTE TN0002: Optimiser Microplate System (ELISA) Setup Guide on the BioTek FLx800 Fluorescence Microplate Reader THE NEXT GENERATION OF MICROPLATES Better Immunoassays through Innovative Microfluidics
More informationRaman Spectroscopy for Pharmaceutical Applications
Spectroscopy Solutions 2014 E conference Raman Spectroscopy for Pharmaceutical Applications Frederick H. Long, Ph.D. President, Spectroscopic Solutions, LLC History of Raman Spectroscopy Discovery of Raman
More informationSupporting Information for. Conjugated polymer composite artificial muscle with solvent-induced anisotropic mechanical actuation
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry A. This journal is The Royal Society of Chemistry 2014 Supporting Information for Conjugated polymer composite artificial muscle
More informationSuper-marketing. A Data Investigation. A note to teachers:
Super-marketing A Data Investigation A note to teachers: This is a simple data investigation requiring interpretation of data, completion of stem and leaf plots, generation of box plots and analysis of
More informationCalculation of BLM Fixed Monitoring Benchmarks for Copper at Selected Monitoring Sites in Colorado
Prepared by HydroQual, Inc. for the US Environmental Protection Agency Calculation of BLM Fixed Monitoring Benchmarks for Copper at Selected Monitoring Sites in Colorado Final Report October 10, 2008 GLEC.030.004.01.001
More informationPreliminary Investigation of Near Infrared Spectroscopy for Green Sand Component Identification
Preliminary Investigation of Near Infrared Spectroscopy for Green Sand Component Identification Dr. Scott R. Giese University of Northern Iowa Research Objective Green sand molding characterization for
More informationA Method to Determine Biodegradable Dissolved Organic Nitrogen in Water ND 58108, USA
A Method to Determine Biodegradable Dissolved Organic Nitrogen in Water Tanush Wadhawan a, Halis Simsek a, Murthy Kasi a, Kristofer Knutson b, John McEvoy c, Birgit Pruess c and Eakalak Khan a* a Department
More informationAssessment of nanoparticles safety: corrected absorbance-based toxicity test
Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 7 Supplementary information Assessment of nanoparticles safety: corrected absorbance-based toxicity test
More informationRobert T. Shoaf, P.E., BCEE Presented by John Krinks, PE
Nitrate and/or TOC Removal by RO Membranes, Anion Exchange and GAC Case Studies Robert T. Shoaf, P.E., BCEE Presented by John Krinks, PE 52 nd Annual OTCO Water Workshop Columbus, OH March 4 th -5 th,
More informationInvestigator: July 2002
KINETIC-BASED MODELS FOR BROMATE FORMATION IN NATURAL WATERS USEPA GRANT # R 826835-01-0 FINAL REPORT EXECUTIVE SUMMARY Investigator: Paul Westerhoff, Ph.D., PE Associate Professor Department of Civil
More informationInvestigation of dendrimers functionalized with eosin as macrophotoinitiators for polymerization-based signal amplification reactions
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Supporting Information Investigation of dendrimers functionalized with eosin as macrophotoinitiators
More informationMarine Chemistry. Piotr Kowalczuk a,, William J. Cooper b, Michael J. Durako c, Amanda E. Kahn c, Michael Gonsior b, Heather Young c
Marine Chemistry 118 (2010) 22 36 Contents lists available at ScienceDirect Marine Chemistry journal homepage: www.elsevier.com/locate/marchem Characterization of dissolved organic matter fluorescence
More informationFusion Analytical Method Validation
Fusion QbD Software Platform Fusion Analytical Method Validation The Only Software That Has It All! 100% aligned with FDA/ICH Quality by Design (QbD) guidances! Can be used for LC and Non-LC methods (e.g.
More informationLab 6 Measurement of Ozone
Georgia Institute of Technology School of Earth and Atmospheric Sciences EAS 4641 Spring 2008 Lab 6 Measurement of Ozone Purpose of Lab 6: In this lab you will measure the ambient concentration of ozone
More informationElectronic Supplementary Material (ESI) for Journal of Materials Chemistry This journal is The Royal Society of Chemistry 2011.
Experimental: MTT assay: To determine cell viability the colorimetric MTT metabolic activity assay was used. Hela cells (1 10 4 cells/well) were cultured in a 96-well plate at 37 C, and exposed to varying
More informationEnhanced biodegradation of carbamazepine after UV/H 2 O 2 advanced. oxidation
Supporting Information for the Environmental Science and Technology article: Enhanced biodegradation of carbamazepine after UV/H 2 O 2 advanced oxidation Prepared for submission to Environmental Science
More informationMeasurement of Enzyme Kinetics by UV-Visible Spectroscopy
UV-0002 UV-Visible Spectroscopy Introduction Enzyme activity is frequently investigated in the medicinal, biochemistry, and food science research fields to elucidate the rate of which reaction occurs and
More informationIndicators of Hydrologic Alteration (IHA) software, Version 7.1
Indicators of Hydrologic Alteration (IHA) software, Version 7.1 IHA Software Analyzes hydrologic characteristics and their changes over time. Computes 67 ecologicallyrelevant flow statistics using daily
More informationAGGGCTCACTCCAGCCTCCAG AGGGGAGGGATGAAGTGATGGG TGCTGGAGCCCGAGTGGGAA TGCCGCACGAAGCTAGCCAT ATCCAGGGAGCAGCGAGCCAA CCGCCTTGTCATGGGTGTGCT
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2015 Sarvesh Varma, Joel Voldman* Supplemental Information PCR Primers The following table lists
More informationWatershed Characteristics and Sediment PAH Contribution from Coal-Tar Sealant EVAN DART CE 394K UNIVERSITY OF TEXAS AT AUSTIN
2014 Watershed Characteristics and Sediment PAH Contribution from Coal-Tar Sealant EVAN DART CE 394K UNIVERSITY OF TEXAS AT AUSTIN I. Introduction The increase in urbanization in the United States has
More informationSide by Side Piloting of Process Alternatives Yields Direct Performance Comparison
OBG PRESENTS: OBG PRESENTS: Side by Side Piloting of Process Alternatives Yields Direct Performance Comparison LORI W. REID, P.E. New York State AWWA Spring Meeting, April 26, 2017 Outline Background Project
More informationFuel Fluorescence Logging using the Optical Image Profiler (OIP)
Fuel Fluorescence Logging using the Optical Image Profiler (OIP) Note: A Patent is Pending for this System. Daniel Pipp Chemist, Geoprobe Systems Presented May 2017 at the Battelle Bioremediation Symposium
More informationDynamics of Energy Transfer in Large. Plasmonic Aluminum Nanoparticles
Supporting Information Dynamics of Energy Transfer in Large Plasmonic Aluminum Nanoparticles Kenneth J. Smith,#, Yan Cheng,#, Ebuka S. Arinze,#, Nicole E. Kim, Arthur E. Bragg, Susanna M. Thon Department
More informationAnthropogenic Influences of Paved Runoff and Sanitary Sewage on the Dissolved
Support Information (SI) File Title Anthropogenic Influences of Paved Runoff and Sanitary Sewage on the Dissolved Organic Matter Quality of Wet Weather Overflows: An Excitation-Emission Matrix Parallel
More informationTarrant Regional Water District Water Quality Trend Analysis Final Report Executive Summary. July 2011
Tarrant Regional Water District Water Quality Trend Analysis 1989-2009 Final Report Executive Summary July 2011 Prepared for Tarrant Regional Water District 201 North Shore Drive Fort Worth, TX 76135 Phone:
More informationExperiment 18 Determination of Iron by Visible Spectrophotometry
Experiment 18 Determination of Iron by Visible Spectrophotometry PRELAB DISCUSSION Visible spectrophotometry (spectral analysis) is a method of measuring the concentration of colored solutions by the amount
More informationPerformance of the Sievers 500 RL On-Line TOC Analyzer
GE Water & Process Technologies Analytical Instruments Performance of the Sievers 500 RL On-Line TOC Analyzer imagination at work Page 2 of 10 Introduction To determine the performance characteristics
More informationDeclaration. All substantive contributions by others to the worked presented, including jointly authored publications, is clearly acknowledged.
High performance size exclusion chromatography with a multiple wavelength absorbance detector for improved dissolved organic matter characterisation and water quality monitoring Huiping Huang School of
More informationOVERVIEW OF ELECTRIC COST OF SERVICE STUDIES
The Prime Group Priority Cost of Service, Rate & Regulatory Support OVERVIEW OF ELECTRIC COST OF SERVICE STUDIES By: Larry Feltner There are a number of considerations in determining the level and structure
More informationResearch Article Estimation of Biochemical Oxygen Demand Based on Dissolved Organic Carbon, UV Absorption, and Fluorescence Measurements
Chemistry Volume 1, Article ID 79, 9 pages http://dx.doi.org/1.11/1/79 Research Article Estimation of Biochemical Oxygen Demand Based on Dissolved Organic Carbon, UV Absorption, and Measurements Jihyun
More informationMinuscule weight percent of graphene oxide and reduced graphene oxide modified Ag 3 PO 4 : New insight into improved photocatalytic activity
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2016 Supporting Information Minuscule
More informationYour Analyte ELISA Kit Instruction
NovaTeinBio FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC PURPOSES Your Analyte ELISA Kit Instruction Intended use The kit is used to detect the level of Your analyte in cell culture, serum blood plasma and
More informationA facile and fast method for quantitating lignin in lignocellulosic biomass using acidic
Electronic Supplementary Material (ESI) for Green Chemistry. This journal is The Royal Society of Chemistry 2016 Electronic Supporting Information (ESI) A facile and fast method for quantitating lignin
More informationAustin Peters, PE, MWH
Presented at PNWS-AWWA Annual Conference Spokane, Washington May 9, 2013 Austin Peters, PE, MWH Co-Authors: Jennifer Gelmini, PE, MWH Michael McWhirter, MWH Michael Price, PE, MWH Peter Kreft, PE, MWH
More informationCategorical Predictors, Building Regression Models
Fall Semester, 2001 Statistics 621 Lecture 9 Robert Stine 1 Categorical Predictors, Building Regression Models Preliminaries Supplemental notes on main Stat 621 web page Steps in building a regression
More informationFROM: Dan Rubado, Evaluation Project Manager, Energy Trust of Oregon; Phil Degens, Evaluation Manager, Energy Trust of Oregon
September 2, 2015 MEMO FROM: Dan Rubado, Evaluation Project Manager, Energy Trust of Oregon; Phil Degens, Evaluation Manager, Energy Trust of Oregon TO: Marshall Johnson, Sr. Program Manager, Energy Trust
More informationCHARACTERIZATION OF WATER CHEMISTRY AND DIDYMOSPHENIA GEMINATA GROWTH IN BOULDER CREEK RACHEL A. MCLOUGHLIN
CHARACTERIZATION OF WATER CHEMISTRY AND DIDYMOSPHENIA GEMINATA GROWTH IN BOULDER CREEK By RACHEL A. MCLOUGHLIN B.S. Environmental Studies, Randolph-Macon College, 2006 A thesis submitted to the Faculty
More informationAPPENDIX III SAMPLE LAB REPORT. Experiment 1. High Performance Liquid Chromatography. Alfred E. Neuman
APPENDIX III SAMPLE LAB REPORT Experiment 1 High Performance Liquid Chromatography Alfred E. Neuman Chemistry 436 September 15, 1999 INTRODUCTION In this experiment, high performance liquid chromatography
More informationZu-Tao Ou-Yang Center for Global Change and Earth Observation Michigan State University
Zu-Tao Ou-Yang Center for Global Change and Earth Observation Michigan State University Ocean Color: Spectral Visible Radiometry Color of the ocean contains latent information on the water qualitycdom,
More informationA Versatile Method for Quantification of DNA and PCR Products Based on Timeresolved
A Versatile Method for Quantification of DNA and PCR Products Based on Timeresolved Eu III Luminescence Bo Song, a Caroline D. B. Vandevyver, a,1 Emmanuel Deiters, a Anne-Sophie Chauvin, a Ilkka Hemmilä,
More informationStatistics 201 Summary of Tools and Techniques
Statistics 201 Summary of Tools and Techniques This document summarizes the many tools and techniques that you will be exposed to in STAT 201. The details of how to do these procedures is intentionally
More informationFormation of Disinfection By-products during Ballast. Water Treatment with Ozone, Chlorine, and Peracetic. Acid: Influence of Water Quality Parameters
Electronic Supplementary Material (ESI) for Environmental Science: Water Research & Technology. This journal is The Royal Society of Chemistry 215 Supporting Information for: Formation of Disinfection
More informationU.S. Geological Survey, Fort Collins, Colorado 80523, USA; 2 Texas
1 2 Linking the Agricultural Landscape of the Midwest to Stream Health with Structural Equation Modeling. 3 4 AUTHORS Travis S. Schmidt 1*, Peter C. Van Metre 2, Daren M. Carlisle 3 5 6 7 1 tschmidt@usgs.gov,
More informationResponse of Seismically Isolated Bridges Considering Variation in the Mechanical Properties of Individual Isolators
..1.... Response of Seismically Isolated Bridges Considering Variation in the Mechanical Properties of Individual Isolators Gordon Warn Graduate Research Assistant, Department of Civil Structural and Environmental
More informationEXPERIMENT 5. Molecular Absorption Spectroscopy: Determination of Iron with 1,10-Phenanthroline
EXPERIMENT 5 Molecular Absorption Spectroscopy: Determination of Iron with 1,10-Phenanthroline UNKNOWN Submit a clean, labeled 100-mL volumetric flask to the instructor so that your unknown iron solution
More informationQuartz Glass for Optics Data and Properties
Quartz Glass for Optics Data and Properties Technical Properties Internal transmission (%) Values of pure transmissions of a 10 mm thick sample for selected UV-Wavelengths. Wavelength nm Suprasil ArF/
More informationAttachment E2. Drought Indices Calculation Methods and Applicability to Colfax County
Attachment E2 Drought Indices Calculation Methods and Applicability to Colfax County Attachment E2. Drought Indices Methodology and Applicability to Colfax County E2.1 Palmer Drought Severity Index E2.1.1
More informationGOOD LABORATORY PRACTICE Agilent Cary 8454 UV-Visible Spectroscopy System
GOOD LABORATORY PRACTICE Agilent Cary 8454 UV-Visible Spectroscopy System Introduction The objective of good laboratory practice (GLP) is to obtain accurate and precise results, using a measurement system
More informationSeasonal variation of colored dissolved organic matter in the Nelson Estuary, Hudson Bay
Seasonal variation of colored dissolved organic matter in the Nelson Estuary, Hudson Bay C. Guéguen 1, A. Perroud 1, G. McCullough 2, D. G. Barber 2 1 Department of Chemistry, Trent University 2 Centre
More informationOur Solutions for Protein Analysis
Our Solutions for Protein Analysis www.horibalifesciences.com info.sci@horiba.com Solutions for Protein Characterization Kinetics Proteins are involved in many critical roles in the body: Enzymes - allow
More informationThe Influence of Watershed Land Use on the Composition of Dissolved Organic Matter Entering Conesus Lake, NY
The Influence of Watershed Land Use on the Composition of Dissolved Organic Matter Entering Conesus Lake, NY Morgan R. Bida, Todd Pagano, A. Christina Tyler Program in Environmental Sciences School of
More informationSEES 503 SUSTAINABLE WATER RESOURCES. Floods. Instructor. Assist. Prof. Dr. Bertuğ Akıntuğ
SEES 503 SUSTAINABLE WATER RESOURCES Floods Instructor Assist. Prof. Dr. Bertuğ Akıntuğ Civil Engineering Program Middle East Technical University Northern Cyprus Campus SEES 503 Sustainable Water Resources
More information