Big Data & (Financal) Networks

Size: px
Start display at page:

Download "Big Data & (Financal) Networks"

Transcription

1 Big Data & (Financal) Networks Daniele Tantari Scuola Normale Superiore, Pisa October 11, /19

2 Motivations I Big data: big opportunities together with technological, methodological and conceptual new challenges. I Extract informations in a sea of noise. I Complex Networks representation of data: the role of the interactions, beyond individuality I From macro to micro: Classification and Prediction. 2/19

3 Financial networks: general tasks I Finance provides a large set of situations where networks are present or can be constructed from data. I Examples: interbank networks, trading networks, payment networks, shareholder networks, control networks, etc, I Many other examples comes from time series: Correlation networks, Partial correlation networks, Granger causality networks, etc. I Prediction on Nodes: signal propagation (risk/default), central nodes, network vulnerability I Prediction on Links: network formation/evolution, reconstruction from partial observations, recommendation systems. 3/19

4 Financial networks: outline of the talk In this presentation I will discuss some financial applications to: I Local risk vs Global network properties with an application to the study of Unicredit payments network. Prediction on nodes I Temporal networks and link forecasting with an application to preferential trading in interbank networks Prediction on links 4/19

5 Payment Network and Credit Risk Rating (E. Letizia and F. Lillo) 5/19

6 THE CORPORATE PAYMENT NETWORK Source: Unicredit Large proprietary dataset of payments between Italian firms: 2.4M companies, 47M payments in Includes information on risk rating for a large fraction of companies. 6 / 19

7 Is the position of a company in the payment network informative on its riskiness beyond its local properties? Company B Company D Company A Company C Low Risk Medium Risk High Risk Company E Company I Company H Company G Company F I How much are your neighbours informative on your risk? I What is the relation between the macro organization of the network and the risk distribution? 7/19

8 Degree Strong relation between degree and risk. Assortativity Using the three risk classes P i B = e ii a i b P i 1 i a ib i where e ij is the fraction of edges connecting vertices of type i and j, a i = P j e ij and b j = P i e ij. Homophily of risk. B > 0: neighbours of firms in the payment network tend to have similar risk profile. 8/19

9 Ranking hierarchical organization I Strong hierarchical structure of the payment network: data driven supply chains identification. I A high risk concentration in low class nodes (top of the hierarchy) could trigger a cascade of distress in the higher rank classes. Machine Learning risk classifier! I Evaluation of new clients from partial informations. I New measure of risk based on network properties. 9/19

10 Random models for temporal networks and link forecasting (with P. Mazzarisi, P. Barucca, and F. Lillo) 10 / 19

11 Research question Many networks are inherently dynamic as links are created and destroyed through time. I Preferential relations between nodes tend to preserve past links (If we were friends yesterday we will be friend today). I Node specific properties can drive the evolution of the network topology (Two social persons are more likely to be friend). We propose a novel methodology for modelling temporal networks subject to link persistence and time-varying node characteristics and disentangling their role. I How the node characteristic and the preferential trading shape a financial network and how to account for the two linking mechanisms in a statistical model of temporal networks? I A proper modeling of network dynamics allows performing short term link prediction. 11 / 19

12 Link persistence I We model the tendency of a link that does (or does not) exist at time t 1 to continue existing (or not existing) at time t. I Discrete AutoRegressive DAR(1) model P(A t A t 1,, )= Y i,j>i ij I A t ij A t 1 +(1 ij ) At ij ij (1 ij) 1 At ij ij I The larger is ij,themorepersistentisthelinkbetweeni and j. 12 / 19

13 Fitness dynamics I The dynamic parameter i t (fitness) of node i is latent and describes its tendency in creating links. I We extend the fitness model to the dynamic case. I We model it as a hidden Markov chain 13 / 19

14 Fitness dynamics (2) I Each node i is characterized by a quantity i t,i.e.thenode fitness. We assume that it follows an AR(1) process, t i = 0,i + 1,i t 1 i + t i 0,i 2 R, 1,i < 1and t i NID(0, i) with i > 0. I We define the link probability at time t as: P(A t ij =1 t i, t j )= e( t i + t j ) 1+e ( t i + t j ) I The larger i t node i. is, the larger is the probability for all links incident to 14 / 19

15 Dynamic fitness + link persistence We combine the hidden dynamics of (fitness) with the mechanism of copying from the past (link persistence). 15 / 19

16 Empirical results We investigate two aspects: I How strong is preferential trading between two banks, when their propensity to trade is accounted for (using fitness)? I Link prediction. The investigated database is the electronic Market of Interbank Deposit (e-mid), an electronic segment of Italian interbank market. We focus on the time series of weekly aggregated, unweighted, and directed adjacency matrix A t : A t ij =1ifbanki lends money at least once to bank j during the week t. 16 / 19

17 What is fitness measuring? EURO (mln) Bank exposure for lender '3' bank exposure δ e θ 3,t 0 Aug 2012 Feb 2013 Aug 2013 Feb 2014 Aug 2014 Feb 2015 I Correlations between x t i e t i and the bank s exposure in the weighted network; I We obtain information on the weighted e-mid network having only the binary information. Disentangle random and preferential trading I The DAR(1) model that does not account for time evolving network topology (fitness), tends to overestimate link stability. I Statistical validation of preferential trading against the null (only fitness) DAR-TGRG DAR(1) α ij 17 / 19

18 Out-of-sample link prediction for e-mid Sensitivity TGRG (AUC 0.83) DAR-TGRG (AUC 0.85) DAR(1) (AUC 0.80) Specificity AUC TGRG DAR-TGRG DAR(1) threshold value for α ij I Out of sample analysis for the e-mid interbank market. I DAR-TGRG outperforms TGRG and DAR(1) network models. I In average, network topology is more important than link stability for link prediction in e-mid. 18 / 19

19 Conclusions I Financial networks are a powerful tool to study the (dynamic) interaction of a large set of financial agent. I Financial networks are the channels of propagation of risk. Interesting interplays between idiosyncratic risk and local or global network topology I Random network models are a powerful tool for I I Modeling temporal networks and forecasting links Inference of large scale network structures 19 / 19

arxiv: v2 [cs.si] 23 Jan 2018

arxiv: v2 [cs.si] 23 Jan 2018 Corporate payments networks and credit risk rating Elisa Letizia a,, Fabrizio Lillo a,b a Scuola Normale Superiore, piazza dei Cavalieri 7, 56126, Pisa, Italy b Department of Mathematics, University of

More information

The effect of Product Ratings on Viral Marketing CS224W Project proposal

The effect of Product Ratings on Viral Marketing CS224W Project proposal The effect of Product Ratings on Viral Marketing CS224W Project proposal Stefan P. Hau-Riege, stefanhr@stanford.edu In network-based marketing, social influence is considered in order to optimize marketing

More information

Business Network Analytics

Business Network Analytics Business Network Analytics Sep, 2017 Daning Hu Department of Informatics University of Zurich Business Intelligence Research Group F Schweitzer et al. Science 2009 Research Methods and Goals What Why How

More information

Community Level Topic Diffusion

Community Level Topic Diffusion Community Level Topic Diffusion Zhiting Hu 1,3, Junjie Yao 2, Bin Cui 1, Eric Xing 1,3 1 Peking Univ., China 2 East China Normal Univ., China 3 Carnegie Mellon Univ. OUTLINE Background Model: COLD Diffusion

More information

Utilising Deep Learning and Genome Wide Association Studies for Epistatic-Driven Preterm Birth Classification in African-American Women

Utilising Deep Learning and Genome Wide Association Studies for Epistatic-Driven Preterm Birth Classification in African-American Women Utilising Deep Learning and Genome Wide Association Studies for Epistatic-Driven Preterm Birth Classification in African-American Women Paul Fergus, Casimiro Curbelo Montañez, Basma Abdulaimma, Paulo Lisboa,

More information

Generative Models for Networks and Applications to E-Commerce

Generative Models for Networks and Applications to E-Commerce Generative Models for Networks and Applications to E-Commerce Patrick J. Wolfe (with David C. Parkes and R. Kang-Xing Jin) Division of Engineering and Applied Sciences Department of Statistics Harvard

More information

Op Risk In A Post AMA World

Op Risk In A Post AMA World Op Risk In A Post AMA World Using Risk Appetite Metrics To Steer The Operational Risk Profile Of The Business Gabriele Maucci Head of Operational and Reputational Risks Roma, 22 nd June 6 A metric known

More information

arxiv: v3 [physics.soc-ph] 22 Mar 2017

arxiv: v3 [physics.soc-ph] 22 Mar 2017 Newcomers vs. incumbents: How firms select their partners for R&D collaborations arxiv:1403.3298v3 [physics.soc-ph] 22 Mar 2017 Antonios Garas, Mario V. Tomasello, and Frank Schweitzer Chair of Systems

More information

Targeting Individuals to Catalyze Collective Action in Social Networks

Targeting Individuals to Catalyze Collective Action in Social Networks Targeting Individuals to Catalyze Collective Action in Social Networks Marco A. Janssen 1 1 Center for the Study of Institutional Diversity School of Human Evolution and Social Change Arizona State University

More information

A structured neural network to forecast the Korean electricity load. Junghwan Jin Jinsoo Kim

A structured neural network to forecast the Korean electricity load. Junghwan Jin Jinsoo Kim A structured neural network to forecast the Korean electricity load Junghwan Jin Jinsoo Kim 1. Introduction 2. Data 3. Method 4. Results 5. Conclusion 1. Introduction Electricity load forecasting has been

More information

Assortativity Patterns in Multi-dimensional Inter-organizational Networks: A Case Study of the Humanitarian Relief Sector

Assortativity Patterns in Multi-dimensional Inter-organizational Networks: A Case Study of the Humanitarian Relief Sector Assortativity Patterns in Multi-dimensional Inter-organizational Networks: A Case Study of the Humanitarian Relief Sector Kang Zhao, Louis-Marie Ngamassi, John Yen, Carleen Maitland, and Andrea Tapia College

More information

On of the major merits of the Flag Model is its potential for representation. There are three approaches to such a task: a qualitative, a

On of the major merits of the Flag Model is its potential for representation. There are three approaches to such a task: a qualitative, a Regime Analysis Regime Analysis is a discrete multi-assessment method suitable to assess projects as well as policies. The strength of the Regime Analysis is that it is able to cope with binary, ordinal,

More information

Can Cascades be Predicted?

Can Cascades be Predicted? Can Cascades be Predicted? Rediet Abebe and Thibaut Horel September 22, 2014 1 Introduction In this presentation, we discuss the paper Can Cascades be Predicted? by Cheng, Adamic, Dow, Kleinberg, and Leskovec,

More information

Final Report: Local Structure and Evolution for Cascade Prediction

Final Report: Local Structure and Evolution for Cascade Prediction Final Report: Local Structure and Evolution for Cascade Prediction Jake Lussier (lussier1@stanford.edu), Jacob Bank (jbank@stanford.edu) ABSTRACT Information cascades in large social networks are complex

More information

Homophily and Influence in Social Networks

Homophily and Influence in Social Networks Homophily and Influence in Social Networks Nicola Barbieri nicolabarbieri1@gmail.com References: Maximizing the Spread of Influence through a Social Network, Kempe et Al 2003 Influence and Correlation

More information

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1

Inferring Gene Networks from Microarray Data using a Hybrid GA p.1 Inferring Gene Networks from Microarray Data using a Hybrid GA Mark Cumiskey, John Levine and Douglas Armstrong johnl@inf.ed.ac.uk http://www.aiai.ed.ac.uk/ johnl Institute for Adaptive and Neural Computation

More information

Use of Economic Tendency Surveys

Use of Economic Tendency Surveys Use of Economic Tendency Surveys UN Workshop Hangzhou Klaus Abberger Swiss Economic Institute (KOF) of the ETH Zurich 8. October 2014 Outline Outline 1 Measurement of Assessments and Expectations of the

More information

The Science of Social Media. Kristina Lerman USC Information Sciences Institute

The Science of Social Media. Kristina Lerman USC Information Sciences Institute The Science of Social Media Kristina Lerman USC Information Sciences Institute ML meetup, July 2011 What is a science? Explain observed phenomena Make verifiable predictions Help engineer systems with

More information

Propagating Uncertainty in Multi-Stage Bayesian Convolutional Neural Networks with Application to Pulmonary Nodule Detection

Propagating Uncertainty in Multi-Stage Bayesian Convolutional Neural Networks with Application to Pulmonary Nodule Detection Propagating Uncertainty in Multi-Stage Bayesian Convolutional Neural Networks with Application to Pulmonary Nodule Detection Onur Ozdemir, Benjamin Woodward, Andrew A. Berlin Draper {oozdemir,bwoodward,aberlin}@draper.com

More information

Inferring Social Ties across Heterogeneous Networks

Inferring Social Ties across Heterogeneous Networks Inferring Social Ties across Heterogeneous Networks CS 6001 Complex Network Structures HARISH ANANDAN Introduction Social Ties Information carrying connections between people It can be: Strong, weak or

More information

Labor Market Adjustments during the Business Cycle in Argentina: A Cohorts Panel VAR Approach. Omar Arias The World Bank

Labor Market Adjustments during the Business Cycle in Argentina: A Cohorts Panel VAR Approach. Omar Arias The World Bank Labor Market Adjustments during the Business Cycle in Argentina: A Cohorts Panel VAR Approach Omar Arias The World Bank Walter Sosa Escudero Universidad de San Andrés and CEDLAS/UNLP April 20, 2009 MOTIVATION

More information

A Dynamics for Advertising on Networks. Atefeh Mohammadi Samane Malmir. Spring 1397

A Dynamics for Advertising on Networks. Atefeh Mohammadi Samane Malmir. Spring 1397 A Dynamics for Advertising on Networks Atefeh Mohammadi Samane Malmir Spring 1397 Outline Introduction Related work Contribution Model Theoretical Result Empirical Result Conclusion What is the problem?

More information

A Propagation-based Algorithm for Inferring Gene-Disease Associations

A Propagation-based Algorithm for Inferring Gene-Disease Associations A Propagation-based Algorithm for Inferring Gene-Disease Associations Oron Vanunu Roded Sharan Abstract: A fundamental challenge in human health is the identification of diseasecausing genes. Recently,

More information

Leonardo Gambacorta and Andres Murcia

Leonardo Gambacorta and Andres Murcia Comments on: The impact of macroprudential policies and their interaction with monetary policy: An empirical analysis using credit registry data by Leonardo Gambacorta and Andres Murcia BIS CCA CGDFS Conference

More information

Fraud Detection for MCC Manipulation

Fraud Detection for MCC Manipulation 2016 International Conference on Informatics, Management Engineering and Industrial Application (IMEIA 2016) ISBN: 978-1-60595-345-8 Fraud Detection for MCC Manipulation Hong-feng CHAI 1, Xin LIU 2, Yan-jun

More information

Creation of a PAM matrix

Creation of a PAM matrix Rationale for substitution matrices Substitution matrices are a way of keeping track of the structural, physical and chemical properties of the amino acids in proteins, in such a fashion that less detrimental

More information

Individual-Level Targeting

Individual-Level Targeting Individual-Level Targeting Individual-level targeting. Review choice modeling framework. Using choice models for individual-level targeting (predictive modeling). Demonstration of software for BBBC case.

More information

EquilibriumSolver Fact Sheet

EquilibriumSolver Fact Sheet EquilibriumSolver Fact Sheet EquilibriumSolver (EQS) is an Excel/VBA application that simultaneously computes a history and forecast of Unit Shipments, Installed Base, and the Rate at which installed base

More information

SOCIAL MEDIA MINING. Behavior Analytics

SOCIAL MEDIA MINING. Behavior Analytics SOCIAL MEDIA MINING Behavior Analytics Dear instructors/users of these slides: Please feel free to include these slides in your own material, or modify them as you see fit. If you decide to incorporate

More information

Identifying influencers in a social network: the value of real referral data

Identifying influencers in a social network: the value of real referral data Identifying influencers in a social network: the value of real referral data I. Roelens a,b,1, P. Baecke b, D.F. Benoit a a Ghent University, Faculty of Economics and Business Administration, Tweekerkenstraat

More information

Final Report: Local Structure and Evolution for Cascade Prediction

Final Report: Local Structure and Evolution for Cascade Prediction Final Report: Local Structure and Evolution for Cascade Prediction Jake Lussier (lussier1@stanford.edu), Jacob Bank (jbank@stanford.edu) December 10, 2011 Abstract Information cascades in large social

More information

Manage the Risk Rating Process

Manage the Risk Rating Process Manage the Risk Rating Process CreditQuest Manage the Risk Rating Process Rating Manager: CreditQuest Rating Manager is a highly flexible software solution that enables financial institutions to deploy

More information

A new approach to Early Warning Systems for smaller European banks

A new approach to Early Warning Systems for smaller European banks Despo Malikkidou Michael Bräuning A new approach to Early Warning Systems for smaller European banks Developed by Division Analysis and Methodological Support DG Micro-prudential Supervision III European

More information

HybridRank: Ranking in the Twitter Hybrid Networks

HybridRank: Ranking in the Twitter Hybrid Networks HybridRank: Ranking in the Twitter Hybrid Networks Jianyu Li Department of Computer Science University of Maryland, College Park jli@cs.umd.edu ABSTRACT User influence in social media may depend on multiple

More information

Contents. About the authors

Contents. About the authors Contents About the authors Glossary Prologue References xi xiii xvii xxii Part I Modeling and simulation framework for value-based healthcare systems 1 1 Healthcare systems modeling and simulation 3 1.1

More information

A Neural Network Model for Forecasting Photovoltaic Deployment in Italy

A Neural Network Model for Forecasting Photovoltaic Deployment in Italy Article A Neural Network Model for Forecasting Photovoltaic Deployment in Italy Crescenzio Gallo *, Michelangelo De Bonis Dipartimento di Medicina Clinica e Sperimentale Università di Foggia Viale Pinto

More information

Toolkit for Impact Evaluation of Public Credit Guarantee Schemes for SMEs (Preliminary)

Toolkit for Impact Evaluation of Public Credit Guarantee Schemes for SMEs (Preliminary) Toolkit for Impact Evaluation of Public Credit Guarantee Schemes for SMEs (Preliminary) Madrid June 2, 2017 Pietro Calice Finance & Markets Global Practice World Bank Group Outline of the Presentation

More information

Tutorial: Big Data Algorithms and Applications Under Hadoop KUNPENG ZHANG SIDDHARTHA BHATTACHARYYA

Tutorial: Big Data Algorithms and Applications Under Hadoop KUNPENG ZHANG SIDDHARTHA BHATTACHARYYA Tutorial: Big Data Algorithms and Applications Under Hadoop KUNPENG ZHANG SIDDHARTHA BHATTACHARYYA http://kzhang6.people.uic.edu/tutorial/amcis2014.html August 7, 2014 Schedule I. Introduction to big data

More information

Co-evolution of Social and Affiliation Networks

Co-evolution of Social and Affiliation Networks Co-evolution of Social and Affiliation Networks Elena Zheleva Dept. of Computer Science University of Maryland College Park, MD 20742, USA elena@cs.umd.edu Hossam Sharara Dept. of Computer Science University

More information

Research on Personal Credit Assessment Based. Neural Network-Logistic Regression Combination

Research on Personal Credit Assessment Based. Neural Network-Logistic Regression Combination Open Journal of Business and Management, 2017, 5, 244-252 http://www.scirp.org/journal/ojbm ISSN Online: 2329-3292 ISSN Print: 2329-3284 Research on Personal Credit Assessment Based on Neural Network-Logistic

More information

Part 3: Food-Web Robustness

Part 3: Food-Web Robustness Part 3: Food-Web Robustness Why might ecological network structure matter? Devious Strategies for Ecosystem Stability, Robustness, Persistence In short, there is no comfortable theorem assuring that increasing

More information

Identifying Peer Influence in Massive Online Social Networks: A Platform for Randomized Experimentation on Facebook

Identifying Peer Influence in Massive Online Social Networks: A Platform for Randomized Experimentation on Facebook Identifying Peer Influence in Massive Online Social Networks: Sinan Aral NYU Stern School of Business and MIT, 44 West 4 th Street Room: 8-81, New York, NY 10012 sinan@stern.nyu.edu Dylan Walker NYU Stern

More information

Influence of First Steps in a Community on Ego-Network: Growth, Diversity, and Engagement

Influence of First Steps in a Community on Ego-Network: Growth, Diversity, and Engagement Influence of First Steps in a Community on Ego-Network: Growth, Diversity, and Engagement Atef Chaudhury University of Waterloo Waterloo, ON N2L 3G1, Canada a29chaud@uwaterloo.ca Myunghwan Kim LinkedIn

More information

THE ROLE OF NESTED DATA ON GDP FORECASTING ACCURACY USING FACTOR MODELS *

THE ROLE OF NESTED DATA ON GDP FORECASTING ACCURACY USING FACTOR MODELS * Andrejs Bessonovs University of Latvia, Latvia THE ROLE OF NESTED DATA ON GDP FORECASTING ACCURACY USING FACTOR MODELS * Abstract The paper studies an impact of nested macroeconomic data on Latvian GDP

More information

Food price pass-through in the euro area: the role of asymmetries and non-linearities

Food price pass-through in the euro area: the role of asymmetries and non-linearities Food price pass-through in the euro area: the role of asymmetries and non-linearities (*) Gianluigi Ferrucci, European Central Bank Rebeca Jiménez-Rodrigues, University of Salamanca Luca Onorante, European

More information

Final Report Evaluating Social Networks as a Medium of Propagation for Real-Time/Location-Based News

Final Report Evaluating Social Networks as a Medium of Propagation for Real-Time/Location-Based News Final Report Evaluating Social Networks as a Medium of Propagation for Real-Time/Location-Based News Mehmet Ozan Kabak, Group Number: 45 December 10, 2012 Abstract This work is concerned with modeling

More information

Capital Markets Day 2017 Commercial Banking Italy

Capital Markets Day 2017 Commercial Banking Italy Capital Markets Day 2017 Commercial Banking Italy Slide 2 Transformation of operating model fully on track Good morning everybody, it is a pleasure for Giovanni and I to update you on Commercial Banking

More information

Time-Aware Service Ranking Prediction in the Internet of Things Environment

Time-Aware Service Ranking Prediction in the Internet of Things Environment sensors Article Time-Aware Ranking Prediction in the Internet of Things Environment Yuze Huang, Jiwei Huang *, Bo Cheng, Shuqing He and Junliang Chen State Key Libratory of Networking and Switching Technology,

More information

RECOGNIZING USER INTENTIONS IN REAL-TIME

RECOGNIZING USER INTENTIONS IN REAL-TIME WHITE PAPER SERIES IPERCEPTIONS ACTIVE RECOGNITION TECHNOLOGY: RECOGNIZING USER INTENTIONS IN REAL-TIME Written by: Lane Cochrane, Vice President of Research at iperceptions Dr Matthew Butler PhD, Senior

More information

Reaction Paper Influence Maximization in Social Networks: A Competitive Perspective

Reaction Paper Influence Maximization in Social Networks: A Competitive Perspective Reaction Paper Influence Maximization in Social Networks: A Competitive Perspective Siddhartha Nambiar October 3 rd, 2013 1 Introduction Social Network Analysis has today fast developed into one of the

More information

Dynamics of Consumer Demand for New Durable Goods

Dynamics of Consumer Demand for New Durable Goods Dynamics of Consumer Demand for New Durable Goods Gautam Gowrisankaran Marc Rysman University of Arizona, HEC Montreal, and NBER Boston University December 15, 2012 Introduction If you don t need a new

More information

FICO Predictive Analytics provides businesses across a variety of industries with:

FICO Predictive Analytics provides businesses across a variety of industries with: FICO Predictive Analytics provides businesses across a variety of industries with: Improved profitability from more targeted decisions across the lifecycle. Stronger analytic expertise and deeper views

More information

Steering Information Diffusion Dynamically against User Attention Limitation

Steering Information Diffusion Dynamically against User Attention Limitation Steering Information Diffusion Dynamically against User Attention Limitation Shuyang Lin, Qingbo Hu, Fengjiao Wang, Philip S.Yu Department of Computer Science University of Illinois at Chicago Chicago,

More information

GDELT Database. Alex Becker Jingjin Wei Adrian Yi

GDELT Database. Alex Becker Jingjin Wei Adrian Yi GDELT Database Alex Becker Jingjin Wei Adrian Yi GDELT Database The vision of the GDELT Project is to codify the entire planet into a computable format using all available open information sources that

More information

The Effects of Permanent and Temporary Shocks to Permanent and Temporary Employment:

The Effects of Permanent and Temporary Shocks to Permanent and Temporary Employment: The Effects of Permanent and Temporary Shocks to Permanent and Temporary Employment: Time Series Evidence from the Korean Economy November 2008 Sunoong Hwang and Youngmin Park School of Economics Yonsei

More information

Predicting ratings of peer-generated content with personalized metrics

Predicting ratings of peer-generated content with personalized metrics Predicting ratings of peer-generated content with personalized metrics Project report Tyler Casey tyler.casey09@gmail.com Marius Lazer mlazer@stanford.edu [Group #40] Ashish Mathew amathew9@stanford.edu

More information

Preface to the third edition Preface to the first edition Acknowledgments

Preface to the third edition Preface to the first edition Acknowledgments Contents Foreword Preface to the third edition Preface to the first edition Acknowledgments Part I PRELIMINARIES XXI XXIII XXVII XXIX CHAPTER 1 Introduction 3 1.1 What Is Business Analytics?................

More information

Recent Advances Towards An Intraspecific Theory of Human Variation for Digital Models

Recent Advances Towards An Intraspecific Theory of Human Variation for Digital Models Recent Advances Towards An Intraspecific Theory of Human Variation for Digital Models By Bradly Alicea freejumper@yahoo.com Department of Telecommunication, Information Studies, and Media and Cognitive

More information

Bourdieu A Glossary. La Salle University. From the SelectedWorks of Maria E Gonzalez. Maria E Gonzalez, La Salle University.

Bourdieu A Glossary. La Salle University. From the SelectedWorks of Maria E Gonzalez. Maria E Gonzalez, La Salle University. La Salle University From the SelectedWorks of Maria E Gonzalez April, 2008 Bourdieu A Glossary Maria E Gonzalez, La Salle University Available at: https://works.bepress.com/maria_e_gonzalez/3/ A GLOSSARY

More information

High Performance Non Interest Income. a High Performance Briefing by Resurgent Performance

High Performance Non Interest Income. a High Performance Briefing by Resurgent Performance High Performance Non Interest Income a High Performance Briefing by High Performance Non Interest Income Non Interest Income (NII) has been an elusive metric for many years. Finding the secret formula

More information

STUDY SUBJECTS TAUGHT IN ENGLISH FOR EXCHANGE STUDENTS SPRING SEMESTER 2017/2018

STUDY SUBJECTS TAUGHT IN ENGLISH FOR EXCHANGE STUDENTS SPRING SEMESTER 2017/2018 STUDY SUBJECTS TAUGHT IN ENGLISH FOR EXCHANGE STUDENTS SPRING SEMESTER 2017/2018 1-3 YEAR Study programme: INTERNATIONAL BUSINESS Credits Description of study subject (ECTS) Subject International Business

More information

Survival Outcome Prediction for Cancer Patients based on Gene Interaction Network Analysis and Expression Profile Classification

Survival Outcome Prediction for Cancer Patients based on Gene Interaction Network Analysis and Expression Profile Classification Survival Outcome Prediction for Cancer Patients based on Gene Interaction Network Analysis and Expression Profile Classification Final Project Report Alexander Herrmann Advised by Dr. Andrew Gentles December

More information

Machine learning in neuroscience

Machine learning in neuroscience Machine learning in neuroscience Bojan Mihaljevic, Luis Rodriguez-Lujan Computational Intelligence Group School of Computer Science, Technical University of Madrid 2015 IEEE Iberian Student Branch Congress

More information

Co-citation Analysis: An Overview

Co-citation Analysis: An Overview Co-citation Analysis: An Overview Ganesh Surwase, Anil Sagar, B. S. Kademani and K. Bhanumurthy Scientific Information Resource Division, Bhabha Atomic Research Centre, Trombay, Mumbai (India) - 400085.

More information

Cluster-based Forecasting for Laboratory samples

Cluster-based Forecasting for Laboratory samples Cluster-based Forecasting for Laboratory samples Research paper Business Analytics Manoj Ashvin Jayaraj Vrije Universiteit Amsterdam Faculty of Science Business Analytics De Boelelaan 1081a 1081 HV Amsterdam

More information

TwitterRank: Finding Topicsensitive Influential Twitterers

TwitterRank: Finding Topicsensitive Influential Twitterers TwitterRank: Finding Topicsensitive Influential Twitterers Jianshu Weng, Ee-Peng Lim, Jing Jiang Singapore Management University Qi He Pennsylvania State University WSDM 2010 Feb 5, 2010 Outline Introduction

More information

Influence Maximization on Social Graphs. Yu-Ting Wen

Influence Maximization on Social Graphs. Yu-Ting Wen Influence Maximization on Social Graphs Yu-Ting Wen 05-25-2018 Outline Background Models of influence Linear Threshold Independent Cascade Influence maximization problem Proof of performance bound Compute

More information

DATA ANALYTICS WITH R, EXCEL & TABLEAU

DATA ANALYTICS WITH R, EXCEL & TABLEAU Learn. Do. Earn. DATA ANALYTICS WITH R, EXCEL & TABLEAU COURSE DETAILS centers@acadgild.com www.acadgild.com 90360 10796 Brief About this Course Data is the foundation for technology-driven digital age.

More information

Analytics for Banks. September 19, 2017

Analytics for Banks. September 19, 2017 Analytics for Banks September 19, 2017 Outline About AlgoAnalytics Problems we can solve for banks Our experience Technology Page 2 About AlgoAnalytics Analytics Consultancy Work at the intersection of

More information

Juan Asúa. General Manager Banking in Spain. Anticipating the new environment

Juan Asúa. General Manager Banking in Spain. Anticipating the new environment Juan Asúa General Manager Banking in Spain Anticipating the new environment Index Excellent positioning: Customers and Products New environment, New opportunities Strategic Drivers: Innovation and Transformation

More information

Unlocking innovation. Joe Staton, Client Services Lead, GfK Market Opportunities & Innovation GfK July 12, 2016 Unlocking innovation

Unlocking innovation. Joe Staton, Client Services Lead, GfK Market Opportunities & Innovation GfK July 12, 2016 Unlocking innovation Unlocking innovation Joe Staton, Client Services Lead, GfK Market Opportunities & Innovation 1 Market opportunities and innovation Strategic innovation roadmap FUTURE MARKET MAP Tomorrow s market opportunities,

More information

Polypropylene Resin Supplier Customer Value & Loyalty Benchmarking Study

Polypropylene Resin Supplier Customer Value & Loyalty Benchmarking Study Polypropylene Resin Supplier Customer Value & Loyalty Benchmarking Study 2016 Metrics to Manage the Customer Experience Tel: (001) 816-364-6200 Fax: (001) 816-364-3606 www.mastio.com OVERVIEW Mastio &

More information

Essential expertise on the economic and consumer credit trends that impact your business and investments.

Essential expertise on the economic and consumer credit trends that impact your business and investments. economic & consumer credit analytics Essential expertise on the economic and consumer credit trends that impact your business and investments. Economic & Consumer Credit Analytics Essential expertise on

More information

Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models

Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Inferring Gene-Gene Interactions and Functional Modules Beyond Standard Models Haiyan Huang Department of Statistics, UC Berkeley Feb 7, 2018 Background Background High dimensionality (p >> n) often results

More information

HDPE & LLDPE/LDPE Resin Supplier Customer Value & Loyalty Benchmarking Studies

HDPE & LLDPE/LDPE Resin Supplier Customer Value & Loyalty Benchmarking Studies HDPE & LLDPE/LDPE Resin Supplier Customer Value & Loyalty Benchmarking Studies 2015 Metrics to Manage the Customer Experience Tel: (001) 816-364-6200 Fax: (001) 816-364-3606 www.mastio.com OVERVIEW MASTIO

More information

Optimize Marketing Budget with Marketing Mix Model

Optimize Marketing Budget with Marketing Mix Model Optimize Marketing Budget with Marketing Mix Model Data Analytics Spreadsheet Modeling New York Boston San Francisco Hyderabad Perceptive-Analytics.com (646) 583 0001 cs@perceptive-analytics.com Executive

More information

RETHINKING WHAT RDC MEANS TO YOUR CUSTOMERS AND YOUR FINANCIAL INSTITUTION

RETHINKING WHAT RDC MEANS TO YOUR CUSTOMERS AND YOUR FINANCIAL INSTITUTION RETHINKING WHAT RDC MEANS TO YOUR CUSTOMERS AND YOUR FINANCIAL INSTITUTION Thank you for joining! Please wait while others join the line. The Webinar will begin shortly. As a courtesy to others, please

More information

Air Transportation System Architecture Analysis

Air Transportation System Architecture Analysis Air Transportation System Architecture Analysis Project Final Presentation Advanced System Architecture Spring 2006 May 9 th, 2006 Presentation by: Philippe Bonnefoy Roland Weibel Instructors: Chris Magee,

More information

Reaction Paper Regarding the Flow of Influence and Social Meaning Across Social Media Networks

Reaction Paper Regarding the Flow of Influence and Social Meaning Across Social Media Networks Reaction Paper Regarding the Flow of Influence and Social Meaning Across Social Media Networks Mahalia Miller Daniel Wiesenthal October 6, 2010 1 Introduction One topic of current interest is how language

More information

Wasserman, S. (1980). Analyzing Social Networks as Stochastic Processes. Journal of

Wasserman, S. (1980). Analyzing Social Networks as Stochastic Processes. Journal of Dana Warmsley Math 4740 Prof. Eldredge Final Paper Wasserman, S. (1980). Analyzing Social Networks as Stochastic Processes. Journal of the American Statistical Association, 75(370), 280-294. A social network

More information

TABLE OF CONTENTS ix

TABLE OF CONTENTS ix TABLE OF CONTENTS ix TABLE OF CONTENTS Page Certification Declaration Acknowledgement Research Publications Table of Contents Abbreviations List of Figures List of Tables List of Keywords Abstract i ii

More information

AN APPROACH TO APPROXIMATE DIFFUSION PROCESSES IN SOCIAL NETWORKS

AN APPROACH TO APPROXIMATE DIFFUSION PROCESSES IN SOCIAL NETWORKS Association for Information Systems AIS Electronic Library (AISeL) UK Academy for Information Systems Conference Proceedings 2010 UK Academy for Information Systems Spring 3-23-2010 AN APPROACH TO APPROXIMATE

More information

AI that creates professional opportunities at scale

AI that creates professional opportunities at scale AI that creates professional opportunities at scale Deepak Agarwal AI in practice, AAAI, San Francisco, USA Feb 6 th, 2017 We are seeking new professional opportunities all the time To Advance our Careers

More information

Chapter 8 Analytical Procedures

Chapter 8 Analytical Procedures Slide 8.1 Principles of Auditing: An Introduction to International Standards on Auditing Chapter 8 Analytical Procedures Rick Hayes, Hans Gortemaker and Philip Wallage Slide 8.2 Analytical procedures Analytical

More information

Jialu Yan, Tingting Gao, Yilin Wei Advised by Dr. German Creamer, PhD, CFA Dec. 11th, Forecasting Rossmann Store Sales Prediction

Jialu Yan, Tingting Gao, Yilin Wei Advised by Dr. German Creamer, PhD, CFA Dec. 11th, Forecasting Rossmann Store Sales Prediction Jialu Yan, Tingting Gao, Yilin Wei Advised by Dr. German Creamer, PhD, CFA Dec. 11th, 2015 Forecasting Rossmann Store Sales Prediction Problem Understanding It is very important for retail stores to save

More information

Machine learning methods for on- line predic4on and op4mal resource alloca4on in smart buildings and grids

Machine learning methods for on- line predic4on and op4mal resource alloca4on in smart buildings and grids Machine learning methods for on- line predic4on and op4mal resource alloca4on in smart buildings and grids Madeleine Gibescu Joint work with: Elena Mocanu, Luis Hurtado, Phuong Nguyen Introduction Motivation:

More information

arxiv: v1 [cs.lg] 14 Jan 2019

arxiv: v1 [cs.lg] 14 Jan 2019 Under consideration for publication arxiv:1901.06247v1 [cs.lg] 14 Jan 2019 Micro- and Macro-Level Churn Analysis of Large-Scale Mobile Games Xi Liu 1, Muhe Xie 2, Xidao Wen 3, Rui Chen 2, Yong Ge 4, Nick

More information

A LATENT SEGMENTATION MULTINOMIAL LOGIT APPROACH TO EXAMINE BICYCLE SHARING SYSTEM USERS DESTINATION PREFERENCES

A LATENT SEGMENTATION MULTINOMIAL LOGIT APPROACH TO EXAMINE BICYCLE SHARING SYSTEM USERS DESTINATION PREFERENCES A LATENT SEGMENTATION MULTINOMIAL LOGIT APPROACH TO EXAMINE BICYCLE SHARING SYSTEM USERS DESTINATION PREFERENCES Ahmadreza Faghih-Imani, McGill University Naveen Eluru, University of Central Florida Introduction

More information

MFMS: Maximal Frequent Module Set mining from multiple human gene expression datasets

MFMS: Maximal Frequent Module Set mining from multiple human gene expression datasets MFMS: Maximal Frequent Module Set mining from multiple human gene expression datasets Saeed Salem North Dakota State University Cagri Ozcaglar Amazon 8/11/2013 Introduction Gene expression analysis Use

More information

Data Mining Applications with R

Data Mining Applications with R Data Mining Applications with R Yanchang Zhao Senior Data Miner, RDataMining.com, Australia Associate Professor, Yonghua Cen Nanjing University of Science and Technology, China AMSTERDAM BOSTON HEIDELBERG

More information

Mean Percentile Rank. Percentile Rank in Industry - Education - Postsecondary/ Higher Education Database

Mean Percentile Rank. Percentile Rank in Industry - Education - Postsecondary/ Higher Education Database EMPLOYEE ENGAGEMENT REPORT Lewis & Clark College Employee Engagement Q12 All - All Jan 22, 2018 - Feb 03, 2018 Q 12 GrandMean Change Mean Percentile Rank Engagement Index N/A 52 Engaged 37% Last mean:

More information

Exporting and Productivity The Cross Country Dimension

Exporting and Productivity The Cross Country Dimension Exporting and Productivity The Cross Country Dimension The Trade-Productivity Nexus in the European Economy C. Altomonte Bocconi U. & Bruegel 15th FIW Workshop - Vienna Altomonte (Bocconi U. & Bruegel)

More information

Information Systems Planning

Information Systems Planning Information Systems Planning 1 Information Systems Planning 2 Distributed Systems Architecture Paradox of IS Planning Most organization's survival now depends on IT Planning of its effective use is a matter

More information

Stress Testing & Capital Planning: Principles, Program Elements & Common Challenges

Stress Testing & Capital Planning: Principles, Program Elements & Common Challenges Stress Testing & Capital Planning: Principles, Program Elements & Common Challenges Table of Contents 1. Comprehensive Capital Analysis & Review: Guiding Principles 3 2. Key Elements 4 3. Common Pitfalls

More information

Systemic Risk in the Global Water IO Network

Systemic Risk in the Global Water IO Network Motivation and RQ Data and definitions SDA Network Conclusions Systemic Risk in the Global Input-Output Network Tiziano Distefano 1 Massimo Riccaboni 1 Giovanni Marin 2 1 IMT Institute for Advanced Studies,

More information

Breakout sessions. AutoCheck vehicle history reporting at its best! This session will cover current strategies and an AutoCheck product road map.

Breakout sessions. AutoCheck vehicle history reporting at its best! This session will cover current strategies and an AutoCheck product road map. Breakout sessions AutoCheck vehicle history reporting at its best! This session will cover current strategies and an AutoCheck product road map. Automotive credit services for lenders This session will

More information

You are Who You Know and How You Behave: Attribute Inference Attacks via Users Social Friends and Behaviors

You are Who You Know and How You Behave: Attribute Inference Attacks via Users Social Friends and Behaviors You are Who You Know and How You Behave: Attribute Inference via Users Social Friends and Behaviors Neil Zhenqiang Gong ECE Department, Iowa State University neilgong@iastate.edu Bin Liu MSIS Department,

More information

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat

Overview. Methods for gene mapping and haplotype analysis. Haplotypes. Outline. acatactacataacatacaatagat. aaatactacctaacctacaagagat Overview Methods for gene mapping and haplotype analysis Prof. Hannu Toivonen hannu.toivonen@cs.helsinki.fi Discovery and utilization of patterns in the human genome Shared patterns family relationships,

More information

CONNECTING CORPORATE GOVERNANCE TO COMPANIES PERFORMANCE BY ARTIFICIAL NEURAL NETWORKS

CONNECTING CORPORATE GOVERNANCE TO COMPANIES PERFORMANCE BY ARTIFICIAL NEURAL NETWORKS CONNECTING CORPORATE GOVERNANCE TO COMPANIES PERFORMANCE BY ARTIFICIAL NEURAL NETWORKS Darie MOLDOVAN, PhD * Mircea RUSU, PhD student ** Abstract The objective of this paper is to demonstrate the utility

More information

Shifting to Customer-Centric Product Determination and Pricing Optimization

Shifting to Customer-Centric Product Determination and Pricing Optimization WHITE PAPER Shifting to Customer- Product Determination and Pricing Optimization Is Traditional Segmentation Still a Competitive Advantage? Marvin W. Foest VP Retail and Commercial Banking Solution Architecture

More information