SUPPLEMENTARY MATERIAL

Size: px
Start display at page:

Download "SUPPLEMENTARY MATERIAL"

Transcription

1 SUPPLEMENTARY MATERIAL Materials and Methods Circular dichroism (CD) spectroscopy. Far ultraviolet (UV) CD spectra of apo- and holo- CaM and the CaM mutants were recorded on a Jasco J-715 spectropolarimeter at 20 o C in 20 mm HEPES ph 8.0, 100 mm KCl, 1 mm MgCl 2 and 200 M EGTA or 1 mm CaCl 2, as appropriate. Spectra are presented as the CD absorption coefficient calculated on a mean residue weight (mrw) basis. Ca 2+ binding measurements. Stoichiometric Ca 2+ dissociation constants for wild type and mutant CaMs were determined from Ca 2+ titrations of the apo proteins (23-27 M) performed in the presence of the chromophoric chelator 5,5 -Br 2 BAPTA (25 M) (26,27). Ca 2+ -binding to the chelator dye was measured in the presence or absence of CaM and the bound fraction was measured by a decrease in absorption compared to the free dye as CaM and its mutants competed for Ca 2+ with the chelator (Figure S2). Measurements were made at 20 o C in 10 mm Tris.HCl ph 8 and 100 mm KCl. Under these conditions, the Ca 2+ binding constant of 5,5 - Br 2 BAPTA was 5.7 x 10 5 M -1 (27). Three separate titrations were performed on each protein sample, and the values for the individual binding constants were obtained from nonlinear least-squares fits directly to the experimentally observed titration curves. The binding data were fitted to a model in which the higher affinities were assigned to the two C lobe sites (K d 3 and K d 4) and the lower affinities to the two N lobe sites (K d 1 and K d 2) of CaM (26,27). From the measured K d 1, K d 2, K d 3 and K d 4, values, an overall K d1 was derived for convenience, for wild type and mutant CaMs (as described in Materials and Methods, Theory section and Table S2), to be used in Scheme 1 and Reaction 1 below. Ca 2+ dissociation kinetics. Stopped-flow kinetic measurements of Ca 2+ dissociation were carried out using quin 2 (Molecular Probes) and a Hi-Tech Scientific SF-61DX2 stopped-flow system as previously described (30) and briefly: fluorescence excitation was set to 320 nm with 1 nm slit width and fluorescence emission from quin 2 was collected using a 530 nm cutoff filter. The assay solution contained 50 mm K + -PIPES ph 7.0, 100 mm KCl, 2 mm MgCl µm quin 2 in assay solution with no added Ca 2+ was mixed with 3 µm wild type or mutant CaM in a 50 µm Ca 2+ -containing buffer solution. In parallel sets of experiments 5 M CaMKII peptide from the Ca 2+.CaM binding domain of CaMKII was included (mixing chamber concentrations). Care was taken that all protein components were free of any Ca 2+ chelator. 1

2 SUPPLEMENTARY TABLES Table S1 Far UV CD properties of CaM mutants. Molar CD absorption coefficients, (M -1 cm -1 ) at 222 nm were determined for mutant CaMs and compared with those for wild type, in the absence and presence of Ca 2+, as a measure of secondary structure content. Table S2 Macroscopic Ca 2+ dissociation constants of wild type and mutant CaMs. Each value represents the mean of three sets of measurements, error is S.D. K d1 represents the overall Ca 2+ dissociation constant for CaM corresponding to K d1 = {1/(K1*K2*K3*K4)} 1/4 (where K1 denotes the association constant for Ca 2+ binding site 1, and so on) for wild type CaM and to the appropriate sites and number of sites for each mutant e.g. for K d1 for CaM1= {1/(K2*K3*K4)} 1/3. Table S3 Ca 2+ dissociation rate constants of CaM mutants and their CaMKII peptide complexes. Stopped-flow kinetic measurements were carried out as described in Materials and Methods. n indicates the number of records averaged, S.E.M. values are the standard error of the mean of n experiments. k off1 and k off2 (s -1 ) represent the rate constants and A1 and A2 correspond to the amplitudes of the first and second phases (when observed). Amplitudes are expressed as % signal change observed in the experiments. SUPPLEMENTARY FIGURES Fig. S1 Far-UV CD spectra of CaM mutants in the presence and absence of Ca 2+. Spectra of the apo (1, red line) and holo (2, blue line) forms of CaM and the CaM mutants A) CaM1, B) CaM2, C) CaM3, D) CaM4, E) CaM12, F) CaM34 and G) wild type CaM. Fig. S2 Ca 2+ titrations of CaM mutants. A) CaM1, B) CaM2, C) CaM3, D) CaM4, E) CaM12, F) CaM34 and G) wild type CaM. Panel G shows titration of 25 M 5,5 -Br 2 BAPTA in the absence of protein (blue squares) and in the presence of 25 M wild type CaM (red label). The fitted curves for these displayed as grey lines are used to overlay the titration data for each mutant to indicate the position of the dye and wild type CaM for comparison. The concentration of the mutants CaMs was in the range of M. Fig. S3 Kinetic parameters of CaMKII activity stimulated by wild type and mutant CaMs, with respect to calmodulin. Steady-state activity measurements were carried out as described in Materials and Methods, syntide 2 concentration was 50 M, free Ca 2+ concentration was set to 60 M. The free Ca 2+ concentration was calculated using the overall K d1 values for CaM and its mutants (Suppl. Table S2) as described in Materials and Methods, except for CaM34 for which free [Ca 2+ ] of 100 M was maintained, CaMKII was 50 nm, ATP was 1 mm. The panels show A) CaM1, ( ) and CaM2, ( ); B) CaM3, ( ) and CaM4, ( ); C) CaM12, ( ), CaM34, ( ) and wild type CaM, ( ). The error bars represent the standard error of the mean (S.E.M.) from three sets of data. 2

3 Table S1 Far UV CD properties of CaM mutants. Protein (- Ca 2+ ) (+ Ca 2+ ) M -1 cm -1 M -1 cm -1 (+ Ca 2+ )/ (- Ca 2+ ) CaM CaM CaM CaM CaM CaM CaM CaM

4 Table S2 Ca 2+ binding properties of wild type and mutant CaMs K d 1 K d 2 K d 3 K d 4 K d1 CaM CaM CaM CaM CaM CaM CaM It must be noted that the affix for the macroscopic dissociation constants does not assign a specific Ca 2+ binding site of CaM. K d 1 and K d 2 refer to the two N lobe sites, though not specifically to either site 1 or site 2, and K d 3 and K d 4 describe binding to the two C lobe sites on the same terms. Overall K d1 was calculated as follows: K d1 = (K d 1 K d 2 K d 4) 1/n, where n is the number of Ca 2+ sites present in the mutant. 4

5 Table S3 Ca 2+ dissociation kinetics of CaM mutants and their complex with CaMKII k off1 s -1 S.E.M A1 S.E.M k off2 s -1 S.E.M A2 S.E.M n WT CaM WT CaM + CaMKII CaM CaM1 + CaMKII CaM CaM2 + CaMKII CaM CaM3 + CaMKII CaM CaM4 + CaMKII CaM CaM12 + CaMKII CaM CaM34 + CaMKII CaM1234 N.D. N.D. 9 CaM CaMKII N.D. N.D. 9 5

6 Figure S1 6

7 Figure S2 7

8 Figure S3 8

N-domain and p97 ATPase activity SUPPLEMENTAL DATA

N-domain and p97 ATPase activity SUPPLEMENTAL DATA SUPPLEMENTAL DATA ATPase assay based on malachite green system ATPase assays were performed using malachite green system (19,54) to obtain kinetic parameters. The assays were performed in reaction mixture

More information

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor

Challenges to measuring intracellular Ca 2+ Calmodulin: nature s Ca 2+ sensor Calcium Signals in Biological Systems Lecture 3 (2/9/0) Measuring intracellular Ca 2+ signals II: Genetically encoded Ca 2+ sensors Henry M. Colecraft, Ph.D. Challenges to measuring intracellular Ca 2+

More information

SUPPLEMENTARY INFORMATION. Supplementary Figures 1-8

SUPPLEMENTARY INFORMATION. Supplementary Figures 1-8 SUPPLEMENTARY INFORMATION Supplementary Figures 1-8 Supplementary Figure 1. TFAM residues contacting the DNA minor groove (A) TFAM contacts on nonspecific DNA. Leu58, Ile81, Asn163, Pro178, and Leu182

More information

Nature Structural & Molecular Biology: doi: /nsmb.2548

Nature Structural & Molecular Biology: doi: /nsmb.2548 Supplementary Figure 1. Structure of GltPhout. (a) Stereo view of a slice through a single GltPhout protomer shown in stick representation along with 2Fo-Fc and anomalous difference electron maps. The

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for Chemical Communications. This journal is The Royal Society of Chemistry 2014 Supporting Information Integration of Graphene Oxide and DNA as Universal Platform

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Conserved arginines on the rim of Hfq catalyze base pair formation and exchange Subrata Panja and Sarah A. Woodson T.C. Jenkins Department of Biophysics, Johns Hopkins University,

More information

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells

Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells SUPPLEMENTARY FIGURES Recruitment of Grb2 to surface IgG and IgE provides antigen receptor-intrinsic costimulation to class-switched B cells Niklas Engels, Lars Morten König, Christina Heemann, Johannes

More information

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems

Berberine as a novel light-up i-motif fluorescence ligand and. its application to design molecular logic systems Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information (ESI) Berberine as a novel light-up i-motif fluorescence ligand

More information

University of Bristol - Explore Bristol Research

University of Bristol - Explore Bristol Research Butterer, A., Pernstich, C., Smith, R. M., Sobott, F., Szczelkun, M. D., & Tóth, J. (2014). Type III restriction endonucleases are heterotrimeric: comprising one helicase-nuclease subunit and a dimeric

More information

Characterization of Antibody-Antigen Interactions by Fluorescence Spectroscopy

Characterization of Antibody-Antigen Interactions by Fluorescence Spectroscopy 25 Characterization of Antibody-Antigen Interactions by Fluorescence Spectroscopy Sotiris Missailidis and Kevin Brady 1. Introduction Fluorescence spectroscopy is a widely used technique for the characterization

More information

Supplementary Materials for

Supplementary Materials for advances.sciencemag.org/cgi/content/full/2/11/e1601625/dc1 Supplementary Materials for A molecular mechanism of chaperone-client recognition This PDF file includes: Lichun He, Timothy Sharpe, Adam Mazur,

More information

The Green Fluorescent Protein. w.chem.uwec.edu/chem412_s99/ppt/green.ppt

The Green Fluorescent Protein. w.chem.uwec.edu/chem412_s99/ppt/green.ppt The Green Fluorescent Protein w.chem.uwec.edu/chem412_s99/ppt/green.ppt www.chem.uwec.edu/chem412_s99/ppt/green.ppt Protein (gene) is from a jellyfish: Aequorea victoria www.chem.uwec.edu/chem412_s99/ppt/green.ppt

More information

School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou , P.R.China

School of Chemistry and Chemical Engineering, Sun Yat-Sen University, Guangzhou , P.R.China Sequence-specific recognition of double-stranded DNA with molecular beacon with the aid of Ag + under neutral ph environment Zhiyou Xiao, Xiaoting Guo, Liansheng Ling * School of Chemistry and Chemical

More information

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M

pt7ht vector and over-expressed in E. coli as inclusion bodies. Cells were lysed in 6 M Supplementary Methods MIG6 production, purification, inhibition, and kinase assays MIG6 segment 1 (30mer, residues 334 364) peptide was synthesized using standard solid-phase peptide synthesis as described

More information

5.36 Biochemistry Laboratory Spring 2009

5.36 Biochemistry Laboratory Spring 2009 MIT OpenCourseWare http://ocw.mit.edu 5.36 Biochemistry Laboratory Spring 2009 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms. SESSION 13 and SESSION

More information

Supplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly

Supplementary Information. Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Supplementary Information Small Molecule-Induced Domain Swapping as a Mechanism for Controlling Protein Function and Assembly Joshua M. Karchin, Jeung-Hoi Ha, Kevin E. Namitz, Michael S. Cosgrove, and

More information

Spectroscopic Characterization of a High-Affinity Calmodulin-Target Peptide Hybrid Molecule

Spectroscopic Characterization of a High-Affinity Calmodulin-Target Peptide Hybrid Molecule 3508 Biochemistry 1996, 35, 3508-3517 Spectroscopic Characterization of a High-Affinity Calmodulin-Target Peptide Hybrid Molecule Stephen R. Martin, Peter M. Bayley,*, Susan E. Brown,, Tudor Porumb, Mingjie

More information

Supplementary Information for

Supplementary Information for Supplementary Information for Conformational landscapes of DNA polymerase I and mutator derivatives establish fidelity checkpoints for nucleotide insertion Hohlbein et al. 1 Supplementary Figure S1. Wt

More information

Supplemental Figure 1

Supplemental Figure 1 Supplemental Fig. 1. Kinetics of,,, AKT and ERK activation in BMMCs following SCF stimulation. Starved BMMCs were stimulated with 250ng/mL of SCF for the indicated time. Soluble Cell Lysates (SCLs) were

More information

Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm

Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm Supplementary Figure 1: Two modes of low concentration of BsSMC on a DNA (a) Protein staining (left) and fluorescent imaging of Cy3 (right) confirm that BsSMC was labeled with Cy3 NHS-Ester. In each panel,

More information

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates

Supplementary Information. Arrays of Individual DNA Molecules on Nanopatterned Substrates Supplementary Information Arrays of Individual DNA Molecules on Nanopatterned Substrates Roland Hager, Alma Halilovic, Jonathan R. Burns, Friedrich Schäffler, Stefan Howorka S1 Figure S-1. Characterization

More information

Suppl. Table I. Design of mutations within the BIIB4 and BIIB5 scfvs for screening in a thermal challenge assay.

Suppl. Table I. Design of mutations within the BIIB4 and BIIB5 scfvs for screening in a thermal challenge assay. Suppl. Table I. Design of mutations within the and scfvs for screening in a thermal challenge assay. scfv position (Kabat numbering) Residue Frequency a Covariation DEEK or Rosetta c scfv position (Kabat

More information

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover

Viral RNAi suppressor reversibly binds sirna to. outcompete Dicer and RISC via multiple-turnover Supplementary Data Viral RNAi suppressor reversibly binds sirna to outcompete Dicer and RISC via multiple-turnover Renata A. Rawlings 1,2, Vishalakshi Krishnan 2 and Nils G. Walter 2 * 1 Biophysics and

More information

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly

SUPPLEMENTARY INFORMATION. Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly SUPPLEMENTARY INFORMATION Reengineering Protein Interfaces Yields Copper-Inducible Ferritin Cage Assembly Dustin J. E. Huard, Kathleen M. Kane and F. Akif Tezcan* Department of Chemistry and Biochemistry,

More information

Reversible Molecular Switching of Molecular Beacon: Controlling DNA Hybridization Kinetics and Thermodynamics Using Mercury(II) Ions

Reversible Molecular Switching of Molecular Beacon: Controlling DNA Hybridization Kinetics and Thermodynamics Using Mercury(II) Ions Supporting Information: Reversible Molecular Switching of Molecular Beacon: Controlling DNA Hybridization Kinetics and Thermodynamics Using Mercury(II) Ions Ronghua Yang, Jianyu Jin, Liping Long, Yongxiang

More information

Supplementary Information

Supplementary Information Supplementary Information Supplemental Figure 1. VVD-III purifies in a reduced state. (a) The cell pellet of VVD-III (VVD 36 C108A:M135I:M165I) is green compared to VVD-I (wild type VVD 36) due to the

More information

Supplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair

Supplemental Information. Single-Molecule Imaging Reveals How. Mre11-Rad50-Nbs1 Initiates DNA Break Repair Molecular Cell, Volume 67 Supplemental Information Single-Molecule Imaging Reveals How Mre11-Rad50-Nbs1 Initiates DNA Break Repair Logan R. Myler, Ignacio F. Gallardo, Michael M. Soniat, Rajashree A. Deshpande,

More information

Characterization of G4-G4 crosstalk in c-kit promoter region

Characterization of G4-G4 crosstalk in c-kit promoter region Supplementary information Characterization of G4-G4 crosstalk in c-kit promoter region Riccardo Rigo #, Claudia Sissi #,* # Department of Pharmaceutical and Pharmacological Sciences, University of Padova,

More information

Development of a quantitative fluorescence-based ligandbinding

Development of a quantitative fluorescence-based ligandbinding 1 2 3 4 5 6 7 Development of a quantitative fluorescence-based ligandbinding assay Conor J. Breen 1, 2, *, Mathilde Raverdeau 2 & H. Paul Voorheis 2 1 Department of Biology, Maynooth University, Maynooth,

More information

Multi-Volume Based Protein Quantification

Multi-Volume Based Protein Quantification A p p l i c a t i o n G u i d e Multi-Volume Based Methods Why Quantify Proteins? Proteins are central to our understanding of biology. In cells, they are multipurpose: from actin providing structural

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/NCHEM.1805 Visualization and Selective Chemical Targeting of RNA G-quadruplex Structures in the Cytoplasm of Human Cells Giulia Biffi 1, Marco Di Antonio 2, David Tannahill 1 and Shankar Balasubramanian

More information

A novel fluorescent probe for Hg 2+ detection in a wide ph range and its application in living cell imaging

A novel fluorescent probe for Hg 2+ detection in a wide ph range and its application in living cell imaging Electronic Supplementary Material (ESI) for Analytical Methods. This journal is The Royal Society of Chemistry 2018 Electronic Supplementary Information A novel fluorescent probe for Hg 2+ detection in

More information

Combining Ca 2+ Imaging with L-glutamate Photorelease

Combining Ca 2+ Imaging with L-glutamate Photorelease Author manuscript, published in "Cold Spring Harb Protoc 2013;2013(12):1165-8" DOI : 10.1101/pdb.prot073122 PROTOCOL 2 Title page Combining Ca 2+ Imaging with L-glutamate Photorelease SHORT TITLE: Ca 2+

More information

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez

Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez Supporting Information for: DNA-based delivery vehicles: ph-controlled disassembly and cargo release by Jung-Won Keum and Harry Bermudez DNA sequences Strand Sequence 1- GGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGGAGGGTTAGGGTTAGGGTTAGGG

More information

Study Small Molecule-Membrane Protein Binding Kinetics with. Nanodisc and Charge Sensitive Optical Detection

Study Small Molecule-Membrane Protein Binding Kinetics with. Nanodisc and Charge Sensitive Optical Detection Support Information Study Small Molecule-Membrane Protein Binding Kinetics with Nanodisc and Charge Sensitive Optical Detection Guangzhong Ma 1,2, Yan Guan 1,3, Shaopeng Wang 1*, Han Xu 4*, Nongjian Tao

More information

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies

Masayoshi Honda, Jeehae Park, Robert A. Pugh, Taekjip Ha, and Maria Spies Molecular Cell, Volume 35 Supplemental Data Single-Molecule Analysis Reveals Differential Effect of ssdna-binding Proteins on DNA Translocation by XPD Helicase Masayoshi Honda, Jeehae Park, Robert A. Pugh,

More information

Quantitative Evaluation of the Ability of Ionic Liquids to Offset the Cold- Induced Unfolding of Proteins

Quantitative Evaluation of the Ability of Ionic Liquids to Offset the Cold- Induced Unfolding of Proteins Electronic Supplementary Material (ESI) for Physical Chemistry Chemical Physics. This journal is the Owner Societies 2014 Supplimentary informations Quantitative Evaluation of the Ability of Ionic Liquids

More information

Supporting Information. Molecular engineering of a dual emission near-infrared ratiometric fluorophore for detection of ph at the organism level

Supporting Information. Molecular engineering of a dual emission near-infrared ratiometric fluorophore for detection of ph at the organism level Electronic Supplementary Material (ESI) for Analyst. This journal is The Royal Society of Chemistry 2015 Supporting Information Molecular engineering of a dual emission near-infrared ratiometric fluorophore

More information

Physical Methods in Models of Cataract Disease. O. P. Srivastava Department of Vision Science University of Alabama at Birmingham

Physical Methods in Models of Cataract Disease. O. P. Srivastava Department of Vision Science University of Alabama at Birmingham Physical Methods in Models of Cataract Disease O. P. Srivastava Department of Vision Science University of Alabama at Birmingham Function of the Lens: Refraction Lens Specific Structural Proteins (α-,

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Michaelis-Menten kinetics of glucose oxidase. The initial activity of GOx in various concentrations of glucose was determined by the HRP-coupled colorimetric assay with 1 nm GOx and

More information

SPARK. Southern Illinois University Edwardsville. Drake Jensen Southern Illinois University Edwardsville,

SPARK. Southern Illinois University Edwardsville. Drake Jensen Southern Illinois University Edwardsville, Southern Illinois University Edwardsville SPARK Chemistry Faculty Research, Scholarship, and Creative Activity Chemistry Spring 2-15-2015 The exchanged EF-hands in calmodulin and troponin C chimeras impair

More information

SUPRAMOLECULAR RECOGNITION OF CWAs SIMULANT BY METAL- SALEN COMPLEXES: THE FIRST MULTI-TOPIC APPROACH

SUPRAMOLECULAR RECOGNITION OF CWAs SIMULANT BY METAL- SALEN COMPLEXES: THE FIRST MULTI-TOPIC APPROACH Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2018 SUPRAMOLECULAR RECOGNITION OF CWAs SIMULANT BY METAL- SALEN COMPLEXES: THE FIRST MULTI-TOPIC APPROACH

More information

Supplementary Information. Human Antibody-Based Chemically Induced Dimerizers for Cell Therapeutic Applications

Supplementary Information. Human Antibody-Based Chemically Induced Dimerizers for Cell Therapeutic Applications Supplementary Information Human Antibody-Based Chemically Induced Dimerizers for Cell Therapeutic Applications Zachary B Hill 1,4, Alexander J Martinko 1,2,4, Duy P Nguyen 1 & James A Wells *1,3 1 Department

More information

Supplementary Information

Supplementary Information Supplementary Information Nonlinear optical dye TSQ1 as an efficiently selective fluorescent probe for G-quadruplex DNA Yuqi Chen a, Shengyong Yan a, Libo Yuan a, Weng* a and Xiang Zhou* a b Yimin Zhou

More information

Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure

Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure ME-10-0005 Conformation of the Mineralocorticoid Receptor N- terminal Domain: Evidence for Induced and Stable Structure Katharina Fischer 1, Sharon M. Kelly 2, Kate Watt 1, Nicholas C. Price 2 and Iain

More information

Spectroscopic Investigation into Minor Groove Binders Designed to Selectively Target DNA Sequences

Spectroscopic Investigation into Minor Groove Binders Designed to Selectively Target DNA Sequences Georgia State University ScholarWorks @ Georgia State University Chemistry Theses Department of Chemistry 12-4-2015 Spectroscopic Investigation into Minor Groove Binders Designed to Selectively Target

More information

Supporting Information

Supporting Information Supporting Information Copper and zinc ions specifically promote non-amyloid aggregation of the highly stable human γ-d crystallin Liliana Quintanar, 1,* José A. Domínguez-Calva, 1 Eugene Serebryany, 2

More information

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain

Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain Supplementatry Fig 1. Domain structure, biophysical characterisation and electron microscopy of a TD. (a) XTACC3/Maskin and XMAP215/chTOG domain architecture. Various C-terminal fragments were cloned and

More information

Supplemental Information. A Visible and Near-Infrared, Dual-Channel. Fluorescence-On Probe for Selectively. Tracking Mitochondrial Glutathione

Supplemental Information. A Visible and Near-Infrared, Dual-Channel. Fluorescence-On Probe for Selectively. Tracking Mitochondrial Glutathione Chem, Volume 4 Supplemental Information A Visible and Near-Infrared, Dual-Channel Fluorescence-On Probe for Selectively Tracking Mitochondrial Glutathione Zhiqiang Xu, Xiaoting Huang, Xie Han, Di Wu, Bibo

More information

Randomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity

Randomly arrayed G-rich DNA sequence for label-free and realtime. assay of enzyme activity Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Randomly arrayed G-rich DNA sequence for label-free and realtime assay of enzyme activity Zhuoliang

More information

model of mechanism of action of the TB drug TMC207 European Molecular Biology Laboratory, Hamburg Outstation, EMBL c/o DESY, D-22603

model of mechanism of action of the TB drug TMC207 European Molecular Biology Laboratory, Hamburg Outstation, EMBL c/o DESY, D-22603 Variations of subunit of the Mycobacterium tuberculosis F-ATPsynthase and a novel model of mechanism of action of the TB drug TMC207 Goran Biuković 1, Sandip Basak 1, Malathy Sony Subramanian Manimekalai

More information

Supplementary Figure 1 a

Supplementary Figure 1 a 3 min PMA 45 min PMA AnnexinV-FITC Supplementary Figure 1 5 min PMA 15 min PMA a 9 min PMA 12 min PMA 5 min FGF7 15 min FGF7 3 min FGF7 6 min FGF7 9 min FGF7 12 min FGF7 5 min control 3 min control 6 min

More information

High-Affinity Binding of Monomeric but Not Oligomeric Amyloid-β to Ganglioside GM1 Containing Nanodiscs

High-Affinity Binding of Monomeric but Not Oligomeric Amyloid-β to Ganglioside GM1 Containing Nanodiscs Supporting information High-Affinity Binding of Monomeric but Not Oligomeric Amyloid-β to Ganglioside GM1 Containing Nanodiscs Maren Thomaier 1,2, Lothar Gremer 1,2, Christina Dammers 1, Judith Fabig 1,

More information

Electronic Supplementary Information. Fibrillation Kinetics of Aβ(1-40) Peptide Depend on Surface Curvature at Nano-Bio Interfaces

Electronic Supplementary Information. Fibrillation Kinetics of Aβ(1-40) Peptide Depend on Surface Curvature at Nano-Bio Interfaces Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2017 Electronic Supplementary Information Submitted to Nanoscale Fibrillation Kinetics of Aβ(1-40)

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 214 Electronic Supplementary Information Construction of DNA logic gates utilizing an H + /Ag + induced

More information

in the RediPlate 96 EnzChek Serine/Threonine Phosphatase (R-33700) Storage upon receipt: Ex/Em: 358/452 nm Introduction

in the RediPlate 96 EnzChek Serine/Threonine Phosphatase (R-33700) Storage upon receipt: Ex/Em: 358/452 nm Introduction Product Information Revised: 23 September 2002 (R-33700) Storage upon receipt: 20 C Desiccate Protect from light Ex/Em: 358/452 nm Introduction Molecular Probes RediPlate 96 EnzChek Serine/Threonine Phosphatase

More information

Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible.

Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Supplementary Figure 1. Antibody-induced cargo release studied by native PAGE. A clear band corresponding to the cargo strand (lane 1) is visible. Because SYBR Gold is less sensitive to single stranded

More information

PHF20 is an effector protein of p53 double lysine methylation

PHF20 is an effector protein of p53 double lysine methylation SUPPLEMENTARY INFORMATION PHF20 is an effector protein of p53 double lysine methylation that stabilizes and activates p53 Gaofeng Cui 1, Sungman Park 2, Aimee I Badeaux 3, Donghwa Kim 2, Joseph Lee 1,

More information

Supplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch

Supplementary Information. Single-molecule analysis reveals multi-state folding of a guanine. riboswitch Supplementary Information Single-molecule analysis reveals multi-state folding of a guanine riboswitch Vishnu Chandra 1,4,#, Zain Hannan 1,5,#, Huizhong Xu 2,# and Maumita Mandal 1,2,3,6* Department of

More information

Supplementary Note 1: Estimation of the number of the spectroscopic units inside the single Pdots

Supplementary Note 1: Estimation of the number of the spectroscopic units inside the single Pdots Supplementary Note 1: Estimation of the number of the spectroscopic units inside the single Pdots The number of the CP chains inside each PD1-L and PD2-L particle was estimated to be 28 and 444 chains/particle,respectively,

More information

SUPPLEMENTARY FIGURES

SUPPLEMENTARY FIGURES SUPPLEMENTARY FIGURES Supplementary Figure S1. Generation of a synaptobrevin2-mrfp knock-in mouse. (a) Targeting strategy of Syb2-mRFP knock-in mouse leaving the synaptobrevin2 gene locus intact except

More information

Supporting Information for. Differential Enzyme Flexibility Probed using Solid-State Nanopores

Supporting Information for. Differential Enzyme Flexibility Probed using Solid-State Nanopores Supporting Information for Differential Enzyme Flexibility Probed using Solid-State Nanopores Rui Hu 1, 2, João V. Rodrigues 3, Pradeep Waduge 4, Hirohito Yamazaki 4, Benjamin Cressiot 4, Yasmin Chishti

More information

Supplementary Information

Supplementary Information 1 upplementary Information Membrane targeting mechanism of Rab GTPases elucidated by semisynthetic prenylated protein probes Yao-Wen Wu*,, Lena K. esterlin, Kui-Thong Tan, erbert Waldmann, Kirill Alexandrov

More information

Supporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions

Supporting Information. DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Supporting Information DNA Tetraplexes-Based Toehold Activation for Controllable DNA Strand Displacement Reactions Wei Tang, Huaming Wang, Dingzhong Wang, Yan Zhao, Na Li, and Feng Liu* Beijing National

More information

BD Ratiometric Calcium Assay Kit

BD Ratiometric Calcium Assay Kit BD Technical Data Sheet BD Ratiometric Calcium Assay Kit Product Information Catalog Number: 644243 Components: Ratiometric Calcium Indicator, 1 vial, lyophilized 10X Signal Enhancer, 10 ml Calcium Assay

More information

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle

Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Introduction Figure 1. Transcreener Kinase Assay Principle Simplifying Kinase Profiling Using ADP Detection with the Transcreener Kinase Assay Karen M. Kleman-Leyer, Tony A. Klink, Thane A. Westermeyer and Robert G. Lowery Introduction A variety of HTS kinase

More information

Cell position. Edge. Core Mean Std. Deviation

Cell position. Edge. Core Mean Std. Deviation Diameter (um) 20 *** 15 10 5 0 Edge Cell position Core Mean Std. Deviation Edge 10.69 2.664 Core 12.61 2.632 Supplementary Figure S1: Measuring cell diameter. Cell diameters were obtained by ImageJ using

More information

Binding of Euplotes Octocarinatus centrin with target peptide melittin

Binding of Euplotes Octocarinatus centrin with target peptide melittin Chinese Science Bulletin 2007 SCIENCE IN CHINA PRESS Springer Binding of Euplotes Octocarinatus centrin with target peptide melittin ZHAO YaQin 1, FENG JiuYing 1, LIANG AiHua 2 & YANG BinSheng 1 1 Institute

More information

A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations

A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations Supporting Information for A nucleic acid-based fluorescent sensor for expeditious detection of pyrophosphate anions at nanomolar concentrations Xin Su, Chen Zhang, Xianjin Xiao, Anqin Xu, Zhendong Xu

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Information Fluorescence Turn-On Detection of a Protein through the Displaced Single-Stranded DNA Binding Protein Binding to a Molecular Beacon Dan Tang, abc Dongli Liao, ab Qiankun

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Contents: Supplementary Figure 1. Additional structural and binding data for designed tuim peptides. Supplementary Figure 2. Subcellular localization patterns of designed tuim

More information

G-Quadruplex formation using fluorescent oligonucleotide as a detection method for discriminating AGG trinucleotide repeats

G-Quadruplex formation using fluorescent oligonucleotide as a detection method for discriminating AGG trinucleotide repeats Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 1 Electronic Supplementary Information G-Quadruplex formation using fluorescent oligonucleotide as a

More information

protocol DNaseAlert Substrate Nuclease Detection System User Manual molecular biology reagents See what we can do for you at

protocol DNaseAlert Substrate Nuclease Detection System User Manual molecular biology reagents See what we can do for you at molecular biology reagents protocol DNaseAlert Substrate Nuclease Detection System User Manual See what we can do for you at www.idtdna.com. For Research Use Only. (14-01-01-13) protocol molecular biology

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature08627 Supplementary Figure 1. DNA sequences used to construct nucleosomes in this work. a, DNA sequences containing the 601 positioning sequence (blue)24 with a PstI restriction site

More information

Supporting Information. An Aptazyme-Gold Nanoparticle Sensor for Amplified. Molecular Probing in Living Cells

Supporting Information. An Aptazyme-Gold Nanoparticle Sensor for Amplified. Molecular Probing in Living Cells Supporting Information n ptazyme-gold Nanoparticle Sensor for mplified Molecular Probing in Living Cells Yanjing Yang, Jin Huang*, Xiaohai Yang, Ke Quan, He Wang, Le Ying, Nuli Xie, Min Ou, Kemin Wang*

More information

Ratiometric Calcium Assay Kit

Ratiometric Calcium Assay Kit BD Technical Data Sheet Ratiometric Calcium Assay Kit Product Information Catalog Number: 644244 Components: Ratiometric Calcium Indicator, 10 vials, lyophilized 10X Signal Enhancer, 100 ml Description

More information

Supplementary Figure 1. WT ph 4.5. γ (ion s

Supplementary Figure 1. WT ph 4.5. γ (ion s Supplementary Figure 1 a WT ph 4.5 b 10 5 γ (ion s 1 ) 10 4 10 3 10 2 WT Y445A EA/YA E148A µcal s 1 Supplementary Figure 1 ph dependence of Cl transport and binding. a) Cl transport rates at ph 7.5 (white)

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION A biomimetic DNA-based channel for the ligand-controlled transport of charged molecular cargo across a biological membrane Jonathan R. Burns, Astrid Seifert, Niels Fertig, Stefan Howorka NATURE NANOTECHNOLOGY

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION DOI: 10.1038/ncb3363 Supplementary Figure 1 Several WNTs bind to the extracellular domains of PKD1. (a) HEK293T cells were co-transfected with indicated plasmids. Flag-tagged proteins were immunoprecipiated

More information

One-Electron Oxidation of DNA: Thymine versus Guanine Reactivity

One-Electron Oxidation of DNA: Thymine versus Guanine Reactivity One-Electron Oxidation of DNA: Thymine versus Guanine Reactivity Sriram Kanvah and Gary B Schuster SUPPORTING INFORMATION EXPERIMENTAL PROCEDURES T4 polynucleotide Kinase (T4 PNK) was purchased from New

More information

Department of Chemistry at Lehman College City University of New York

Department of Chemistry at Lehman College City University of New York Department of Chemistry at Lehman College City University of New York Biochemistry Laboratory, CHE 447, Syllabus, Spring 2011. Instructor: Cristina C. Clement, Ph.D., Chemistry Department, Lehman College,

More information

Recovery of the Formation and Function of Oxidized G-Quadruplexes by a Pyrenemodified

Recovery of the Formation and Function of Oxidized G-Quadruplexes by a Pyrenemodified Supporting Information Recovery of the Formation and Function of Oxidized G-Quadruplexes by a Pyrenemodified Guanine Tract Shuntaro Takahashi, Ki Tae Kim, Peter Podbevsek, Janez Plavec, Byeang Hyean Kim,

More information

Fast, three-dimensional super-resolution imaging of live cells

Fast, three-dimensional super-resolution imaging of live cells Nature Methods Fast, three-dimensional super-resolution imaging of live cells Sara A Jones, Sang-Hee Shim, Jiang He & Xiaowei Zhuang Supplementary Figure 1 Supplementary Figure 2 Supplementary Figure 3

More information

Visualizing mechanical tension across membrane receptors with a fluorescent sensor

Visualizing mechanical tension across membrane receptors with a fluorescent sensor Nature Methods Visualizing mechanical tension across membrane receptors with a fluorescent sensor Daniel R. Stabley, Carol Jurchenko, Stephen S. Marshall, Khalid S. Salaita Supplementary Figure 1 Fabrication

More information

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches

The mechanism(s) of protein folding. What is meant by mechanism. Experimental approaches The mechanism(s) of protein folding What is meant by mechanism Computational approaches Experimental approaches Questions: What events occur and in what time sequence when a protein folds Is there a specified

More information

Tyrosine Kinase Assay Kit, Red*

Tyrosine Kinase Assay Kit, Red* Rh Tyrosine Kinase Assay Kit, Red* 1.0 INTRODUCTION Part # P2882, P2883 Lit. # L0531 Rev. 11/02 Page 1 of 6 The phosphorylation of proteins by protein tyrosine kinases (PTKs) is critical to the normal

More information

nanodsf 2bind: Your service provider for biophysical characterization of proteins Precisely revealing protein folding and stability

nanodsf 2bind: Your service provider for biophysical characterization of proteins Precisely revealing protein folding and stability nanodsf Precisely revealing protein folding and stability 2bind: Your service provider for biophysical characterization of proteins This booklet was written and designed by 2bind 08 2015 Any reproduction

More information

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al.,

JCB. Supplemental material THE JOURNAL OF CELL BIOLOGY. Hong et al., Supplemental material JCB Hong et al., http://www.jcb.org/cgi/content/full/jcb.201412127/dc1 THE JOURNAL OF CELL BIOLOGY Figure S1. Analysis of purified proteins by SDS-PAGE and pull-down assays. (A) Coomassie-stained

More information

Cell Surface-Anchored Fluorescent Aptamer Sensor Enables. Imaging of Chemical Transmitter Dynamics

Cell Surface-Anchored Fluorescent Aptamer Sensor Enables. Imaging of Chemical Transmitter Dynamics Supporting Information for Cell Surface-Anchored Fluorescent Aptamer Sensor Enables Imaging of Chemical Transmitter Dynamics Takeshi Tokunaga, Shigeyuki Namiki, Katsuhiro Yamada, Takahiro Imaishi, Hiroshi

More information

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide

ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide ARBRE-P4EU Consensus Protein Quality Guidelines for Biophysical and Biochemical Studies Minimal information to provide Protein name and full primary structure, by providing a NCBI (or UniProt) accession

More information

Application of Biacore Technology

Application of Biacore Technology Principles and typical results Application of Biacore Technology Common types of Biacore analyses Specificity analysis Is my molecule of interest specific for its target? Multiple binding analysis In which

More information

Box 7905, Engineering Building I, North Carolina State University, Raleigh, NC 27695, Phone: Fax:

Box 7905, Engineering Building I, North Carolina State University, Raleigh, NC 27695, Phone: Fax: Inefficient ribosomal skipping enables simultaneous secretion and display of proteins in Saccharomyces cerevisiae Carlos A. Cruz-Teran 1, Karthik Tiruthani 1, Adam Mischler, and Balaji M. Rao * Department

More information

Supplementary Note 1. Enzymatic properties of the purified Syn BVR

Supplementary Note 1. Enzymatic properties of the purified Syn BVR Supplementary Note 1. Enzymatic properties of the purified Syn BVR The expression vector pet15b-syn bvr allowed us to routinely prepare 15 mg of electrophoretically homogenous Syn BVR from 2.5 L of TB-medium

More information

Optically Controlled Reversible Protein Hydrogels Based on Photoswitchable Fluorescent Protein Dronpa. Electronic Supplementary Information

Optically Controlled Reversible Protein Hydrogels Based on Photoswitchable Fluorescent Protein Dronpa. Electronic Supplementary Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Optically Controlled Reversible Protein Hydrogels Based on Photoswitchable Fluorescent Protein

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary figures Supplementary Figure 1: Suv39h1, but not Suv39h2, promotes HP1α sumoylation in vivo. In vivo HP1α sumoylation assay. Top: experimental scheme. Middle: we

More information

Supplementary Information. Tau co-organizes dynamic microtubule and actin networks. and Isabelle Arnal 1,2,*

Supplementary Information. Tau co-organizes dynamic microtubule and actin networks. and Isabelle Arnal 1,2,* Supplementary Information Tau co-organizes dynamic microtubule and actin networks Auréliane Elie 1,2, Elea Prezel 1,2, Christophe Guérin 3, Eric Denarier 1,2,4, Sacnicte Ramirez- Rios 1,2, Laurence Serre

More information

Supplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct

Supplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct Supplementary information to eif4b stimulates eif4a ATPase and unwinding activities by direct interaction through its 7-repeats region, Alexandra Z. Andreou, Ulf Harms & Dagmar Klostermeier. Supplementary

More information

Fluorescence spectroscopy

Fluorescence spectroscopy Fluorescence spectroscopy The light: electromagnetic wave Tamás Huber Biophysics seminar Dept. of Biophysics, University of Pécs 05-07. February 2013. Luminescence: light emission of an excited system.

More information

ADP TR-FRET Green Assay

ADP TR-FRET Green Assay TR-FRET ADP TR-FRET Green Assay Technical Manual v072209 Transcreener ADP TR-FRET Green Assay Instructions for Part Numbers 3005-1K and 3005-10K 1.0 Introduction p.2 2.0 Assay Components p.3 3.0 Protocol

More information

Calcium binding proteins in malaria and heart disease

Calcium binding proteins in malaria and heart disease Calcium binding proteins in malaria and heart disease Patrik Lundström Department of Physics, Chemistry and Biology, Linköping University patlu@ifm.liu.se Vetenskapsdag 2016-10-06 Outline Nuclear magnetic

More information